Definition | Pantoea sp. At-9b chromosome, complete genome. |
---|---|
Accession | NC_014837 |
Length | 4,368,708 |
Legend
Hits against Virus and prophage DB | |
Hits against Bacterial DB or GenBank file |
Region 1, total : 26 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(2321587..2321790) | PHAGE_Escher_HK639: hypothetical protein; Pat9b_2105; phage(gi356870646) | 3e-08 | Click |
2 | complement(2321967..2323238) | PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; Pat9b_2106; phage(gi399528788) | 3e-44 | Click |
3 | complement(2323311..2324036) | hypothetical protein; Pat9b_2107 | N/A | Click |
4 | complement(2324311..2327379) | PHAGE_Salmon_vB_SosS_Oslo: tail fiber protein; Pat9b_2108; phage(gi399528786) | 0.0 | Click |
5 | complement(2327443..2327967) | PHAGE_Salmon_SPN3UB: putative tail assembly protein I; Pat9b_2109; phage(gi423262413) | 4e-62 | Click |
6 | complement(2327910..2328638) | PHAGE_Salmon_vB_SosS_Oslo: tail assembly protein; Pat9b_2110; phage(gi399528784) | 2e-92 | Click |
7 | complement(2328635..2329339) | PHAGE_Salmon_SPN3UB: minor tail protein L; Pat9b_2111; phage(gi423262411) | 8e-101 | Click |
8 | complement(2329336..2329689) | PHAGE_Salmon_vB_SosS_Oslo: minor tail protein; Pat9b_2112; phage(gi399528780) | 2e-47 | Click |
9 | complement(2329746..2329958) | hypothetical protein; Pat9b_2113 | N/A | Click |
10 | complement(2329995..2333024) | PHAGE_Cronob_ENT47670: putative tail protein; Pat9b_2114; phage(gi431810494) | 5e-145 | Click |
11 | complement(2333070..2333693) | hypothetical protein; Pat9b_2115 | N/A | Click |
12 | complement(2333875..2334603) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2116; phage(gi431810508) | 2e-62 | Click |
13 | complement(2334654..2335397) | PHAGE_Cronob_ENT47670: major tail subunit; Pat9b_2117; phage(gi431810520) | 7e-79 | Click |
14 | complement(2335422..2335805) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2118; phage(gi431810530) | 2e-53 | Click |
15 | complement(2335802..2336242) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2119; phage(gi431810532) | 2e-27 | Click |
16 | complement(2336245..2336592) | PHAGE_Salmon_E1: hypothetical protein VIP0025; Pat9b_2120; phage(gi170676301) | 6e-24 | Click |
17 | complement(2336761..2337138) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2121; phage(gi431810531) | 2e-20 | Click |
18 | complement(2337141..2337509) | hypothetical protein; Pat9b_2122 | N/A | Click |
19 | complement(2337519..2338598) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2123; phage(gi431810503) | 9e-157 | Click |
20 | complement(2338610..2339044) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2124; phage(gi431810525) | 4e-46 | Click |
21 | complement(2339048..2340457) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2125; phage(gi431810499) | 9e-163 | Click |
22 | complement(2340494..2341432) | PHAGE_Cronob_ENT47670: phage head morphogenesis; Pat9b_2126; phage(gi431810507) | 1e-107 | Click |
23 | complement(2341440..2342897) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2127; phage(gi431810500) | 0.0 | Click |
