| Definition | Sinorhizobium meliloti AK83 chromosome chromosome 1, complete sequence. |
|---|---|
| Accession | NC_015590 |
| Length | 3,820,344 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 19 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 275384..277192 | PHAGE_Rhodob_RcapNL: P4 family phage/plasmid primase; Sinme_0254; phage(gi461475021) | 2e-56 | Click |
| 2 | 277470..278264 | hypothetical protein; Sinme_0255 | N/A | Click |
| 3 | 278432..279178 | PHAGE_Synech_S_CBS1: hypothetical protein; Sinme_0256; phage(gi356870837) | 5e-08 | Click |
| 4 | 279328..279969 | hypothetical protein; Sinme_0257 | N/A | Click |
| 5 | 279966..282008 | PHAGE_Synech_S_CBS1: large terminase subunit; Sinme_0258; phage(gi356870795) | 5e-47 | Click |
| 6 | 282019..282255 | PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; Sinme_0259; phage(gi169257234) | 9e-05 | Click |
| 7 | 282252..283976 | PHAGE_Salmon_SPN19: putative lambda family portal protein B; Sinme_0260; phage(gi414090190) | 1e-69 | Click |
| 8 | 283973..284878 | PHAGE_Entero_HK630: head maturation protease C; Sinme_0261; phage(gi428782792) | 1e-43 | Click |
| 9 | 284904..285446 | PHAGE_Ovine__2: ORF73; Sinme_0262; phage(gi83642908) | 9e-07 | Click |
| 10 | 285449..285805 | hypothetical protein; Sinme_0263 | N/A | Click |
| 11 | 285833..286864 | PHAGE_Burkho_AH2: major capsid protein; Sinme_0264; phage(gi399529101) | 3e-39 | Click |
| 12 | 286939..287343 | PHAGE_Maruca_MNPV: PE38; Sinme_0265; phage(gi119964655) | 1e-04 | Click |
| 13 | 287340..287666 | hypothetical protein; Sinme_0266 | N/A | Click |
| 14 | 287669..287965 | hypothetical protein; Sinme_0267 | N/A | Click |
| 15 | 287967..288431 | PHAGE_Synech_S_CBS3: hypothetical protein; Sinme_0268; phage(gi331028017) | 2e-05 | Click |
| 16 | 288524..288934 | PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; Sinme_0269; phage(gi461474972) | 2e-14 | Click |
| 17 | 288947..289348 | hypothetical protein; Sinme_0270 | N/A | Click |
| 18 | complement(289588..289767) | hypothetical protein; Sinme_0271 | N/A | Click |
| 19 | 289870..291741 | PHAGE_Synech_S_CBS1: tail tape measure protein; Sinme_0272; phage(gi356870809) | 1e-08 | Click |
Region 2, total : 21 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 794781..794792 | attL ACTCCGTTCGGA | N/A | Click |
| 2 | complement(795174..796262) | PHAGE_Cronob_ENT47670: integrase; Sinme_0764; phage(gi431810502) | 1e-05 | Click |
| 3 | 796292..796549 | hypothetical protein; Sinme_0765 | N/A | Click |
| 4 | complement(796447..796767) | hypothetical protein; Sinme_0766 | N/A | Click |
| 5 | complement(796764..797669) | hypothetical protein; Sinme_0767 | N/A | Click |
| 6 | complement(797659..798015) | HNH nuclease; Sinme_0768 | N/A | Click |
| 7 | complement(798012..798374) | PHAGE_Sinorh_PBC5: hypothetical protein PBC5p74; Sinme_0769; phage(gi18071285) | 1e-48 | Click |
| 8 | complement(798371..799096) | PHAGE_Sinorh_PBC5: hypothetical protein PBC5p72; Sinme_0770; phage(gi18071239) | 5e-34 | Click |
| 9 | complement(799096..799773) | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; Sinme_0771; phage(gi428782758) | 1e-17 | Click |
| 10 | complement(799770..800012) | hypothetical protein; Sinme_0772 | N/A | Click |
| 11 | complement(800009..801025) | PHAGE_Sinorh_PBC5: hypothetical protein PBC5p75; Sinme_0773; phage(gi18071268) | 3e-141 | Click |
| 12 | complement(801022..801240) | hypothetical protein; Sinme_0774 | N/A | Click |
| 13 | complement(801237..801488) | hypothetical protein; Sinme_0775 | N/A | Click |
