CP002622.fna not available for download.

Definition Clostridium lentocellum DSM 5427 chromosome, complete genome.
Accession NC_015275
Length 4,714,237
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 32 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 914773..914796  attL    TCCCCCAACTTGGTGTATTTTTTT  N/A  Click
2 complement(914900..916030)  PHAGE_Clostr_phi3626: putative integrase; Clole_0715; phage(gi20065985)  4e-27  Click
3 916199..916744  hypothetical protein; Clole_0716  N/A  Click
4 complement(916822..917739)  exonuclease RNase T and DNA polymerase III; Clole_0717  N/A  Click
5 complement(917798..918166)  hypothetical protein; Clole_0718  N/A  Click
6 918293..918457  hypothetical protein; Clole_0719  N/A  Click
7 918460..918768  hypothetical protein; Clole_0720  N/A  Click
8 918781..918987  hypothetical protein; Clole_0721  N/A  Click
9 919000..919170  hypothetical protein; Clole_0722  N/A  Click
10 919264..919398  hypothetical protein; Clole_0723  N/A  Click
11 919395..919607  hypothetical protein; Clole_0724  N/A  Click
12 919795..920520  hypothetical protein; Clole_0725  N/A  Click
13 920532..920696  hypothetical protein; Clole_0726  N/A  Click
14 920671..921270  hypothetical protein; Clole_0727  N/A  Click
15 921267..921653  VRR-NUC domain-containing protein; Clole_0728  N/A  Click
16 921658..922443  PHAGE_Entero_EF62phi: chromosome partitioning ATPase; Clole_0729; phage(gi384519759)  2e-16  Click
17 922453..923409  ParB domain protein nuclease; Clole_0730  N/A  Click
18 complement(923521..924198)  PHAGE_Strept_SM1: gp7; Clole_0731; phage(gi32469438)  4e-52  Click
19 924663..926183  PHAGE_Pectob_ZF40: putative methylase; Clole_0732; phage(gi422936661)  4e-105  Click
20 complement(926238..926522)  hypothetical protein; Clole_0733  N/A  Click
21 complement(926684..926977)  hypothetical protein; Clole_0734  N/A  Click
22 927103..927270  hypothetical protein; Clole_0735  N/A  Click
23 927307..927591  hypothetical protein; Clole_0736  N/A  Click
24 927620..927967  ASCH domain protein; Clole_0737  N/A  Click
25 927979..928527  PHAGE_Clostr_PhiS63: gp40; Clole_0738; phage(gi388570666)  4e-15  Click
26 928655..929023  HNH endonuclease; Clole_0739  N/A  Click
27 929101..929496  phage terminase, small subunit; Clole_0740  N/A  Click
28 929477..931207  terminase; Clole_0741  N/A  Click
29 931211..932416  phage portal protein, HK97 family; Clole_0742  N/A  Click
30 932409..932999  PHAGE_Clostr_phi3626: putative prohead protease; Clole_0743; phage(gi20065968)  3e-25  Click
31 932981..934384  PHAGE_Bacill_1: Phage capsid protein; Clole_0744; phage(gi155042936)  3e-163  Click
32 934520..934795  hypothetical protein; Clole_0745  N/A  Click
33 934785..935090  phage head-tail adaptor; Clole_0746  N/A  Click
34 947532..947555  attR    TCCCCCAACTTGGTGTATTTTTTT  N/A  Click
Region 2, total : 20 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 986154..986167  attL    TAATATTGATATAA  N/A  Click
2 986382..987344  integrase family protein; Clole_0811  N/A  Click
3 987572..988036  hypothetical protein; Clole_0812  N/A  Click
4 988314..989030  PHAGE_Clostr_phiCD38_2: terminase small subunit; Clole_0813; phage(gi333798108)  5e-41  Click
5 989032..990291  PHAGE_Clostr_phiCD38_2: terminase large subunit; Clole_0814; phage(gi333798109)  9e-54  Click
6 990431..991840  PHAGE_Clostr_phiCD38_2: minor capsid protein; Clole_0815; phage(gi333798110)  6e-123  Click
7 991853..993445  PHAGE_Clostr_phiCD38_2: minor capsid protein; Clole_0816; phage(gi333798111)  8e-66  Click
8 993445..993744  hypothetical protein; Clole_0817  N/A  Click
9 993809..993955  hypothetical protein; Clole_0818  N/A  Click
10 complement(993952..994179)  hypothetical protein; Clole_0819  N/A  Click
11 994449..995036  PHAGE_Clostr_phiCD38_2: scaffolding protein; Clole_0820; phage(gi333798113)  6e-20  Click
12 995057..996397  hypothetical protein; Clole_0821  N/A  Click
13 996414..996791  PHAGE_Clostr_phiCD38_2: hypothetical protein; Clole_0822; phage(gi333798115)  2e-11  Click
14 996793..997185  hypothetical protein; Clole_0823  N/A  Click
15 997185..997610  Minor capsid; Clole_0824  N/A  Click
16 997607..998020  hypothetical protein; Clole_0825  N/A  Click
17 998034..998537  hypothetical protein; Clole_0826  N/A  Click
18 998562..998912  hypothetical protein; Clole_0827  N/A  Click
19 998912..999484  PHAGE_Clostr_phiCD38_2: hypothetical protein; Clole_0828; phage(gi333798121)  1e-54  Click
20 999497..999631  hypothetical protein; Clole_0829  N/A  Click
21 999669..1003307  phage tail tape measure protein, TP901 family; Clole_0830  N/A  Click