24 | complement(2342907..2344370) | PHAGE_Vibrio_pYD38_B: hypothetical protein; Pat9b_2128; phage(gi514231577) | 2e-143 | Click |
25 | complement(2344357..2344836) | PHAGE_Cronob_ENT47670: hypothetical protein; Pat9b_2129; phage(gi431810521) | 2e-60 | Click |
26 | complement(2344867..2345526) | PHAGE_Cronob_ENT47670: putative transposase; Pat9b_2130; phage(gi431810514) | 1e-85 | Click |
Region 2, total : 30 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 2340807..2340818 | attL GCGCCAACCTGC | N/A | Click |
2 | complement(2349945..2350574) | PHAGE_Entero_epsilon15: endolysin; Pat9b_2138; phage(gi30387404) | 8e-89 | Click |
3 | complement(2350578..2350916) | PHAGE_Salmon_Fels_1: bacteriophage lysis protein; holin; Pat9b_2139; phage(gi169257181) | 1e-33 | Click |
4 | 2351081..2351266 | hypothetical protein; Pat9b_2140 | N/A | Click |
5 | complement(2352720..2352799) | tRNA | N/A | Click |
6 | complement(2353012..2353851) | PHAGE_Entero_HK225: late gene regulator Q; Pat9b_2141; phage(gi428782441) | 2e-65 | Click |
7 | complement(2353885..2354244) | PHAGE_Entero_HK225: endodeoxyribonuclease; Pat9b_2142; phage(gi428782440) | 1e-43 | Click |
8 | complement(2354241..2355626) | PHAGE_Entero_HK446: DNA replication protein P; Pat9b_2143; phage(gi428782238) | 3e-121 | Click |
9 | complement(2355619..2356683) | PHAGE_Erwini_phiEt88: phage replication protein O; Pat9b_2144; phage(gi327198609) | 1e-58 | Click |
10 | complement(2356850..2357077) | hypothetical protein; Pat9b_2145 | N/A | Click |
11 | complement(2357074..2357397) | hypothetical protein; Pat9b_2146 | N/A | Click |
12 | complement(2357460..2357699) | PHAGE_Salmon_SPN3UB: putative Cro; Pat9b_2147; phage(gi423262425) | 3e-06 | Click |
13 | 2357804..2358529 | PHAGE_Escher_TL_2011c: repressor protein CI; Pat9b_2148; phage(gi418487062) | 1e-58 | Click |
14 | 2358549..2358761 | hypothetical protein; Pat9b_2149 | N/A | Click |
15 | complement(2359692..2359901) | PHAGE_Entero_HK225: hypothetical protein; Pat9b_2150; phage(gi428782417) | 5e-06 | Click |
16 | 2360903..2361307 | hypothetical protein; Pat9b_2151 | N/A | Click |
17 | 2361429..2361638 | hypothetical protein; Pat9b_2152 | N/A | Click |
18 | 2361607..2362275 | PHAGE_Cronob_vB_CsaM_GAP32: putative DNA polymerase III epsilon subunit; Pat9b_2153; phage(gi414087193) | 8e-16 | Click |
19 | 2362277..2362942 | PHAGE_Entero_HK629: hypothetical protein; Pat9b_2154; phage(gi428782051) | 2e-71 | Click |
20 | 2362942..2363640 | PHAGE_Escher_TL_2011c: hypothetical protein; Pat9b_2155; phage(gi418487087) | 5e-19 | Click |
21 | 2363711..2364250 | PHAGE_Salmon_ST64B: hypothetical protein sb35; Pat9b_2156; phage(gi23505479) | 4e-51 | Click |
22 | 2364243..2364461 | hypothetical protein; Pat9b_2157 | N/A | Click |
23 | 2364573..2364848 | hypothetical protein; Pat9b_2158 | N/A | Click |
24 | 2364942..2365184 | PHAGE_Pectob_ZF40: putative DNA polymerase; Pat9b_2159; phage(gi422936677) | 2e-23 | Click |
25 | 2365181..2365411 | hypothetical protein; Pat9b_2160 | N/A | Click |
26 | 2365461..2365964 | hypothetical protein; Pat9b_2161 | N/A | Click |