| 14 | complement(801485..802006) | PHAGE_Azospi_Cd: hypothetical protein APCd_gp83; Sinme_0776; phage(gi168495186) | 7e-35 | Click |
| 15 | complement(802008..803027) | phage recombination protein Bet; Sinme_0777 | N/A | Click |
| 16 | complement(803030..803560) | PHAGE_Lister_A500: gp43; Sinme_0778; phage(gi157325002) | 8e-10 | Click |
| 17 | complement(803562..803798) | hypothetical protein; Sinme_0779 | N/A | Click |
| 18 | complement(803840..804169) | hypothetical protein; Sinme_0780 | N/A | Click |
| 19 | complement(804185..804586) | hypothetical protein; Sinme_0781 | N/A | Click |
| 20 | 805025..805420 | hypothetical protein; Sinme_0782 | N/A | Click |
| 21 | complement(805421..806212) | PHAGE_Haemop_SuMu: transcription regulator; Sinme_0783; phage(gi418489036) | 4e-14 | Click |
| 22 | 806295..806498 | PHAGE_Entero_mEp237: prophage anti-repressor; Sinme_0784; phage(gi435439305) | 9e-05 | Click |
| 23 | 811003..811014 | attR ACTCCGTTCGGA | N/A | Click |
Region 3, total : 29 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 815974..816474 | PHAGE_Salmon_SPN1S: terminase small subunit; Sinme_0804; phage(gi374531192) | 7e-06 | Click |
| 2 | 816550..817809 | PHAGE_Strept_6: terminase large subunit; Sinme_0805; phage(gi93007440) | 1e-39 | Click |
| 3 | 817818..819635 | PHAGE_Iodoba_phiPLPE: gp19 putative portal protein; Sinme_0806; phage(gi197085633) | 5e-55 | Click |
| 4 | complement(819636..819866) | hypothetical protein; Sinme_0807 | N/A | Click |
| 5 | 819894..821039 | PHAGE_Iodoba_phiPLPE: gp27 putative head protein; Sinme_0808; phage(gi197085641) | 2e-42 | Click |
| 6 | 821052..821522 | PHAGE_Iodoba_phiPLPE: hypothetical protein phiPLPE_28; Sinme_0809; phage(gi197085642) | 4e-07 | Click |
| 7 | 821548..822525 | PHAGE_Iodoba_phiPLPE: gp29 major capsid protein; Sinme_0810; phage(gi197085643) | 3e-18 | Click |
| 8 | 822541..822882 | hypothetical protein; Sinme_0811 | N/A | Click |
| 9 | 822934..823428 | PHAGE_Pseudo_vB_Pae_Kakheti25: virion protein; Sinme_0812; phage(gi388542673) | 5e-06 | Click |
| 10 | complement(823452..823613) | hypothetical protein; Sinme_0813 | N/A | Click |
| 11 | 823694..824056 | PHAGE_Pseudo_MP1412: structural protein; Sinme_0814; phage(gi399529026) | 9e-08 | Click |
| 12 | complement(824063..824353) | hypothetical protein; Sinme_0815 | N/A | Click |
| 13 | 824419..824586 | hypothetical protein; Sinme_0816 | N/A | Click |
| 14 | 824583..824864 | hypothetical protein; Sinme_0817 | N/A | Click |
| 15 | 824923..825921 | PHAGE_Roseob_1: head morphogenesis protein; Sinme_0818; phage(gi331028124) | 9e-20 | Click |
| 16 | 825921..826403 | PHAGE_Salico_CGphi29: hypothetical protein; Sinme_0819; phage(gi472340179) | 8e-14 | Click |
| 17 | complement(826342..826560) | hypothetical protein; Sinme_0820 | N/A | Click |
| 18 | 826577..827008 | hypothetical protein; Sinme_0821 | N/A | Click |
| 19 | 827065..827802 | PHAGE_Cyanop_S_TIM5: tail fiber protein; Sinme_0822; phage(gi422936163) | 1e-07 | Click |
| 20 | 827802..828215 | hypothetical protein; Sinme_0823 | N/A | Click |
| 21 | 828563..831424 | PHAGE_Rhodov_RS1: hypothetical protein; Sinme_0824; phage(gi472342924) | 2e-20 | Click |
| 22 | 831428..832162 | PHAGE_Rhizob_3: p018; Sinme_0825; phage(gi195546549) | 1e-07 | Click |
| 23 | 832162..832767 | hypothetical protein; Sinme_0826 | N/A | Click |
| 24 | 832770..833189 | PHAGE_Rhodob_RcapNL: hypothetical protein; Sinme_0827; phage(gi461474979) | 2e-05 | Click |
| 25 | 833186..835786 | PHAGE_Rhizob_3: putative tail fiber protein H; Sinme_0828; phage(gi195546553) | 3e-41 | Click |