22 1009778..1009791  attR    TAATATTGATATAA  N/A  Click
Region 3, total : 18 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2060369..2060381  attL    AAAAAATAAAAAG  N/A  Click
2 2063692..2064657  integrase family protein; Clole_1849  N/A  Click
3 2064667..2065113  phage transcriptional regulator, RinA family; Clole_1850  N/A  Click
4 2065352..2065425  tRNA  N/A  Click
5 2065455..2066012  PHAGE_Strept_PH10: hypothetical protein PH10_gp28; Clole_1851; phage(gi238821345)  8e-30  Click
6 2066311..2066805  hypothetical protein; Clole_1852  N/A  Click
7 2066810..2067508  HNH endonuclease; Clole_1853  N/A  Click
8 2067623..2067982  hypothetical protein; Clole_1854  N/A  Click
9 2067975..2069693  terminase; Clole_1855  N/A  Click
10 2069705..2070946  portal protein; Clole_1856  N/A  Click
11 2070939..2071538  phage prohead protease HK97 family; Clole_1857  N/A  Click
12 2071561..2072784  phage major capsid protein, HK97 family; Clole_1858  N/A  Click
13 2072957..2073205  hypothetical protein; Clole_1860  N/A  Click
14 2073210..2073518  PHAGE_Strept_PH10: hypothetical protein PH10_gp39; Clole_1861; phage(gi238821356)  6e-10  Click
15 2073505..2073951  hypothetical protein; Clole_1862  N/A  Click
16 2073948..2074328  hypothetical protein; Clole_1863  N/A  Click
17 2074336..2074956  PHAGE_Entero_phiFL4A: hypothetical protein; Clole_1864; phage(gi281416479)  2e-21  Click
18 2074956..2075282  hypothetical protein; Clole_1865  N/A  Click
19 2075339..2075548  hypothetical protein; Clole_1866  N/A  Click
20 2075560..2079207  PHAGE_Clostr_phiCD38_2: tail tape measure; Clole_1867; phage(gi333798123)  2e-88  Click
21 2090430..2090442  attR    AAAAAATAAAAAG  N/A  Click
Region 4, total : 27 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2993970..2993981  attL    TTCTTTTCTTTA  N/A  Click
2 complement(3000537..3001616)  PHAGE_Strept_1: tail protein; Clole_2741; phage(gi39653735)  3e-59  Click
3 complement(3001613..3002017)  Phage-like element PBSX protein, XkdS; Clole_2742  N/A  Click
4 complement(3002007..3002543)  hypothetical protein; Clole_2743  N/A  Click
5 complement(3002536..3003516)  phage cell wall hydrolase; Clole_2744  N/A  Click
6 complement(3003509..3004201)  peptidoglycan-binding lysin domain protein; Clole_2745  N/A  Click
7 complement(3004201..3006357)  phage tape measure protein; Clole_2746  N/A  Click
8 complement(3006551..3006979)  XkdN-like protein; Clole_2748  N/A  Click
9 complement(3007026..3007517)  XkdM protein, phage-like element PBSX; Clole_2749  N/A  Click
10 complement(3007534..3008844)  phage protein; Clole_2750  N/A  Click
11 complement(3008846..3009040)  PHAGE_Lactob_KC5a: hypothetical protein; Clole_2751; phage(gi90592619)  7e-05  Click
12 complement(3009033..3009458)  PHAGE_Strept_1: hypothetical protein EJ-1p51; Clole_2752; phage(gi39653725)  4e-05  Click
13 complement(3009451..3009954)  PHAGE_Strept_1: hypothetical protein EJ-1p50; Clole_2753; phage(gi39653724)  4e-11  Click
14 complement(3009954..3010337)  PHAGE_Strept_1: hypothetical protein EJ-1p49; Clole_2754; phage(gi39653723)  9e-06  Click
15 complement(3010334..3010669)  PHAGE_Strept_1: hypothetical protein EJ-1p48; Clole_2755; phage(gi39653722)  1e-06  Click
16 complement(3010712..3011731)  PHAGE_Entero_phiEf11: putative head protein; Clole_2756; phage(gi282598750)  2e-66  Click
17 complement(3011745..3012119)  hypothetical protein; Clole_2757  N/A  Click
18 complement(3012138..3012764)  PHAGE_Lactob_KC5a: putative phage minor capsid protein; Clole_2758; phage(gi90592613)  3e-10  Click
19 complement(3012926..3013117)  hypothetical protein; Clole_2759  N/A  Click
20 3013220..3013396  hypothetical protein; Clole_2760  N/A  Click
21 complement(3013365..3013619)  hypothetical protein; Clole_2761  N/A  Click
22 complement(3013681..3013863)  hypothetical protein; Clole_2762  N/A  Click
23 complement(3013847..3015220)  phage head morphogenesis protein, SPP1 gp7 family; Clole_2763  N/A  Click
24 complement(3015210..3016655)  phage portal protein, SPP1 family; Clole_2764  N/A  Click
25 complement(3016659..3017963)  PHAGE_Strept_1: terminase, large subunit; Clole_2765; phage(gi39653713)  5e-168  Click
26 complement(3017951..3018808)  PHAGE_Deep_s_D6E: small subunit terminase; Clole_2766; phage(gi423262328)  2e-74  Click
27 complement(3018972..3019376)  RNA polymerase, sigma 28 subunit, FliA/WhiG subfamily; Clole_2767  N/A  Click
28 3019442..3019453  attR    TTCTTTTCTTTA  N/A  Click
29 complement(3019603..3020565)  integrase family protein; Clole_2768  N/A  Click