The gene/protein map for NC_000854 is currently unavailable.

Definition Dickeya dadantii Ech586 chromosome, complete genome.
Accession NC_013592
Length 4,818,394
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 39 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 818289..818332  attL    TGGTGGAGCTGGGGGGAGTTGAACCCCCGTCCGAAATTCCTACA  N/A  Click
2 complement(818382..819473)  PHAGE_Salmon_RE_2010: integrase; Dd586_0727; phage(gi418489683)  7e-151  Click
3 complement(819601..820248)  hypothetical protein; Dd586_0728  N/A  Click
4 complement(820249..821283)  hypothetical protein; Dd586_0729  N/A  Click
5 complement(821538..822101)  PHAGE_Entero_2: P2 CI-like protein; Dd586_0730; phage(gi169936063)  2e-34  Click
6 822231..822452  hypothetical protein; Dd586_0731  N/A  Click
7 822485..822994  PHAGE_Salmon_RE_2010: regulatory protein; Dd586_0732; phage(gi418489686)  2e-50  Click
8 823091..823246  hypothetical protein; Dd586_0733  N/A  Click
9 823259..823588  hypothetical protein; Dd586_0734  N/A  Click
10 823660..823890  PHAGE_Erwini_ENT90: putative prophage protein; Dd586_0735; phage(gi431810987)  1e-10  Click
11 823890..824213  hypothetical protein; Dd586_0736  N/A  Click
12 824210..826255  PHAGE_Vibrio_kappa: putative replication protein; Dd586_0737; phage(gi165970249)  2e-109  Click
13 complement(826295..826495)  hypothetical protein; Dd586_0738  N/A  Click
14 826784..826939  hypothetical protein; Dd586_0739  N/A  Click
15 complement(826946..827212)  PHAGE_Vibrio_kappa: hypothetical zinc-finger protein; Dd586_0740; phage(gi165970253)  4e-20  Click
16 complement(827266..828294)  PHAGE_Vibrio_kappa: hypothetical pbsx family phage portal protein; Dd586_0741; phage(gi165970255)  4e-82  Click
17 complement(828291..830066)  PHAGE_Vibrio_kappa: putative terminase ATPase subunit; Dd586_0742; phage(gi165970256)  4e-180  Click
18 830223..831059  PHAGE_Vibrio_kappa: putative capsid scaffolding protein; Dd586_0743; phage(gi165970257)  2e-30  Click
19 831114..832145  PHAGE_Vibrio_kappa: putative major capsid protein; Dd586_0744; phage(gi165970258)  7e-87  Click
20 832149..832850  PHAGE_Vibrio_kappa: putative terminase endonuclease subunit; Dd586_0745; phage(gi165970259)  4e-42  Click
21 832887..833399  PHAGE_Vibrio_kappa: putative head completion protein; Dd586_0746; phage(gi165970260)  2e-26  Click
22 833396..833893  PHAGE_Vibrio_kappa: hypothetical protein KP27; Dd586_0747; phage(gi165970261)  4e-09  Click
23 833890..834594  PHAGE_Vibrio_kappa: putative tail completion protein; Dd586_0748; phage(gi165970262)  6e-05  Click
24 834597..835712  PHAGE_Vibrio_kappa: putative tail sheath protein; Dd586_0749; phage(gi165970264)  1e-75  Click
25 835709..836164  PHAGE_Vibrio_kappa: putative tail tube protein; Dd586_0750; phage(gi165970265)  4e-31  Click
26 836173..836478  PHAGE_Burkho_KS9: holin gp22; Dd586_0751; phage(gi255033753)  1e-20  Click
27 836465..836806  PHAGE_Pseudo_PaP2: hypothetical protein PaP2_gp17; Dd586_0752; phage(gi48697087)  9e-27  Click