| 26 | 835839..837581 | PHAGE_Cyanop_PSS2: capsid decoration protein; Sinme_0829; phage(gi254729536) | 4e-07 | Click |
| 27 | complement(837623..837901) | hypothetical protein; Sinme_0830 | N/A | Click |
| 28 | 837988..838374 | hypothetical protein; Sinme_0831 | N/A | Click |
| 29 | complement(838371..839108) | PHAGE_Synech_S_CRM01: glycosyl transferase; Sinme_0832; phage(gi333798250) | 9e-10 | Click |
Region 4, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1366297..1366310 | attL CTCGGCCGCGATCA | N/A | Click |
| 2 | complement(1372696..1375560) | PHAGE_Cyanop_MED4_213: glycine dehydrogenase; Sinme_1350; phage(gi472340385) | 0.0 | Click |
| 3 | complement(1375560..1375922) | glycine cleavage system H protein; Sinme_1351 | N/A | Click |
| 4 | complement(1375939..1377078) | glycine cleavage system T protein; Sinme_1352 | N/A | Click |
| 5 | 1377501..1378709 | PROPHAGE_Escher_CFT073: putative prophage integrase; Sinme_1353; phage(gi26250313) | 8e-68 | Click |
| 6 | complement(1378764..1378952) | PHAGE_Burkho_Bcep176: gp32; Sinme_1354; phage(gi77864657) | 2e-10 | Click |
| 7 | 1379082..1379285 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1355; phage(gi472341398) | 6e-09 | Click |
| 8 | 1379285..1379947 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1356; phage(gi472341399) | 5e-22 | Click |
| 9 | 1379937..1382039 | PHAGE_Loktan_pCB2051_A: terminase large subunit; Sinme_1357; phage(gi472341400) | 0.0 | Click |
| 10 | 1382153..1382374 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1358; phage(gi472341401) | 7e-06 | Click |
| 11 | 1382376..1384202 | PHAGE_Loktan_pCB2051_A: portal protein; Sinme_1359; phage(gi472341402) | 3e-138 | Click |
| 12 | 1384192..1385514 | PHAGE_Loktan_pCB2051_A: peptidase; Sinme_1360; phage(gi472341403) | 3e-103 | Click |
| 13 | 1385559..1385999 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1361; phage(gi472341404) | 7e-10 | Click |
| 14 | 1386038..1387129 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1362; phage(gi472341405) | 1e-28 | Click |
| 15 | 1387220..1387561 | hypothetical protein; Sinme_1363 | N/A | Click |
| 16 | 1387561..1387938 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1364; phage(gi472341407) | 5e-20 | Click |
| 17 | 1387938..1388522 | PHAGE_Burkho_AH2: hypothetical protein; Sinme_1365; phage(gi399529098) | 2e-34 | Click |
| 18 | 1388519..1389052 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1366; phage(gi472341408) | 7e-38 | Click |
| 19 | 1389102..1389890 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1367; phage(gi472341409) | 4e-65 | Click |
| 20 | 1389920..1390348 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1368; phage(gi472341410) | 3e-14 | Click |
| 21 | 1390598..1395649 | PHAGE_Loktan_pCB2051_A: tail length tape measure protein; Sinme_1369; phage(gi472341411) | 3e-156 | Click |
| 22 | 1395649..1396887 | PHAGE_Pseudo_B3: hypothetical protein B3ORF52; Sinme_1370; phage(gi56692621) | 1e-65 | Click |
| 23 | 1396889..1397704 | PHAGE_Provid_Redjac: conserved tail assembly protein; Sinme_1371; phage(gi410490763) | 8e-60 | Click |
| 24 | 1397716..1397952 | PHAGE_Salmon_SPN19: putative tail assembly protein 1; Sinme_1372; phage(gi414090176) | 5e-17 | Click |
| 25 | 1397949..1398164 | PHAGE_Pseudo_MP1412: hypothetical protein; Sinme_1373; phage(gi399529037) | 6e-10 | Click |
| 26 | 1398157..1400361 | PHAGE_Burkho_BcepNazgul: conserved tail assembly protein; Sinme_1374; phage(gi34610151) | 8e-161 | Click |
| 27 | 1400416..1401615 | PHAGE_Loktan_pCB2051_A: hypothetical protein; Sinme_1375; phage(gi472341422) | 4e-59 | Click |
