The gene/protein map for AP011170 is currently unavailable.

Definition Candidatus Liberibacter solanacearum CLso-ZC1 chromosome, complete genome.
Accession NC_014774
Length 1,258,278
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 53 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 175469..175491  attL    CCTGTCGGGTGCACCATTAAAAC  N/A  Click
2 complement(175568..176017)  PHAGE_Pseudo_PAJU2: putative endolysin; CKC_00860; phage(gi209552446)  3e-22  Click
3 176085..176480  hypothetical protein; CKC_00865  N/A  Click
4 complement(176477..176953)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00870; phage(gi423262467)  4e-68  Click
5 complement(176950..177207)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00875; phage(gi423262468)  1e-22  Click
6 complement(177204..179636)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00880; phage(gi423262471)  6e-29  Click
7 complement(179700..180680)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00885; phage(gi423262472)  4e-12  Click
8 complement(180904..182547)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00890; phage(gi423262473)  8e-40  Click
9 complement(182571..182960)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00895; phage(gi423262473)  7e-05  Click
10 complement(182961..183407)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00900; phage(gi423262474)  9e-19  Click
11 complement(183410..184393)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00905; phage(gi423262475)  1e-22  Click
12 complement(184429..186726)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00910; phage(gi423262475)  1e-13  Click
13 complement(186726..188492)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00915; phage(gi423262476)  2e-115  Click
14 complement(188494..189012)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00920; phage(gi423262477)  9e-54  Click
15 complement(189018..190049)  PHAGE_Liberi_SC1: putative major capsid protein; CKC_00925; phage(gi423262478)  6e-154  Click
16 complement(190073..190255)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00930; phage(gi423262479)  2e-12  Click
17 190254..190568  PHAGE_Liberi_SC1: hypothetical protein; CKC_00935; phage(gi423262480)  3e-25  Click
18 complement(191100..192767)  PHAGE_Liberi_SC1: putative phage-related head-to-tail joining protein; CKC_00940; phage(gi423262481)  0.0  Click
19 complement(192764..193105)  PHAGE_Vibrio_VP93: hypothetical protein VPP93_gp32; CKC_00945; phage(gi229604956)  9e-05  Click
20 complement(193098..194627)  PHAGE_Liberi_SC1: putative phage terminase large subunit; CKC_00950; phage(gi423262483)  0.0  Click
21 complement(194836..195354)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00955; phage(gi423262484)  1e-48  Click
22 complement(196506..197087)  PHAGE_Liberi_SC1: hypothetical protein; CKC_00960; phage(gi423262485)  9e-35  Click
23 197251..197610  hypothetical protein; CKC_00965  N/A  Click
24 197629..198198  PHAGE_Strept_Sfi19: hypothetical protein Sfi19p28; CKC_00970; phage(gi9632919)  2e-29  Click
25 198282..198521  hypothetical protein; CKC_00975  N/A  Click
26 198615..199403  PHAGE_Liberi_SC1: putative Bro-N family phage antirepressor; CKC_00980; phage(gi423262499)  4e-58  Click
27 199423..199677  hypothetical protein; CKC_00985  N/A  Click
28 199680..199772  hypothetical protein; CKC_00990  N/A  Click
29 199772..199945  hypothetical protein; CKC_00995  N/A  Click
30 199945..200127  hypothetical protein; CKC_01000  N/A  Click
31 200120..200221  hypothetical protein; CKC_01005  N/A  Click
32 200227..201039  hypothetical protein; CKC_01010  N/A  Click
33 201067..202632  PHAGE_Liberi_SC1: hypothetical protein; CKC_01015; phage(gi423262469)  4e-15  Click
34 202720..203178  hypothetical protein; CKC_01020  N/A  Click
35 complement(203229..205289)  PHAGE_Liberi_SC1: phage associated primase; CKC_01025; phage(gi423262493)  0.0  Click
36 complement(205405..205611)  PHAGE_Liberi_SC1: phage associated primase; CKC_01030; phage(gi423262493)  9e-27  Click
