| Definition | Streptococcus parauberis KCTC 11537 chromosome, complete genome. | 
|---|---|
| Accession | NC_015558 | 
| Length | 2,143,887 | 
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file | 
        Region 1, total : 39 CDS	
      
	| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE | 
|---|---|---|---|---|
| 1 | 869075..869090 | attL TATTTCACCAATAAAA | N/A | Click | 
| 2 | 882546..883244 | PHAGE_Amsact_: putative ATP-binding cassette transporter; STP_0836; phage(gi9964444) | 3e-16 | Click | 
| 3 | 883253..884044 | membrane protein; STP_0837 | N/A | Click | 
| 4 | complement(884087..884698) | membrane protein; STP_0838 | N/A | Click | 
| 5 | 884791..885135 | tRNA | N/A | Click | 
| 6 | complement(885708..886679) | PHAGE_Lister_A006: gp21; STP_0839; phage(gi157325436) | 1e-37 | Click | 
| 7 | complement(886773..886964) | PHAGE_Lactob_LF1: hypothetical protein; STP_0840; phage(gi418489439) | 5e-09 | Click | 
| 8 | complement(887053..888300) | PHAGE_Entero_phiEF24C: putative N-acetylmuramoyl-L-alanine amidase; STP_0841; phage(gi158079305) | 2e-24 | Click | 
| 9 | complement(888304..888489) | PHAGE_Temper_1: hypothetical protein phiNIH1.1_49; STP_0842; phage(gi16271825) | 3e-22 | Click | 
| 10 | complement(888536..888856) | PHAGE_Strept_phi3396: hypothetical protein phi3396_54; STP_0843; phage(gi126011116) | 4e-25 | Click | 
| 11 | complement(889034..889363) | PHAGE_Strept_5: hypothetical protein SpyM3_1309; STP_0844; phage(gi28876391) | 9e-21 | Click | 
| 12 | complement(889412..891268) | PHAGE_Strept_Abc2: tail protein; STP_0845; phage(gi281416402) | 4e-75 | Click | 
| 13 | complement(891278..894526) | PHAGE_Lactoc_lato: putative tail-host specificity protein; STP_0846; phage(gi30089906) | 4e-125 | Click | 
| 14 | complement(896079..900587) | PHAGE_Strept_DT1: putative tail component protein; STP_0847; phage(gi29165636) | 0.0 | Click | 
| 15 | complement(900762..901151) | PHAGE_Strept_Sfi19: putative tail component protein; STP_0848; phage(gi9632905) | 7e-27 | Click | 
| 16 | complement(901216..901830) | PHAGE_Strept_YMC_2011: major tail protein; STP_0849; phage(gi399498728) | 3e-82 | Click | 
| 17 | complement(901846..902220) | PHAGE_Strept_Sfi21: putative tail component protein; STP_0850; phage(gi9632947) | 6e-33 | Click | 
| 18 | complement(902224..902640) | PHAGE_Strept_Sfi19: putative tail component protein; STP_0851; phage(gi9632903) | 2e-46 | Click | 
| 19 | complement(903322..904509) | PHAGE_Strept_Sfi19: major head protein; STP_0852; phage(gi9632900) | 3e-141 | Click | 
| 20 | complement(904525..905220) | PHAGE_Strept_YMC_2011: Predicted clp-protease; STP_0853; phage(gi399498722) | 1e-83 | Click | 
| 21 | complement(905227..906345) | PHAGE_Strept_DT1: putative portal protein; STP_0854; phage(gi9632422) | 6e-140 | Click | 
| 22 | complement(906588..908459) | PHAGE_Strept_Sfi19: putative terminase large subunit; STP_0855; phage(gi9632897) | 0.0 | Click | 
| 23 | complement(908471..908932) | PHAGE_Strept_DT1: hypothetical protein DT1p02; STP_0856; phage(gi9632418) | 1e-57 | Click | 
| 24 | complement(909777..909849) | tRNA | N/A | Click | 
| 25 | complement(909887..910204) | hypothetical protein; STP_0857 | N/A | Click | 
| 26 | complement(910425..910841) | PHAGE_Strept_6: putative transcriptional activator; STP_0858; phage(gi28876467) | 7e-63 | Click | 
| 27 | complement(910834..911136) | PHAGE_Strept_1: putaive immunity repressor protein; STP_0859; phage(gi28876166) | 3e-22 | Click | 
| 28 | complement(911176..911757) | PHAGE_Temper_1: hypothetical protein phiNIH1.1_21; STP_0860; phage(gi16271797) | 2e-14 | Click | 
| 29 | complement(912272..912664) | PHAGE_Strept_SMP: hypothetical protein; STP_0861; phage(gi119953770) | 2e-31 | Click | 
| 30 | complement(912668..913993) | PHAGE_Strept_6: putative helicase; STP_0862; phage(gi28876470) | 0.0 | Click | 