27 | 2366028..2366513 | hypothetical protein; Pat9b_2162 | N/A | Click |
28 | complement(2366643..2367251) | hypothetical protein; Pat9b_2163 | N/A | Click |
29 | 2367303..2368178 | PHAGE_Salmon_ST64B: putative DNA methyltransferase; Pat9b_2164; phage(gi23505488) | 4e-90 | Click |
30 | 2368175..2369929 | PHAGE_Pectob_ZF40: putative methylase; Pat9b_2165; phage(gi422936661) | 0.0 | Click |
31 | 2369883..2369894 | attR GCGCCAACCTGC | N/A | Click |
32 | 2369939..2370142 | PHAGE_Entero_HK225: excisionase; Pat9b_2166; phage(gi428782407) | 2e-19 | Click |
33 | complement(2370139..2371332) | PHAGE_Entero_HK225: integrase; Pat9b_2167; phage(gi428782406) | 1e-145 | Click |
Region 3, total : 43 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 3750546..3750573 | attL TCGCTGGTTCAAACCCAGCAGGGGCCAC | N/A | Click |
2 | complement(3753589..3753807) | PHAGE_Entero_Fels_2: P2 gpOgr-like protein (acttivation of late gene expression); Pat9b_3408; phage(gi169936018) | 1e-24 | Click |
3 | complement(3753872..3754969) | PHAGE_Entero_Fels_2: P2 gpD-like tail protein; Pat9b_3409; phage(gi169936019) | 1e-157 | Click |
4 | complement(3754966..3755451) | PHAGE_Entero_Fels_2: P2 gpU-like tail protein; Pat9b_3410; phage(gi169936020) | 4e-65 | Click |
5 | complement(3755448..3758222) | PHAGE_Entero_Fels_2: P2 gpT-like tail protein; Pat9b_3411; phage(gi169936021) | 1e-133 | Click |
6 | complement(3758215..3758337) | PHAGE_Entero_Fels_2: P2 gpE-like protein; Pat9b_3412; phage(gi169936022) | 7e-11 | Click |
7 | complement(3758352..3758654) | PHAGE_Entero_Fels_2: P2 gpE-like tail protein; Pat9b_3413; phage(gi169936023) | 1e-33 | Click |
8 | complement(3758709..3759224) | PHAGE_Entero_Fels_2: P2 gpFII-like protein; Pat9b_3414; phage(gi169936024) | 2e-84 | Click |
9 | complement(3759237..3760406) | PHAGE_Entero_Fels_2: P2 gpFI-like protein; Pat9b_3415; phage(gi169936025) | 0.0 | Click |
10 | complement(3760563..3760769) | hypothetical protein; Pat9b_3416 | N/A | Click |
11 | complement(3760769..3762268) | PHAGE_Entero_Fels_2: P2 gpH-like protein; Pat9b_3417; phage(gi169936030) | 2e-95 | Click |
12 | complement(3762265..3762879) | PHAGE_Entero_Fels_2: P2 gpI-like baseplate assembly protein; Pat9b_3418; phage(gi169936031) | 3e-89 | Click |
13 | complement(3762876..3763790) | PHAGE_Entero_Fels_2: P2 gpJ-like baseplate assembly protein; Pat9b_3419; phage(gi169936032) | 1e-108 | Click |
14 | complement(3763777..3764136) | PHAGE_Entero_Fels_2: P2 gpW-like baseplate protein; Pat9b_3420; phage(gi169936033) | 8e-42 | Click |
15 | complement(3764133..3764711) | PHAGE_Entero_Fels_2: P2 gpV-like protein; Pat9b_3421; phage(gi169936034) | 2e-74 | Click |
16 | 3764806..3765540 | hypothetical protein; Pat9b_3422 | N/A | Click |
17 | complement(3765563..3766006) | PHAGE_Entero_Fels_2: P2 gpS-like tail completion protein; Pat9b_3423; phage(gi169936035) | 1e-46 | Click |
18 | complement(3765999..3766430) | PHAGE_Entero_Fels_2: P2 gpR-like tail completion protein; Pat9b_3424; phage(gi169936036) | 1e-54 | Click |
19 | complement(3766526..3766954) | PHAGE_Entero_Fels_2: P2 LysB-like protein; Pat9b_3426; phage(gi169936038) | 5e-41 | Click |