37 complement(205612..205707)  PHAGE_Liberi_SC1: hypothetical protein; CKC_01035; phage(gi423262494)  3e-07  Click
38 complement(205694..206323)  PHAGE_Parame_NY2A: hypothetical protein NY2A_B805R; CKC_01040; phage(gi157953109)  6e-19  Click
39 complement(206320..206538)  hypothetical protein; CKC_01045  N/A  Click
40 206797..207015  hypothetical protein; CKC_01050  N/A  Click
41 207070..207456  PHAGE_Liberi_SC1: hypothetical protein; CKC_01055; phage(gi423262496)  5e-24  Click
42 207551..207769  PHAGE_Liberi_SC1: hypothetical protein; CKC_01060; phage(gi423262497)  4e-09  Click
43 208009..209175  PHAGE_Liberi_SC1: hypothetical protein; CKC_01065; phage(gi423262498)  1e-162  Click
44 209225..209416  PHAGE_Iodoba_phiPLPE: anti-repressor Ant; CKC_01070; phage(gi197085624)  2e-07  Click
45 209452..210243  PHAGE_Liberi_SC1: putative Bro-N family phage antirepressor; CKC_01075; phage(gi423262499)  5e-100  Click
46 210259..210903  PHAGE_Liberi_SC1: hypothetical protein; CKC_01080; phage(gi423262500)  1e-75  Click
47 210907..212928  PHAGE_Liberi_SC1: DNA polymerase A; CKC_01085; phage(gi423262501)  0.0  Click
48 212925..213230  PHAGE_Liberi_SC1: endonuclease; CKC_01090; phage(gi423262502)  1e-37  Click
49 213218..214588  PHAGE_Liberi_SC1: SNF2 Dead box helicase; CKC_01095; phage(gi423262503)  0.0  Click
50 214591..214974  PHAGE_Liberi_SC1: DNA ligase; CKC_01100; phage(gi423262504)  2e-18  Click
51 214976..215410  PHAGE_Liberi_SC1: guanylate kinase; CKC_01105; phage(gi423262505)  5e-35  Click
52 215424..215522  PHAGE_Liberi_SC2: guanylate kinase; CKC_01110; phage(gi423262548)  5e-07  Click
53 215524..215697  hypothetical protein; CKC_01115  N/A  Click
54 215823..216722  PHAGE_Azospi_Cd: integrase; CKC_01120; phage(gi168495175)  7e-24  Click
55 216820..216842  attR    CCTGTCGGGTGCACCATTAAAAC  N/A  Click
Region 2, total : 57 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1212581..1212596  attL    CGCGCCGGGATCACCA  N/A  Click
2 complement(1214438..1214914)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05710; phage(gi423262467)  2e-68  Click
3 complement(1214911..1215168)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05715; phage(gi423262468)  5e-17  Click
4 complement(1215165..1217597)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05720; phage(gi423262471)  6e-29  Click
5 complement(1217661..1218752)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05725; phage(gi423262472)  7e-13  Click
6 complement(1218755..1220506)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05730; phage(gi423262473)  2e-42  Click
7 complement(1220530..1220919)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05735; phage(gi423262473)  7e-05  Click
8 complement(1220920..1221366)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05740; phage(gi423262474)  9e-19  Click
9 complement(1221369..1222352)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05745; phage(gi423262475)  1e-22  Click
10 complement(1222388..1224871)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05750; phage(gi423262475)  2e-16  Click
11 complement(1224871..1226637)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05755; phage(gi423262476)  3e-116  Click
12 complement(1226639..1227157)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05760; phage(gi423262477)  3e-50  Click
13 complement(1227163..1228194)  PHAGE_Liberi_SC1: putative major capsid protein; CKC_05765; phage(gi423262478)  6e-154  Click
14 complement(1228218..1228922)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05770; phage(gi423262479)  5e-63  Click
15 complement(1228926..1229252)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05775; phage(gi423262480)  8e-28  Click
16 complement(1229245..1230912)  PHAGE_Liberi_SC1: putative phage-related head-to-tail joining protein; CKC_05780; phage(gi423262481)  0.0  Click
17 complement(1230909..1231250)  PHAGE_Vibrio_VP93: hypothetical protein VPP93_gp32; CKC_05785; phage(gi229604956)  9e-05  Click