| 31 | complement(914073..914264) | PHAGE_Strept_6: hypothetical protein SpyM3_1441; STP_0863; phage(gi28876471) | 6e-29 | Click | 
| 32 | complement(914642..917038) | PHAGE_Strept_6: putative DNA primase/helicase; STP_0864; phage(gi28876472) | 0.0 | Click | 
| 33 | complement(917043..918965) | PHAGE_Strept_6: putative DNA polymerase A domain; STP_0865; phage(gi28876473) | 0.0 | Click | 
| 34 | complement(919008..919571) | PHAGE_Strept_6: hypothetical protein SpyM3_1444; STP_0866; phage(gi28876474) | 2e-94 | Click | 
| 35 | complement(919584..920738) | PHAGE_Strept_6: hypothetical protein SpyM3_1445; STP_0867; phage(gi28876475) | 0.0 | Click | 
| 36 | complement(920738..921079) | PHAGE_Strept_6: hypothetical protein SpyM3_1446; STP_0868; phage(gi28876476) | 7e-19 | Click | 
| 37 | complement(921171..921383) | PHAGE_Strept_6: hypothetical protein SpyM3_1447; STP_0869; phage(gi28876477) | 3e-13 | Click | 
| 38 | complement(923141..923332) | PHAGE_Strept_6: putative transcriptional repressor; STP_0870; phage(gi28876484) | 1e-25 | Click | 
| 39 | 923831..924301 | hypothetical protein; STP_0871 | N/A | Click | 
| 40 | 925182..925535 | PHAGE_Strept_6: putative repressor; STP_0872; phage(gi28876485) | 2e-46 | Click | 
| 41 | 925895..926320 | hypothetical protein; STP_0873 | N/A | Click | 
| 42 | 926689..926704 | attR TATTTCACCAATAAAA | N/A | Click | 
| 43 | 926812..927900 | PHAGE_Strept_6: putative integrase; STP_0874; phage(gi28876488) | 4e-47 | Click | 
        Region 2, total : 24 CDS	
      
	| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE | 
|---|---|---|---|---|
| 1 | complement(1379802..1382756) | PHAGE_Strept_5: putative tail protein; STP_1260; phage(gi28876393) | 0.0 | Click | 
| 2 | complement(1382760..1384028) | PHAGE_Strept_5: putative minor structural protein; STP_1261; phage(gi28876394) | 2e-146 | Click | 
| 3 | complement(1384248..1386449) | PHAGE_Strept_5: putative platlet-binding protein, minor tail fiber protein; STP_1262; phage(gi28876395) | 5e-105 | Click | 
| 4 | complement(1386442..1386711) | PHAGE_Strept_5: hypothetical protein SpyM3_1314; STP_1263; phage(gi28876396) | 6e-30 | Click | 
| 5 | 1386772..1386800 | attL GACAAAGAAAAAAGCGAAGTCAATATCTT | N/A | Click | 
| 6 | complement(1387210..1387737) | PHAGE_Strept_5: hypothetical protein SpyM3_1316; STP_1264; phage(gi28876398) | 3e-72 | Click | 
| 7 | complement(1387748..1388026) | PHAGE_Strept_5: hypothetical protein SpyM3_1317; STP_1265; phage(gi28876399) | 1e-35 | Click | 
| 8 | complement(1388156..1388557) | PHAGE_Strept_5: hypothetical protein SpyM3_1318; STP_1266; phage(gi28876400) | 2e-43 | Click | 
| 9 | complement(1388865..1389200) | PHAGE_Strept_5: hypothetical protein SpyM3_1320; STP_1267; phage(gi28876402) | 5e-25 | Click | 
| 10 | complement(1389369..1390268) | PHAGE_Strept_5: hypothetical protein SpyM3_1322; STP_1268; phage(gi28876404) | 3e-129 | Click | 
| 11 | complement(1390284..1390967) | PHAGE_Strept_5: hypothetical protein SpyM3_1323; STP_1269; phage(gi28876405) | 8e-58 | Click | 
| 12 | complement(1392660..1393580) | PHAGE_Strept_5: hypothetical protein SpyM3_1325; STP_1270; phage(gi28876407) | 5e-112 | Click | 
| 13 | complement(1393591..1395129) | PHAGE_Strept_5: hypothetical protein SpyM3_1326; STP_1271; phage(gi28876408) | 6e-168 | Click | 
| 14 | complement(1396339..1396662) | PHAGE_Strept_O1205: putative small subunit of the terminase; STP_1272; phage(gi23455900) | 2e-38 | Click | 
| 15 | complement(1397328..1397398) | tRNA | N/A | Click | 
| 16 | complement(1401135..1401422) | Sulfate adenylyltransferase, large subunit; STP_1273 | N/A | Click | 
| 17 | complement(1403648..1404418) | PHAGE_Lister_B054: gp50; STP_1274; phage(gi157325334) | 1e-42 | Click | 
