| Definition | Ethanoligenens harbinense YUAN-3 chromosome, complete genome. |
|---|---|
| Accession | NC_014828 |
| Length | 3,008,576 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 93922..95373 | PHAGE_Lactoc_1: TerL; Ethha_0089; phage(gi13786562) | 1e-129 | Click |
| 2 | 95391..96818 | PHAGE_Clostr_phiCD38_2: minor capsid protein; Ethha_0090; phage(gi333798110) | 3e-97 | Click |
| 3 | 96805..98472 | PHAGE_Clostr_phiCD38_2: minor capsid protein; Ethha_0091; phage(gi333798111) | 3e-61 | Click |
| 4 | 98485..98706 | hypothetical protein; Ethha_0092 | N/A | Click |
| 5 | 98871..99410 | PHAGE_Clostr_phiCD38_2: scaffolding protein; Ethha_0093; phage(gi333798113) | 1e-16 | Click |
| 6 | 99423..100598 | PHAGE_Mycoba_TM4: major capsid subunit gp9; Ethha_0094; phage(gi18496895) | 7e-37 | Click |
| 7 | 100612..100983 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0095; phage(gi333798115) | 3e-06 | Click |
| 8 | 100980..101402 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0096; phage(gi333798116) | 5e-05 | Click |
| 9 | 101407..101820 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0097; phage(gi333798117) | 8e-05 | Click |
| 10 | 101820..102245 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0098; phage(gi333798118) | 6e-29 | Click |
| 11 | 102242..102745 | hypothetical protein; Ethha_0099 | N/A | Click |
| 12 | 102758..103114 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0100; phage(gi333798120) | 1e-13 | Click |
| 13 | 103111..103710 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0101; phage(gi333798121) | 3e-24 | Click |
| 14 | 104009..106339 | PHAGE_Entero_phiFL1A: PblA-like tail protein; Ethha_0102; phage(gi281416377) | 4e-40 | Click |
| 15 | 106352..106897 | hypothetical protein; Ethha_0103 | N/A | Click |
| 16 | 106897..107802 | PHAGE_Bacill_vB_BceM_Bc431v3: hypothetical protein; Ethha_0104; phage(gi472437449) | 9e-07 | Click |
| 17 | 107802..109079 | PHAGE_Equid_8: envelope glycoprotein J; Ethha_0105; phage(gi386522795) | 2e-07 | Click |
Region 2, total : 39 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 499864..499883 | attL TGTTCAACTTTTGTTCAAGT | N/A | Click |
| 2 | complement(499958..501370) | PHAGE_Temper_1: integrase-like protein; Ethha_0463; phage(gi16271777) | 1e-19 | Click |
| 3 | complement(501342..502097) | PHAGE_Lister_A500: gp33; Ethha_0464; phage(gi157324992) | 2e-06 | Click |
| 4 | 502126..502137 | attL CTTTCTTTTAAT | N/A | Click |
| 5 | 502269..502505 | DNA binding domain protein, excisionase family; Ethha_0465 | N/A | Click |
| 6 | 502562..502897 | hypothetical protein; Ethha_0466 | N/A | Click |
| 7 | 502910..504313 | Relaxase/mobilization nuclease family protein; Ethha_0467 | N/A | Click |
| 8 | 504784..505005 | PHAGE_Lactob_KC5a: putative transcriptional regulator; Ethha_0468; phage(gi90592588) | 2e-05 | Click |
| 9 | 505141..506646 | PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; Ethha_0469; phage(gi423261981) | 5e-12 | Click |
| 10 | 506633..507667 | hypothetical protein; Ethha_0470 | N/A | Click |
| 11 | 507664..508230 | restriction modification system DNA specificity domain; Ethha_0471 | N/A | Click |
| 12 | complement(508219..508863) | PHAGE_Cafete_BV_PW1: putative DNA N6-adenine methyltransferase; Ethha_0472; phage(gi310831004) | 5e-08 | Click |
| 13 | 508920..509912 | PHAGE_Thermu_26: phage XerD-like integrase; Ethha_0473; phage(gi157265417) | 2e-15 | Click |