20 | complement(3766951..3767466) | PHAGE_Entero_Fels_2: endolysin; Pat9b_3427; phage(gi169936041) | 3e-69 | Click |
21 | complement(3767447..3767659) | PHAGE_Entero_Fels_2: lysis protein; Pat9b_3428; phage(gi169936042) | 6e-21 | Click |
22 | complement(3767663..3767866) | PHAGE_Entero_Fels_2: P2 gpX-like tail protein; Pat9b_3429; phage(gi169936043) | 2e-28 | Click |
23 | complement(3767866..3768330) | PHAGE_Entero_Fels_2: P2 gpL-like protein; Pat9b_3430; phage(gi169936044) | 3e-62 | Click |
24 | complement(3768430..3769080) | PHAGE_Entero_Fels_2: P2 gpM-like protein; Pat9b_3431; phage(gi169936045) | 3e-86 | Click |
25 | complement(3769083..3770144) | PHAGE_Entero_Fels_2: P2 gpN-like major capsid protein; Pat9b_3432; phage(gi169936046) | 8e-145 | Click |
26 | complement(3770191..3771024) | PHAGE_Entero_Fels_2: P2 gpO-like protein; Pat9b_3433; phage(gi169936047) | 3e-118 | Click |
27 | 3771175..3772941 | PHAGE_Entero_Fels_2: P2 gpP-like protein; Pat9b_3434; phage(gi169936048) | 0.0 | Click |
28 | 3772942..3773973 | PHAGE_Entero_Fels_2: P2 gpQ-like protein; Pat9b_3435; phage(gi169936049) | 2e-172 | Click |
29 | 3773985..3774935 | PHAGE_Salmon_7_11: hypothetical protein; Pat9b_3436; phage(gi345461254) | 7e-14 | Click |
30 | complement(3774984..3775778) | hypothetical protein; Pat9b_3437 | N/A | Click |
31 | complement(3775809..3776180) | PHAGE_Lactob_prophage_Lj965: hypothetical protein Ljo_0305; Pat9b_3438; phage(gi41179237) | 5e-29 | Click |
32 | complement(3777474..3777662) | PHAGE_Entero_Fels_2: hypothetical protein STM2728.Fels2; Pat9b_3441; phage(gi169936053) | 3e-19 | Click |
33 | complement(3777765..3779774) | PHAGE_Erwini_ENT90: replication protein A; Pat9b_3442; phage(gi431810936) | 3e-143 | Click |
34 | complement(3779767..3780084) | hypothetical protein; Pat9b_3443 | N/A | Click |
35 | complement(3780081..3780308) | PHAGE_Entero_Fels_2: P2 gpOrf82-like protein; Pat9b_3444; phage(gi169936056) | 1e-17 | Click |
36 | complement(3780308..3780535) | PHAGE_Entero_Fels_2: hypothetical protein STM2732.Fels2; Pat9b_3445; phage(gi169936057) | 4e-09 | Click |
37 | complement(3780605..3780943) | PHAGE_Entero_Fels_2: hypothetical protein STM2733.Fels2; Pat9b_3446; phage(gi169936058) | 1e-27 | Click |
38 | complement(3781102..3781611) | PHAGE_Entero_Fels_2: bacteriophage regulatory protein CII; Pat9b_3448; phage(gi169936061) | 1e-54 | Click |
39 | complement(3781646..3781882) | PHAGE_Pasteu_F108: Cox; Pat9b_3449; phage(gi109302900) | 5e-06 | Click |
40 | 3781972..3782577 | PHAGE_Entero_Fels_2: P2 CI-like protein; Pat9b_3450; phage(gi169936063) | 5e-37 | Click |
41 | 3782586..3783617 | PHAGE_Entero_Fels_2: P2 Int-like protein; Pat9b_3451; phage(gi169936064) | 5e-103 | Click |
42 | 3783725..3784483 | PHAGE_Atelin_herpesvirus_3: orf 48; Pat9b_3452; phage(gi9631239) | 3e-08 | Click |
43 | 3785378..3785405 | attR TCGCTGGTTCAAACCCAGCAGGGGCCAC | N/A | Click |
44 | complement(3785432..3786475) | ImpA domain-containing protein; Pat9b_3453 | N/A | Click |
45 | complement(3786513..3786953) | type VI secretion system lysozyme-like protein; Pat9b_3454 | N/A | Click |