| 18 | complement(1404774..1405121) | PHAGE_Strept_M102: hypothetical protein M102_gp29; STP_1275; phage(gi242345600) | 6e-05 | Click | 
| 19 | complement(1405364..1405663) | PHAGE_Strept_3: hypothetical protein SpyM3_1139; STP_1276; phage(gi28876309) | 1e-24 | Click | 
| 20 | complement(1405851..1406102) | PHAGE_Strept_4: putative replication protein; STP_1277; phage(gi28876369) | 2e-24 | Click | 
| 21 | complement(1407980..1408705) | PHAGE_Temper_1: antirepressor; STP_1278; phage(gi16271781) | 8e-109 | Click | 
| 22 | 1409745..1410500 | PHAGE_Strept_2: putative repressor protein; STP_1279; phage(gi28876261) | 3e-100 | Click | 
| 23 | 1410569..1411336 | PHAGE_Lactob_Lj965: putative superinfection immunity protein; STP_1280; phage(gi41179219) | 2e-27 | Click | 
| 24 | 1411494..1412591 | PHAGE_Strept_6: putative integrase; STP_1281; phage(gi28876488) | 2e-133 | Click | 
| 25 | complement(1413179..1414468) | PHAGE_Entero_phiEF24C: putative N-acetylmuramoyl-L-alanine amidase; STP_1282; phage(gi158079305) | 6e-24 | Click | 
| 26 | complement(1415246..1417867) | PHAGE_Strept_5: hypothetical protein SpyM3_1305; STP_1283; phage(gi28876387) | 4e-13 | Click | 
| 27 | 1424834..1424862 | attR GACAAAGAAAAAAGCGAAGTCAATATCTT | N/A | Click | 
        Region 3, total : 19 CDS	
      
	| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE | 
|---|---|---|---|---|
| 1 | complement(1798052..1798777) | PHAGE_Strept_SM1: gp56; STP_1586; phage(gi32469431) | 2e-14 | Click | 
| 2 | complement(1798770..1799234) | PHAGE_Strept_3: putative holin protein; STP_1587; phage(gi28876267) | 9e-52 | Click | 
| 3 | complement(1799450..1799788) | PHAGE_Strept_5: hypothetical protein SpyM3_1309; STP_1588; phage(gi28876391) | 2e-20 | Click | 
| 4 | complement(1799837..1801693) | PHAGE_Strept_Abc2: tail protein; STP_1589; phage(gi281416402) | 2e-76 | Click | 
| 5 | complement(1801703..1804444) | PHAGE_Strept_2: receptor-binding protein; STP_1590; phage(gi273809745) | 5e-73 | Click | 
| 6 | complement(1804456..1805247) | PHAGE_Lactoc_bIL309: host-specificity; STP_1591; phage(gi13095858) | 1e-28 | Click | 
| 7 | complement(1805247..1806692) | PHAGE_Strept_MM1: putative minor structural protein; STP_1592; phage(gi15088787) | 2e-66 | Click | 
| 8 | complement(1806689..1810495) | PHAGE_Strept_phiNJ2: putative envelope protein; STP_1593; phage(gi414090212) | 2e-124 | Click | 
| 9 | complement(1810515..1811003) | PHAGE_Strept_MM1: hypothetical protein MM1p45; STP_1594; phage(gi15088785) | 2e-21 | Click | 
| 10 | complement(1811987..1812394) | PHAGE_Strept_MM1: putative minor capsid protein 4; STP_1595; phage(gi15088782) | 5e-36 | Click | 
| 11 | complement(1812395..1812751) | PHAGE_Strept_MM1: putative minor capsid protein 3; STP_1596; phage(gi15088781) | 4e-31 | Click | 
| 12 | complement(1813067..1813456) | PHAGE_Strept_MM1: hypothetical protein MM1p39; STP_1597; phage(gi15088779) | 3e-41 | Click | 
| 13 | complement(1813760..1814644) | PHAGE_Strept_MM1: hypothetical protein MM1p37; STP_1598; phage(gi15088777) | 3e-99 | Click | 
| 14 | complement(1814667..1815245) | PHAGE_Strept_MM1: putative scaffolding protein; STP_1599; phage(gi15088776) | 2e-47 | Click | 
| 15 | complement(1815381..1816493) | PHAGE_Strept_MM1: hypothetical protein MM1p35; STP_1600; phage(gi15088775) | 1e-138 | Click | 
| 16 | complement(1816549..1818066) | PHAGE_Strept_MM1: putative minor capsid protein 1; STP_1601; phage(gi26553451) | 0.0 | Click | 
| 17 | complement(1818129..1819439) | PHAGE_Strept_MM1: putative large terminase subunit; STP_1602; phage(gi15088772) | 0.0 | Click | 
| 18 | complement(1820011..1820826) | PHAGE_Strept_MM1: hypothetical protein MM1p30; STP_1603; phage(gi26553447) | 2e-46 | Click | 
| 19 | complement(1821200..1822300) | PHAGE_Strept_MM1: hypothetical protein MM1p29; STP_1604; phage(gi26553450) | 2e-146 | Click |