| 14 | 509926..510462 | restriction modification system DNA specificity domain; Ethha_0474 | N/A | Click |
| 15 | complement(510451..511032) | restriction modification system, type I; Ethha_0475 | N/A | Click |
| 16 | 511139..514156 | PHAGE_Lactoc_P087: putative helicase; Ethha_0476; phage(gi229604971) | 9e-06 | Click |
| 17 | 514229..514900 | restriction endonuclease; Ethha_0477 | N/A | Click |
| 18 | complement(515018..515584) | PHAGE_Salisa_1: hypothetical protein; Ethha_0478; phage(gi388570712) | 1e-30 | Click |
| 19 | complement(515878..516660) | PHAGE_Megavi_lba: putative peptidase C1-like protein; Ethha_0479; phage(gi448825360) | 8e-30 | Click |
| 20 | complement(516663..516917) | hypothetical protein; Ethha_0480 | N/A | Click |
| 21 | complement(516930..518105) | PHAGE_Clostr_phiSM101: autolytic lysozyme; Ethha_0481; phage(gi110804057) | 6e-18 | Click |
| 22 | complement(518180..518908) | PHAGE_Azospi_Cd: tail fiber protein; Ethha_0482; phage(gi168495153) | 8e-06 | Click |
| 23 | complement(518922..519977) | hypothetical protein; Ethha_0483 | N/A | Click |
| 24 | complement(519977..521254) | PHAGE_Equid_8: envelope glycoprotein J; Ethha_0484; phage(gi386522795) | 2e-07 | Click |
| 25 | complement(521254..522159) | PHAGE_Bacill_vB_BceM_Bc431v3: hypothetical protein; Ethha_0485; phage(gi472437449) | 9e-07 | Click |
| 26 | complement(522159..522704) | phage tail component; Ethha_0486 | N/A | Click |
| 27 | complement(522717..525896) | PHAGE_Clostr_phiCD38_2: tail tape measure; Ethha_0487; phage(gi333798123) | 2e-49 | Click |
| 28 | 525969..526505 | PHAGE_Lactob_1: hypothetical protein Lv-1_gp24; Ethha_0488; phage(gi219563221) | 6e-06 | Click |
| 29 | complement(526502..527110) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0489; phage(gi333798121) | 2e-24 | Click |
| 30 | complement(527107..527490) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0490; phage(gi333798120) | 3e-07 | Click |
| 31 | complement(527504..528007) | hypothetical protein; Ethha_0491 | N/A | Click |
| 32 | complement(528010..528429) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0492; phage(gi333798118) | 2e-27 | Click |
| 33 | complement(528429..528839) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0493; phage(gi333798117) | 8e-05 | Click |
| 34 | complement(528844..529266) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0494; phage(gi333798116) | 1e-06 | Click |
| 35 | complement(529263..529631) | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ethha_0495; phage(gi333798115) | 6e-07 | Click |
| 36 | complement(529644..530819) | PHAGE_Mycoba_TM4: major capsid subunit gp9; Ethha_0496; phage(gi18496895) | 6e-37 | Click |
| 37 | complement(530832..531371) | PHAGE_Clostr_phiCD38_2: scaffolding protein; Ethha_0497; phage(gi333798113) | 4e-15 | Click |
| 38 | complement(531534..531755) | hypothetical protein; Ethha_0498 | N/A | Click |
| 39 | complement(531758..533428) | PHAGE_Clostr_phiCD38_2: minor capsid protein; Ethha_0499; phage(gi333798111) | 8e-62 | Click |
| 40 | complement(533428..534852) | PHAGE_Clostr_phiCD38_2: minor capsid protein; Ethha_0500; phage(gi333798110) | 7e-99 | Click |
| 41 | complement(534879..536330) | PHAGE_Lactoc_1: TerL; Ethha_0501; phage(gi13786562) | 6e-129 | Click |
| 42 | 547416..547427 | attR CTTTCTTTTAAT | N/A | Click |
| 43 | 548051..548070 | attR TGTTCAACTTTTGTTCAAGT | N/A | Click |