18 complement(1231243..1232772)  PHAGE_Liberi_SC1: putative phage terminase large subunit; CKC_05790; phage(gi423262483)  0.0  Click
19 complement(1233262..1233804)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05795; phage(gi423262484)  3e-16  Click
20 complement(1234004..1234441)  PHAGE_Tetras_SI1: hypothetical protein; CKC_05800; phage(gi472342269)  2e-05  Click
21 complement(1234753..1235067)  hypothetical protein; CKC_05805  N/A  Click
22 complement(1235145..1235378)  hypothetical protein; CKC_05810  N/A  Click
23 1235672..1235845  hypothetical protein; CKC_05815  N/A  Click
24 complement(1236171..1236803)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05820; phage(gi423262485)  5e-34  Click
25 complement(1237061..1237738)  hypothetical protein; CKC_05825  N/A  Click
26 complement(1237820..1238575)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05830; phage(gi423262485)  1e-31  Click
27 1238741..1239094  hypothetical protein; CKC_05835  N/A  Click
28 1239127..1239342  PHAGE_Liberi_SC1: hypothetical protein; CKC_05840; phage(gi423262488)  6e-20  Click
29 1239487..1240272  PHAGE_Liberi_SC1: putative Bro-N family phage antirepressor; CKC_05845; phage(gi423262499)  2e-66  Click
30 1240292..1240546  hypothetical protein; CKC_05850  N/A  Click
31 1240549..1240641  hypothetical protein; CKC_05855  N/A  Click
32 1240641..1240814  hypothetical protein; CKC_05860  N/A  Click
33 1240814..1240996  hypothetical protein; CKC_05865  N/A  Click
34 1240989..1241090  hypothetical protein; CKC_05870  N/A  Click
35 1241096..1241908  hypothetical protein; CKC_05875  N/A  Click
36 1241936..1243501  PHAGE_Liberi_SC1: hypothetical protein; CKC_05880; phage(gi423262469)  4e-15  Click
37 1243589..1244017  hypothetical protein; CKC_05885  N/A  Click
38 complement(1244100..1245101)  PHAGE_Liberi_SC1: phage associated primase; CKC_05890; phage(gi423262493)  2e-165  Click
39 complement(1245091..1246161)  PHAGE_Liberi_SC1: phage associated primase; CKC_05895; phage(gi423262493)  7e-145  Click
40 complement(1246277..1246483)  PHAGE_Liberi_SC1: phage associated primase; CKC_05900; phage(gi423262493)  9e-27  Click
41 complement(1246484..1246579)  PHAGE_Liberi_SC1: hypothetical protein; CKC_05905; phage(gi423262494)  3e-07  Click
42 complement(1246566..1247195)  PHAGE_Parame_NY2A: hypothetical protein NY2A_B805R; CKC_05910; phage(gi157953109)  6e-19  Click
43 complement(1247192..1247410)  hypothetical protein; CKC_05915  N/A  Click
44 1247669..1247887  hypothetical protein; CKC_05920  N/A  Click
45 1247942..1248328  PHAGE_Liberi_SC1: hypothetical protein; CKC_05925; phage(gi423262496)  5e-24  Click
46 1248423..1248641  PHAGE_Liberi_SC1: hypothetical protein; CKC_05930; phage(gi423262497)  4e-09  Click
47 1248881..1250047  PHAGE_Liberi_SC1: hypothetical protein; CKC_05935; phage(gi423262498)  2e-165  Click
48 1250097..1250330  PHAGE_Iodoba_phiPLPE: anti-repressor Ant; CKC_05940; phage(gi197085624)  2e-07  Click
49 1250444..1251238  PHAGE_Liberi_SC1: putative Bro-N family phage antirepressor; CKC_05945; phage(gi423262499)  3e-98  Click
50 1251254..1251805  PHAGE_Liberi_SC1: hypothetical protein; CKC_05950; phage(gi423262500)  2e-60  Click
51 1251903..1253930  PHAGE_Liberi_SC1: DNA polymerase A; CKC_05955; phage(gi423262501)  0.0  Click
52 1253927..1254232  PHAGE_Liberi_SC1: endonuclease; CKC_05960; phage(gi423262502)  1e-37  Click
53 1254220..1255590  PHAGE_Liberi_SC1: SNF2 Dead box helicase; CKC_05965; phage(gi423262503)  0.0  Click
54 1255593..1255976  PHAGE_Liberi_SC1: DNA ligase; CKC_05970; phage(gi423262504)  2e-18  Click
55 1255978..1256412  PHAGE_Liberi_SC1: guanylate kinase; CKC_05975; phage(gi423262505)  5e-35  Click
56 1256426..1256524  PHAGE_Liberi_SC2: guanylate kinase; CKC_05980; phage(gi423262548)  5e-07  Click
57 1256526..1256699  hypothetical protein; CKC_05985  N/A  Click
58 1256825..1257724  PHAGE_Azospi_Cd: integrase; CKC_05990; phage(gi168495175)  7e-24  Click
59 1257822..1257837  attR    CGCGCCGGGATCACCA  N/A  Click