| Definition | Clostridium lentocellum DSM 5427 chromosome, complete genome. |
|---|---|
| Accession | NC_015275 |
| Length | 4,714,237 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 32 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 914773..914796 | attL TCCCCCAACTTGGTGTATTTTTTT | N/A | Click |
| 2 | complement(914900..916030) | PHAGE_Clostr_phi3626: putative integrase; Clole_0715; phage(gi20065985) | 4e-27 | Click |
| 3 | 916199..916744 | hypothetical protein; Clole_0716 | N/A | Click |
| 4 | complement(916822..917739) | exonuclease RNase T and DNA polymerase III; Clole_0717 | N/A | Click |
| 5 | complement(917798..918166) | hypothetical protein; Clole_0718 | N/A | Click |
| 6 | 918293..918457 | hypothetical protein; Clole_0719 | N/A | Click |
| 7 | 918460..918768 | hypothetical protein; Clole_0720 | N/A | Click |
| 8 | 918781..918987 | hypothetical protein; Clole_0721 | N/A | Click |
| 9 | 919000..919170 | hypothetical protein; Clole_0722 | N/A | Click |
| 10 | 919264..919398 | hypothetical protein; Clole_0723 | N/A | Click |
| 11 | 919395..919607 | hypothetical protein; Clole_0724 | N/A | Click |
| 12 | 919795..920520 | hypothetical protein; Clole_0725 | N/A | Click |
| 13 | 920532..920696 | hypothetical protein; Clole_0726 | N/A | Click |
| 14 | 920671..921270 | hypothetical protein; Clole_0727 | N/A | Click |
| 15 | 921267..921653 | VRR-NUC domain-containing protein; Clole_0728 | N/A | Click |
| 16 | 921658..922443 | PHAGE_Entero_EF62phi: chromosome partitioning ATPase; Clole_0729; phage(gi384519759) | 2e-16 | Click |
| 17 | 922453..923409 | ParB domain protein nuclease; Clole_0730 | N/A | Click |
| 18 | complement(923521..924198) | PHAGE_Strept_SM1: gp7; Clole_0731; phage(gi32469438) | 4e-52 | Click |
| 19 | 924663..926183 | PHAGE_Pectob_ZF40: putative methylase; Clole_0732; phage(gi422936661) | 4e-105 | Click |
| 20 | complement(926238..926522) | hypothetical protein; Clole_0733 | N/A | Click |
| 21 | complement(926684..926977) | hypothetical protein; Clole_0734 | N/A | Click |
| 22 | 927103..927270 | hypothetical protein; Clole_0735 | N/A | Click |
| 23 | 927307..927591 | hypothetical protein; Clole_0736 | N/A | Click |
| 24 | 927620..927967 | ASCH domain protein; Clole_0737 | N/A | Click |
| 25 | 927979..928527 | PHAGE_Clostr_PhiS63: gp40; Clole_0738; phage(gi388570666) | 4e-15 | Click |
| 26 | 928655..929023 | HNH endonuclease; Clole_0739 | N/A | Click |
| 27 | 929101..929496 | phage terminase, small subunit; Clole_0740 | N/A | Click |
| 28 | 929477..931207 | terminase; Clole_0741 | N/A | Click |
| 29 | 931211..932416 | phage portal protein, HK97 family; Clole_0742 | N/A | Click |
| 30 | 932409..932999 | PHAGE_Clostr_phi3626: putative prohead protease; Clole_0743; phage(gi20065968) | 3e-25 | Click |
| 31 | 932981..934384 | PHAGE_Bacill_1: Phage capsid protein; Clole_0744; phage(gi155042936) | 3e-163 | Click |
| 32 | 934520..934795 | hypothetical protein; Clole_0745 | N/A | Click |
| 33 | 934785..935090 | phage head-tail adaptor; Clole_0746 | N/A | Click |
| 34 | 947532..947555 | attR TCCCCCAACTTGGTGTATTTTTTT | N/A | Click |
Region 2, total : 20 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 986154..986167 | attL TAATATTGATATAA | N/A | Click |
| 2 | 986382..987344 | integrase family protein; Clole_0811 | N/A | Click |