28 836806..837162  PHAGE_Erwini_phiEa104: hypothetical protein; Dd586_0753; phage(gi327198401)  2e-09  Click
29 837119..837298  hypothetical protein; Dd586_0754  N/A  Click
30 837295..837552  PHAGE_Vibrio_kappa: hypothetical protein KP36; Dd586_0755; phage(gi165970270)  3e-07  Click
31 837561..837743  PHAGE_Pasteu_F108: hypothetical protein F108p32; Dd586_0756; phage(gi109302928)  2e-09  Click
32 837740..839704  PHAGE_Vibrio_kappa: putative tail length determinator; Dd586_0757; phage(gi165970271)  7e-76  Click
33 839704..840033  PHAGE_Vibrio_kappa: hypothetical protein KP38; Dd586_0758; phage(gi165970272)  1e-19  Click
34 840030..841214  PHAGE_Vibrio_kappa: hypothetical protein KP39; Dd586_0759; phage(gi165970273)  2e-83  Click
35 841207..841839  PHAGE_Vibrio_kappa: hypothetical protein KP40; Dd586_0760; phage(gi165970274)  1e-36  Click
36 841848..843452  PHAGE_Vibrio_kappa: putative tail fiber protein; Dd586_0761; phage(gi165970275)  2e-41  Click
37 843452..844072  PHAGE_Entero_HK106: tail fiber assembly protein; Dd586_0762; phage(gi428783304)  2e-40  Click
38 844069..844794  PHAGE_Vibrio_kappa: hypothetical protein KP43; Dd586_0763; phage(gi165970277)  9e-12  Click
39 844766..845287  PHAGE_Vibrio_kappa: hypothetical protein KP44; Dd586_0764; phage(gi165970278)  2e-22  Click
40 845291..846943  PHAGE_Vibrio_kappa: hypothetical protein KP45; Dd586_0765; phage(gi165970279)  5e-96  Click
41 848156..848199  attR    TGGTGGAGCTGGGGGGAGTTGAACCCCCGTCCGAAATTCCTACA  N/A  Click
Region 2, total : 33 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(2010814..2012628)  PHAGE_Pseudo_YuA: hypothetical protein; Dd586_1770; phage(gi162135126)  6e-05  Click
2 complement(2012851..2014155)  guanine deaminase; Dd586_1771  N/A  Click
3 complement(2014545..2014736)  PHAGE_Yersin_413C: Ogr; Dd586_1772; phage(gi30065732)  4e-18  Click
4 complement(2014833..2016008)  PHAGE_Yersin_413C: gpD; Dd586_1773; phage(gi30065731)  8e-84  Click
5 complement(2016005..2016502)  PHAGE_Yersin_413C: gpU; Dd586_1774; phage(gi30065730)  1e-41  Click
6 complement(2016510..2017598)  hypothetical protein; Dd586_1775  N/A  Click
7 complement(2017591..2017710)  PHAGE_Yersin_413C: gpE+E'; Dd586_1776; phage(gi30065728)  2e-11  Click
8 complement(2017743..2018033)  PHAGE_Yersin_413C: gpE; Dd586_1777; phage(gi30065727)  1e-24  Click
9 complement(2018094..2018612)  PHAGE_Yersin_413C: FII; Dd586_1778; phage(gi30065726)  3e-69  Click
10 complement(2018627..2019796)  PHAGE_Yersin_413C: gpFI; Dd586_1779; phage(gi30065725)  0.0  Click
11 complement(2020023..2020634)  PHAGE_Entero_HK630: tail fiber assembly protein; Dd586_1780; phage(gi428782810)  4e-32  Click
12 complement(2020637..2021233)  PROPHAGE_Salmon_Ty2: variable tail fiber protein; Dd586_1781; phage(gi29143754)  3e-29  Click
13 complement(2021395..2021976)  PHAGE_Entero_P1: Cin; Dd586_1782; phage(gi46401653)  3e-64  Click
14 2022001..2022585  PROPHAGE_Salmon_Ty2: variable tail fiber protein; Dd586_1783; phage(gi29143754)  2e-31  Click
15 2022753..2024108  hypothetical protein; Dd586_1784  N/A  Click