| 28 | 1401612..1402523 | PHAGE_Entero_Enc34: phage structural protein; Sinme_1376; phage(gi422936811) | 2e-42 | Click |
| 29 | 1411243..1411256 | attR CTCGGCCGCGATCA | N/A | Click |
Region 5, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1840535..1841368) | PROPHAGE_Xantho_33913: IS1480 transposase; Sinme_1824; phage(gi21231089) | 6e-27 | Click |
| 2 | 1841638..1841742 | hypothetical protein; Sinme_1825 | N/A | Click |
| 3 | complement(1841974..1842300) | PHAGE_Rhodob_RcapNL: hypothetical protein; Sinme_1826; phage(gi461474983) | 1e-29 | Click |
| 4 | complement(1842301..1842666) | PHAGE_Agroba_7_7_1: hypothetical protein; Sinme_1827; phage(gi435844352) | 6e-17 | Click |
| 5 | complement(1842666..1843481) | PHAGE_Synech_S_SSM7: putative transmembrane protein; Sinme_1828; phage(gi326783672) | 8e-07 | Click |
| 6 | complement(1843743..1844078) | hypothetical protein; Sinme_1829 | N/A | Click |
| 7 | complement(1844065..1844412) | PHAGE_Pseudo_MP42: hypothetical protein; Sinme_1830; phage(gi399528628) | 3e-15 | Click |
| 8 | complement(1844412..1845512) | PHAGE_Pseudo_MP42: hypothetical protein; Sinme_1831; phage(gi399528627) | 8e-09 | Click |
| 9 | complement(1845524..1847059) | hypothetical protein; Sinme_1832 | N/A | Click |
| 10 | complement(1847059..1849716) | PHAGE_Salmon_SSU5: putative phage tail protein; Sinme_1833; phage(gi410491430) | 3e-12 | Click |
Region 6, total : 19 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1851465..1853336) | PHAGE_Synech_S_CBS1: tail tape measure protein; Sinme_1837; phage(gi356870809) | 3e-08 | Click |
| 2 | 1853430..1853609 | hypothetical protein; Sinme_1838 | N/A | Click |
| 3 | complement(1853849..1854250) | hypothetical protein; Sinme_1839 | N/A | Click |
| 4 | complement(1854263..1854673) | PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; Sinme_1840; phage(gi461474972) | 2e-14 | Click |
| 5 | complement(1854766..1855230) | hypothetical protein; Sinme_1841 | N/A | Click |
| 6 | complement(1855232..1855528) | hypothetical protein; Sinme_1842 | N/A | Click |
| 7 | complement(1855531..1855857) | hypothetical protein; Sinme_1843 | N/A | Click |
| 8 | complement(1855854..1856321) | PHAGE_Emilia_86: hypothetical protein EhV247; Sinme_1844; phage(gi73852718) | 3e-06 | Click |
| 9 | complement(1856396..1857427) | PHAGE_Burkho_AH2: major capsid protein; Sinme_1845; phage(gi399529101) | 9e-41 | Click |
| 10 | complement(1857455..1857811) | hypothetical protein; Sinme_1846 | N/A | Click |
| 11 | complement(1857814..1858365) | PHAGE_Mycoba_Gumball: gp62; Sinme_1847; phage(gi206599766) | 1e-05 | Click |
| 12 | complement(1858391..1859296) | PHAGE_Entero_HK630: head maturation protease C; Sinme_1848; phage(gi428782792) | 3e-41 | Click |
| 13 | complement(1859293..1861017) | PHAGE_Salmon_SPN19: putative lambda family portal protein B; Sinme_1849; phage(gi414090190) | 2e-69 | Click |
| 14 | complement(1861014..1861250) | PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; Sinme_1850; phage(gi169257234) | 2e-05 | Click |
| 15 | complement(1861261..1863303) | PHAGE_Synech_S_CBS1: large terminase subunit; Sinme_1851; phage(gi356870795) | 2e-47 | Click |
| 16 | complement(1863300..1863938) | hypothetical protein; Sinme_1852 | N/A | Click |
| 17 | complement(1864082..1864828) | PHAGE_Synech_S_CBS1: hypothetical protein; Sinme_1853; phage(gi356870837) | 2e-08 | Click |
| 18 | complement(1865068..1865733) | NusG antitermination factor; Sinme_1854 | N/A | Click |
| 19 | complement(1865717..1866982) | PHAGE_Geobac_GBSV1: phage replication protein; Sinme_1855; phage(gi115334613) | 1e-12 | Click |