| 3 | 987572..988036 | hypothetical protein; Clole_0812 | N/A | Click |
| 4 | 988314..989030 | PHAGE_Clostr_phiCD38_2: terminase small subunit; Clole_0813; phage(gi333798108) | 5e-41 | Click |
| 5 | 989032..990291 | PHAGE_Clostr_phiCD38_2: terminase large subunit; Clole_0814; phage(gi333798109) | 9e-54 | Click |
| 6 | 990431..991840 | PHAGE_Clostr_phiCD38_2: minor capsid protein; Clole_0815; phage(gi333798110) | 6e-123 | Click |
| 7 | 991853..993445 | PHAGE_Clostr_phiCD38_2: minor capsid protein; Clole_0816; phage(gi333798111) | 8e-66 | Click |
| 8 | 993445..993744 | hypothetical protein; Clole_0817 | N/A | Click |
| 9 | 993809..993955 | hypothetical protein; Clole_0818 | N/A | Click |
| 10 | complement(993952..994179) | hypothetical protein; Clole_0819 | N/A | Click |
| 11 | 994449..995036 | PHAGE_Clostr_phiCD38_2: scaffolding protein; Clole_0820; phage(gi333798113) | 6e-20 | Click |
| 12 | 995057..996397 | hypothetical protein; Clole_0821 | N/A | Click |
| 13 | 996414..996791 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Clole_0822; phage(gi333798115) | 2e-11 | Click |
| 14 | 996793..997185 | hypothetical protein; Clole_0823 | N/A | Click |
| 15 | 997185..997610 | Minor capsid; Clole_0824 | N/A | Click |
| 16 | 997607..998020 | hypothetical protein; Clole_0825 | N/A | Click |
| 17 | 998034..998537 | hypothetical protein; Clole_0826 | N/A | Click |
| 18 | 998562..998912 | hypothetical protein; Clole_0827 | N/A | Click |
| 19 | 998912..999484 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Clole_0828; phage(gi333798121) | 1e-54 | Click |
| 20 | 999497..999631 | hypothetical protein; Clole_0829 | N/A | Click |
| 21 | 999669..1003307 | phage tail tape measure protein, TP901 family; Clole_0830 | N/A | Click |
| 22 | 1009778..1009791 | attR TAATATTGATATAA | N/A | Click |
Region 3, total : 18 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2060369..2060381 | attL AAAAAATAAAAAG | N/A | Click |
| 2 | 2063692..2064657 | integrase family protein; Clole_1849 | N/A | Click |
| 3 | 2064667..2065113 | phage transcriptional regulator, RinA family; Clole_1850 | N/A | Click |
| 4 | 2065352..2065425 | tRNA | N/A | Click |
| 5 | 2065455..2066012 | PHAGE_Strept_PH10: hypothetical protein PH10_gp28; Clole_1851; phage(gi238821345) | 8e-30 | Click |
| 6 | 2066311..2066805 | hypothetical protein; Clole_1852 | N/A | Click |
| 7 | 2066810..2067508 | HNH endonuclease; Clole_1853 | N/A | Click |
| 8 | 2067623..2067982 | hypothetical protein; Clole_1854 | N/A | Click |
| 9 | 2067975..2069693 | terminase; Clole_1855 | N/A | Click |
| 10 | 2069705..2070946 | portal protein; Clole_1856 | N/A | Click |
| 11 | 2070939..2071538 | phage prohead protease HK97 family; Clole_1857 | N/A | Click |
| 12 | 2071561..2072784 | phage major capsid protein, HK97 family; Clole_1858 | N/A | Click |
| 13 | 2072957..2073205 | hypothetical protein; Clole_1860 | N/A | Click |
| 14 | 2073210..2073518 | PHAGE_Strept_PH10: hypothetical protein PH10_gp39; Clole_1861; phage(gi238821356) | 6e-10 | Click |
| 15 | 2073505..2073951 | hypothetical protein; Clole_1862 | N/A | Click |
| 16 | 2073948..2074328 | hypothetical protein; Clole_1863 | N/A | Click |
| 17 | 2074336..2074956 | PHAGE_Entero_phiFL4A: hypothetical protein; Clole_1864; phage(gi281416479) | 2e-21 | Click |
| 18 | 2074956..2075282 | hypothetical protein; Clole_1865 | N/A | Click |