Region 3, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1529010..1529021 | attL TCCGGCAAAGCG | N/A | Click |
| 2 | complement(1540100..1541302) | PHAGE_Roseob_SIO1: gp7; Ethha_1407; phage(gi9964615) | 6e-05 | Click |
| 3 | 1541507..1541686 | hypothetical protein; Ethha_1408 | N/A | Click |
| 4 | complement(1541712..1543097) | PHAGE_Entero_HK544: replicative DNA helicase; Ethha_1409; phage(gi428783262) | 2e-05 | Click |
| 5 | complement(1543156..1543917) | PHAGE_Thermu_77: amidase endolysin; Ethha_1410; phage(gi257136443) | 1e-11 | Click |
| 6 | 1544093..1544800 | ErfK/YbiS/YcfS/YnhG family protein; Ethha_1411 | N/A | Click |
| 7 | complement(1544744..1545298) | PHAGE_Acanth_mimivirus: probable methylated-DNA--protein-cysteine methyltransferase; Ethha_1412; phage(gi311978100) | 4e-16 | Click |
| 8 | 1545336..1546340 | PHAGE_Mycoba_BPs: integrase; Ethha_1413; phage(gi189043119) | 1e-12 | Click |
| 9 | complement(1546377..1547261) | PHAGE_Thermu_26: phage XerD-like integrase; Ethha_1414; phage(gi157265417) | 7e-18 | Click |
| 10 | complement(1547415..1548035) | protein of unknown function DUF95 transmembrane; Ethha_1415 | N/A | Click |
| 11 | complement(1548140..1548940) | pyrroline-5-carboxylate reductase; Ethha_1416 | N/A | Click |
| 12 | complement(1549069..1549230) | hypothetical protein; Ethha_1417 | N/A | Click |
| 13 | complement(1549227..1550585) | PHAGE_Campyl_CP21: radical SAM domain-containing protein; Ethha_1418; phage(gi422935264) | 4e-09 | Click |
| 14 | 1554369..1554380 | attR TCCGGCAAAGCG | N/A | Click |
Region 4, total : 49 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1953131..1955137) | PHAGE_Acinet_Bphi_B1251: putative restriction-modification protein; Ethha_1808; phage(gi423261981) | 2e-07 | Click |
| 2 | complement(1955228..1955443) | DNA binding domain protein, excisionase family; Ethha_1809 | N/A | Click |
| 3 | complement(1955436..1956293) | hypothetical protein; Ethha_1810 | N/A | Click |
| 4 | 1956533..1956724 | hypothetical protein; Ethha_1811 | N/A | Click |
| 5 | 1957017..1957517 | Bacterio-opsin activator HTH domain protein; Ethha_1812 | N/A | Click |
| 6 | 1957800..1958132 | hypothetical protein; Ethha_1813 | N/A | Click |
| 7 | 1958122..1959264 | PHAGE_Bacill_PBC1: hypothetical protein; Ethha_1814; phage(gi389060350) | 2e-82 | Click |
| 8 | 1959257..1959835 | PHAGE_Staphy_SMSAP5: hypothetical protein; Ethha_1815; phage(gi422935814) | 1e-41 | Click |
| 9 | 1959848..1960045 | hypothetical protein; Ethha_1816 | N/A | Click |
| 10 | 1960124..1962112 | PHAGE_Strept_6: putative DNA polymerase A domain; Ethha_1817; phage(gi28876473) | 1e-176 | Click |
| 11 | 1962209..1962631 | PHAGE_Vibrio_pYD21_A: hypothetical protein; Ethha_1818; phage(gi472340455) | 1e-07 | Click |
| 12 | 1962631..1964883 | PHAGE_Escher_ADB_2: hypothetical protein; Ethha_1819; phage(gi428782996) | 2e-17 | Click |
| 13 | 1965128..1965685 | hypothetical protein; Ethha_1820 | N/A | Click |
| 14 | 1965682..1965969 | PHAGE_Acyrth_1: hypothetical protein APSE-1_44; Ethha_1821; phage(gi9633591) | 7e-16 | Click |
| 15 | 1965947..1966459 | PHAGE_Pseudo_phiKZ: ORF296; Ethha_1822; phage(gi29135232) | 8e-07 | Click |
| 16 | 1966443..1967795 | PHAGE_Entero_phiFL4A: DNA helicase; Ethha_1823; phage(gi281416462) | 8e-131 | Click |
| 17 | 1967792..1968013 | hypothetical protein; Ethha_1824 | N/A | Click |