Region 7, total : 21 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2315304..2317727) | PHAGE_Rhizob_3: putative tail fiber protein H; Sinme_2298; phage(gi195546553) | 7e-33 | Click |
| 2 | complement(2317712..2318110) | hypothetical protein; Sinme_2299 | N/A | Click |
| 3 | complement(2318110..2318703) | hypothetical protein; Sinme_2300 | N/A | Click |
| 4 | complement(2318703..2319383) | PHAGE_Rhizob_3: p018; Sinme_2301; phage(gi195546549) | 5e-20 | Click |
| 5 | complement(2319386..2321323) | PHAGE_Synech_S_CBS1: tail tape measure protein; Sinme_2302; phage(gi356870809) | 2e-37 | Click |
| 6 | complement(2321615..2321980) | hypothetical protein; Sinme_2303 | N/A | Click |
| 7 | complement(2321983..2322414) | PHAGE_Tetras_SI1: hypothetical protein; Sinme_2304; phage(gi472342241) | 2e-06 | Click |
| 8 | complement(2322437..2322820) | hypothetical protein; Sinme_2305 | N/A | Click |
| 9 | complement(2322828..2323304) | PHAGE_Tetras_SI1: hypothetical protein; Sinme_2306; phage(gi472342243) | 8e-08 | Click |
| 10 | complement(2323304..2323639) | PHAGE_Rhodob_RcapNL: phage head-tail adapter protein; Sinme_2307; phage(gi461474968) | 2e-06 | Click |
| 11 | complement(2323639..2324220) | PHAGE_Rhodob_RcapNL: hypothetical protein; Sinme_2308; phage(gi461474967) | 1e-09 | Click |
| 12 | complement(2324223..2324435) | hypothetical protein; Sinme_2309 | N/A | Click |
| 13 | complement(2324496..2325701) | PHAGE_Xantho_CP1: putative head protein; Sinme_2310; phage(gi431811003) | 2e-121 | Click |
| 14 | complement(2325732..2326427) | PHAGE_Tetras_SI1: phage prohead protease; Sinme_2311; phage(gi472342256) | 2e-28 | Click |
| 15 | complement(2326424..2327671) | PHAGE_Entero_mEp235: portal protein; Sinme_2312; phage(gi428781813) | 2e-78 | Click |
| 16 | complement(2327668..2329356) | PHAGE_Burkho_Bcep176: gp79; Sinme_2313; phage(gi77864705) | 5e-133 | Click |
| 17 | complement(2329353..2329754) | hypothetical protein; Sinme_2314 | N/A | Click |
| 18 | 2329870..2330484 | hypothetical protein; Sinme_2315 | N/A | Click |
| 19 | 2330481..2330660 | hypothetical protein; Sinme_2316 | N/A | Click |
| 20 | complement(2330705..2330983) | PHAGE_Burkho_BcepMigl: virion associated protein; Sinme_2317; phage(gi431809916) | 1e-05 | Click |
| 21 | complement(2330997..2332637) | PHAGE_Pectob_My1: YadA domain-containing protein; Sinme_2318; phage(gi410491156) | 9e-18 | Click |
Region 8, total : 8 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3711074..3711093 | attL TGTGCTCGTCACAGGGATCC | N/A | Click |
| 2 | complement(3711332..3712912) | PHAGE_Human__2: ubiquitin E3 ligase ICP0; Sinme_3584; phage(gi109676722) | 6e-10 | Click |
| 3 | 3713052..3713384 | hypothetical protein; Sinme_3585 | N/A | Click |
| 4 | complement(3713448..3713975) | PHAGE_Europe_virus: hypothetical protein; Sinme_3586; phage(gi388260142) | 6e-05 | Click |
| 5 | 3714367..3714453 | tRNA | N/A | Click |
| 6 | complement(3714581..3716536) | PHAGE_Pelagi_HTVC008M: adenylate/guanylyl cyclase; Sinme_3587; phage(gi460042455) | 2e-24 | Click |
| 7 | complement(3716672..3717718) | PHAGE_Acanth_1: hypothetical protein ATCV1_Z295L; Sinme_3588; phage(gi155371242) | 4e-08 | Click |
| 8 | complement(3717804..3718133) | hypothetical protein; Sinme_3589 | N/A | Click |
| 9 | 3718341..3718967 | PHAGE_Microc_LMM01: 3'-5' exonuclease; Sinme_3590; phage(gi117530351) | 7e-05 | Click |
| 10 | 3718989..3719008 | attR TGTGCTCGTCACAGGGATCC | N/A | Click |
| 11 | 3719326..3720474 | PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; Sinme_3591; phage(gi17546158) | 5e-12 | Click |