| 19 | 2075339..2075548 | hypothetical protein; Clole_1866 | N/A | Click |
| 20 | 2075560..2079207 | PHAGE_Clostr_phiCD38_2: tail tape measure; Clole_1867; phage(gi333798123) | 2e-88 | Click |
| 21 | 2090430..2090442 | attR AAAAAATAAAAAG | N/A | Click |
Region 4, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2993970..2993981 | attL TTCTTTTCTTTA | N/A | Click |
| 2 | complement(3000537..3001616) | PHAGE_Strept_1: tail protein; Clole_2741; phage(gi39653735) | 3e-59 | Click |
| 3 | complement(3001613..3002017) | Phage-like element PBSX protein, XkdS; Clole_2742 | N/A | Click |
| 4 | complement(3002007..3002543) | hypothetical protein; Clole_2743 | N/A | Click |
| 5 | complement(3002536..3003516) | phage cell wall hydrolase; Clole_2744 | N/A | Click |
| 6 | complement(3003509..3004201) | peptidoglycan-binding lysin domain protein; Clole_2745 | N/A | Click |
| 7 | complement(3004201..3006357) | phage tape measure protein; Clole_2746 | N/A | Click |
| 8 | complement(3006551..3006979) | XkdN-like protein; Clole_2748 | N/A | Click |
| 9 | complement(3007026..3007517) | XkdM protein, phage-like element PBSX; Clole_2749 | N/A | Click |
| 10 | complement(3007534..3008844) | phage protein; Clole_2750 | N/A | Click |
| 11 | complement(3008846..3009040) | PHAGE_Lactob_KC5a: hypothetical protein; Clole_2751; phage(gi90592619) | 7e-05 | Click |
| 12 | complement(3009033..3009458) | PHAGE_Strept_1: hypothetical protein EJ-1p51; Clole_2752; phage(gi39653725) | 4e-05 | Click |
| 13 | complement(3009451..3009954) | PHAGE_Strept_1: hypothetical protein EJ-1p50; Clole_2753; phage(gi39653724) | 4e-11 | Click |
| 14 | complement(3009954..3010337) | PHAGE_Strept_1: hypothetical protein EJ-1p49; Clole_2754; phage(gi39653723) | 9e-06 | Click |
| 15 | complement(3010334..3010669) | PHAGE_Strept_1: hypothetical protein EJ-1p48; Clole_2755; phage(gi39653722) | 1e-06 | Click |
| 16 | complement(3010712..3011731) | PHAGE_Entero_phiEf11: putative head protein; Clole_2756; phage(gi282598750) | 2e-66 | Click |
| 17 | complement(3011745..3012119) | hypothetical protein; Clole_2757 | N/A | Click |
| 18 | complement(3012138..3012764) | PHAGE_Lactob_KC5a: putative phage minor capsid protein; Clole_2758; phage(gi90592613) | 3e-10 | Click |
| 19 | complement(3012926..3013117) | hypothetical protein; Clole_2759 | N/A | Click |
| 20 | 3013220..3013396 | hypothetical protein; Clole_2760 | N/A | Click |
| 21 | complement(3013365..3013619) | hypothetical protein; Clole_2761 | N/A | Click |
| 22 | complement(3013681..3013863) | hypothetical protein; Clole_2762 | N/A | Click |
| 23 | complement(3013847..3015220) | phage head morphogenesis protein, SPP1 gp7 family; Clole_2763 | N/A | Click |
| 24 | complement(3015210..3016655) | phage portal protein, SPP1 family; Clole_2764 | N/A | Click |
| 25 | complement(3016659..3017963) | PHAGE_Strept_1: terminase, large subunit; Clole_2765; phage(gi39653713) | 5e-168 | Click |
| 26 | complement(3017951..3018808) | PHAGE_Deep_s_D6E: small subunit terminase; Clole_2766; phage(gi423262328) | 2e-74 | Click |
| 27 | complement(3018972..3019376) | RNA polymerase, sigma 28 subunit, FliA/WhiG subfamily; Clole_2767 | N/A | Click |
| 28 | 3019442..3019453 | attR TTCTTTTCTTTA | N/A | Click |
| 29 | complement(3019603..3020565) | integrase family protein; Clole_2768 | N/A | Click |