| 18 | 1968010..1968423 | sigma-70 region 4 domain protein; Ethha_1825 | N/A | Click |
| 19 | 1968578..1968931 | PHAGE_Burkho_phiE125: putative class I holin; Ethha_1826; phage(gi17975232) | 4e-18 | Click |
| 20 | 1969068..1969619 | hypothetical protein; Ethha_1827 | N/A | Click |
| 21 | 1969620..1970882 | PHAGE_Psychr_pOW20_A: DNA methylase; Ethha_1828; phage(gi472339820) | 2e-56 | Click |
| 22 | 1971650..1972381 | virulence-related protein; Ethha_1830 | N/A | Click |
| 23 | 1972378..1972602 | hypothetical protein; Ethha_1831 | N/A | Click |
| 24 | 1972604..1972789 | virulence-related protein; Ethha_1832 | N/A | Click |
| 25 | 1972910..1973386 | hypothetical protein; Ethha_1833 | N/A | Click |
| 26 | 1973389..1973616 | hypothetical protein; Ethha_1834 | N/A | Click |
| 27 | 1973736..1975343 | PHAGE_Nocard_NBR1: terminase large subunit; Ethha_1835; phage(gi372217589) | 3e-82 | Click |
| 28 | 1975422..1976768 | PHAGE_Burkho_phiE125: putative portal protein; Ethha_1836; phage(gi17975165) | 2e-74 | Click |
| 29 | 1976765..1977511 | PHAGE_Geobac_E2: putative Clp peptidase; Ethha_1837; phage(gi148747731) | 2e-45 | Click |
| 30 | 1977531..1978736 | PHAGE_Azospi_Cd: Phage major capsid protein; Ethha_1838; phage(gi168495136) | 2e-34 | Click |
| 31 | 1978805..1979083 | uncharacterized phage protein (possible DNA packaging); Ethha_1839 | N/A | Click |
| 32 | 1979083..1979415 | PHAGE_Clostr_PhiS63: gp8; Ethha_1840; phage(gi388570637) | 9e-05 | Click |
| 33 | 1979412..1979792 | PHAGE_Bacill_1: hypothetical protein BV1_gp26; Ethha_1841; phage(gi155042941) | 3e-13 | Click |
| 34 | 1979789..1980115 | PHAGE_Bacill_1: Putative aminopeptidase; Ethha_1842; phage(gi155042942) | 3e-19 | Click |
| 35 | 1980118..1980130 | attL ATTATGGCTAACA | N/A | Click |
| 36 | 1980121..1980717 | PHAGE_Bacill_1: hypothetical protein BV1_gp28; Ethha_1843; phage(gi155042943) | 1e-44 | Click |
| 37 | 1980729..1981106 | PHAGE_Bacill_1: hypothetical protein BV1_gp29; Ethha_1844; phage(gi155042944) | 3e-14 | Click |
| 38 | 1981103..1981267 | hypothetical protein; Ethha_1845 | N/A | Click |
| 39 | 1981283..1983997 | PHAGE_Geobac_E2: putative tail tape measure protein; Ethha_1846; phage(gi148747742) | 4e-99 | Click |
| 40 | 1983997..1985901 | PHAGE_Bacill_1: hypothetical protein BV1_gp32; Ethha_1847; phage(gi155042947) | 5e-14 | Click |
| 41 | 1985898..1987277 | PHAGE_Bacill_1: hypothetical protein BV1_gp33; Ethha_1848; phage(gi155042948) | 1e-35 | Click |
| 42 | 1987290..1987484 | hypothetical protein; Ethha_1849 | N/A | Click |
| 43 | 1987487..1988068 | hypothetical protein; Ethha_1850 | N/A | Click |
| 44 | 1988065..1990545 | glycosyl hydrolase-like protein; Ethha_1851 | N/A | Click |
| 45 | 1990633..1991046 | PHAGE_Bacill_WBeta: phage holin; Ethha_1852; phage(gi85701395) | 5e-26 | Click |
| 46 | 1991049..1991999 | PHAGE_Clostr_phiSM101: autolytic lysozyme; Ethha_1853; phage(gi110804057) | 4e-18 | Click |
| 47 | 1992121..1992543 | hypothetical protein; Ethha_1854 | N/A | Click |
| 48 | 1992536..1992700 | hypothetical protein; Ethha_1855 | N/A | Click |
| 49 | 1992758..1994551 | PHAGE_Bacill_phBC6A51: Site-specific recombinase; Ethha_1856; phage(gi31415812) | 2e-24 | Click |
| 50 | 1994530..1996113 | PHAGE_Bacill_WBeta: putative site-specific recombinase; Ethha_1857; phage(gi85701406) | 2e-27 | Click |
| 51 | 1996611..1996623 | attR ATTATGGCTAACA | N/A | Click |