16 2024261..2025607  major facilitator superfamily protein; Dd586_1785  N/A  Click
17 complement(2025696..2026262)  Smr protein/MutS2; Dd586_1786  N/A  Click
18 complement(2026416..2027621)  PROPHAGE_Salmon_Ty2: variable tail fiber protein; Dd586_1787; phage(gi29143754)  3e-98  Click
19 complement(2027850..2028461)  PROPHAGE_Salmon_Ty2: putative phage tail protein; Dd586_1788; phage(gi29143753)  4e-73  Click
20 complement(2028454..2029362)  PHAGE_Yersin_413C: gpJ; Dd586_1789; phage(gi30065720)  1e-125  Click
21 complement(2029367..2029717)  PHAGE_Yersin_413C: gpW; Dd586_1790; phage(gi30065719)  8e-36  Click
22 complement(2029714..2030367)  PHAGE_Yersin_413C: gpV; Dd586_1791; phage(gi30065718)  6e-79  Click
23 complement(2030695..2031156)  PHAGE_Yersin_413C: gpR; Dd586_1792; phage(gi30065716)  8e-31  Click
24 complement(2031199..2031402)  PHAGE_Yersin_413C: gpX; Dd586_1793; phage(gi30065711)  2e-21  Click
25 2031507..2031995  hypothetical protein; Dd586_1794  N/A  Click
26 complement(2031955..2032086)  hypothetical protein; Dd586_1795  N/A  Click
27 complement(2032096..2032317)  hypothetical protein; Dd586_1796  N/A  Click
28 complement(2032381..2034504)  PHAGE_Yersin_413C: gpA; Dd586_1797; phage(gi30065742)  7e-172  Click
29 complement(2034601..2034825)  PHAGE_Yersin_413C: hypothetical protein L-413Cp36; Dd586_1798; phage(gi30065740)  6e-15  Click
30 complement(2034825..2035040)  hypothetical protein; Dd586_1799  N/A  Click
31 complement(2035163..2035675)  PHAGE_Yersin_413C: gpB; Dd586_1800; phage(gi30065737)  1e-35  Click
32 complement(2035672..2036154)  hypothetical protein; Dd586_1801  N/A  Click
33 2036258..2037121  PHAGE_Entero_PsP3: CI; Dd586_1802; phage(gi41057393)  2e-84  Click
Region 3, total : 11 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2701746..2701823  attL    AAGTACCGGTTACTGACGGAAACCCCACAGAAACCCGCATCCTCTCTGAGTTTGCGGGTTTTTTGTTGCCTGTTATCT  N/A  Click
2 2701909..2703159  PHAGE_Entero_P4: integrase; Dd586_2389; phage(gi9627511)  2e-71  Click
3 2703327..2704070  hypothetical protein; Dd586_2390  N/A  Click
4 2704208..2704420  phage transcriptional regulator AlpA; Dd586_2391  N/A  Click
5 2704422..2704868  hypothetical protein; Dd586_2392  N/A  Click
6 2704883..2705725  PHAGE_Escher_TL_2011c: putative antirepressor; Dd586_2393; phage(gi418487055)  3e-24  Click
7 2706270..2706458  hypothetical protein; Dd586_2395  N/A  Click
8 2706451..2706657  PHAGE_Salmon_1: hypothetical protein STM0898.2n.Fels1; Dd586_2396; phage(gi169257165)  2e-13  Click
9 2706654..2707283  PHAGE_Entero_phiP27: hypothetical protein P27p06; Dd586_2397; phage(gi18249870)  9e-15  Click
10 2707294..2709993  PHAGE_Entero_P4: DNA primase; Dd586_2398; phage(gi9627512)  7e-42  Click
11 2710450..2710638  hypothetical protein; Dd586_2399  N/A  Click
12 2710622..2712316  PHAGE_Pectob_ZF40: putative tail-fiber/lysozyme protein; Dd586_2400; phage(gi422936697)  1e-154  Click
13 2714372..2714449  attR    AAGTACCGGTTACTGACGGAAACCCCACAGAAACCCGCATCCTCTCTGAGTTTGCGGGTTTTTTGTTGCCTGTTATCT  N/A  Click