Definition | Staphylococcus aureus subsp. aureus ED98, complete genome. |
---|---|
Accession | NC_013450 |
Length | 2,824,404 |
Legend
Hits against Virus and prophage DB | |
Hits against Bacterial DB or GenBank file |
Region 1, total : 22 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 828015..829040 | PHAGE_Plankt_PaV_LD: ABC transporter; SAAV_0784; phage(gi371496158) | 2e-30 | Click |
2 | 829033..829728 | ABC transporter, permease protein; SAAV_0785 | N/A | Click |
3 | 829746..830567 | ABC transporter, substrate-binding protein; SAAV_0786 | N/A | Click |
4 | 830549..830567 | attL AGTTATTCCTGCTAAATAA | N/A | Click |
5 | complement(830711..831931) | PHAGE_Staphy_PT1028: ORF002; SAAV_0787; phage(gi66395166) | 2e-105 | Click |
6 | complement(831945..833333) | PHAGE_Melano_entomopoxvirus: ORF MSV261 leucine rich repeat gene family protein, similar to Amsacta moorei entomopoxvirus Q3 ORF SW:P28854; SAAV_0788; phage(gi9631422) | 2e-09 | Click |
7 | complement(833360..833932) | PHAGE_Staphy_PT1028: ORF006; SAAV_0789; phage(gi66395170) | 1e-14 | Click |
8 | 834104..834325 | PHAGE_Thermo_THSA_485A: transcriptional regulator, XRE family; SAAV_0790; phage(gi397912660) | 3e-05 | Click |
9 | 834326..834598 | PHAGE_Staphy_PT1028: ORF019; SAAV_0791; phage(gi66395183) | 7e-40 | Click |
10 | 834610..834756 | pathogenicity island protein; SAAV_0792 | N/A | Click |
11 | 834749..834961 | PHAGE_Staphy_phiMR25: hypothetical protein; SAAV_0793; phage(gi189427130) | 6e-09 | Click |
12 | 834963..835322 | pathogenicity island protein; SAAV_0794 | N/A | Click |
13 | 835323..835640 | PHAGE_Staphy_PT1028: ORF016; SAAV_0795; phage(gi66395180) | 9e-21 | Click |
14 | 835704..836573 | PHAGE_Staphy_PT1028: ORF003; SAAV_0796; phage(gi66395167) | 3e-161 | Click |
15 | 836587..838296 | PHAGE_Staphy_PT1028: ORF001; SAAV_0797; phage(gi66395165) | 0.0 | Click |
16 | 838626..839006 | PHAGE_Staphy_PT1028: ORF013; SAAV_0798; phage(gi66395177) | 5e-70 | Click |
17 | 839003..839644 | PHAGE_Staphy_PT1028: ORF008; SAAV_0799; phage(gi66395172) | 6e-112 | Click |
18 | 839991..840332 | PHAGE_Staphy_PT1028: ORF015; SAAV_0800; phage(gi66395179) | 2e-60 | Click |
19 | 840344..840922 | PHAGE_Campyl_CP30A: recombination endonuclease; SAAV_0801; phage(gi410493113) | 3e-05 | Click |
20 | 840940..841158 | pathogenicity island protein ORF8; SAAV_0802 | N/A | Click |
21 | 841209..841736 | PHAGE_Staphy_PT1028: ORF010; SAAV_0803; phage(gi66395174) | 1e-92 | Click |
22 | 841739..842080 | PHAGE_Staphy_PT1028: ORF014; SAAV_0804; phage(gi66395178) | 3e-53 | Click |
23 | 842077..842646 | PHAGE_Staphy_PT1028: ORF009; phage; phage terminase family protein; SAAV_0805(gi66395173) | 7e-104 | Click |
24 | 846109..846127 | attR AGTTATTCCTGCTAAATAA | N/A | Click |
Region 2, total : 61 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 853657..853676 | attL TATTGATACCATTTTGATAC | N/A | Click |
2 | complement(853680..854729) | PHAGE_Staphy_phiETA2: integrase; SAAV_0818; phage(gi122891715) | 0.0 | Click |
3 | complement(854790..855758) | DNA adenine methylase; SAAV_0819 | N/A | Click |
4 | complement(855889..856452) | PHAGE_Microm_12T: site-specific DNA-methyltransferase CviBI; SAAV_0820; phage(gi472342749) | 3e-22 | Click |
5 | complement(856541..856870) | PHAGE_Staphy_phiETA: hypothetical protein phiETA_04; SAAV_0821; phage(gi17426232) | 2e-27 | Click |
6 | complement(856882..857598) | PHAGE_Staphy_phiETA: similar to phage phi PVL repressor; SAAV_0822; phage(gi17426234) | 1e-123 | Click |
7 | 857762..858004 | PHAGE_Staphy_phiPVL108: putative cro-like repressor; SAAV_0823; phage(gi119443659) | 6e-41 | Click |
8 | 858017..858460 | PHAGE_Staphy_CN125: hypothetical protein CUR005; SAAV_0824; phage(gi239507366) | 2e-74 | Click |
9 | 858475..858618 | PHAGE_Staphy_71: ORF132; SAAV_0825; phage(gi66396109) | 1e-19 | Click |
10 | complement(858628..859230) | PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp06; SAAV_0826; phage(gi215401176) | 6e-106 | Click |
11 | 859860..860612 | PHAGE_Staphy_CN125: anti-repressor; SAAV_0827; phage(gi239507368) | 5e-141 | Click |
12 | 860653..860943 | PHAGE_Bacill_Finn: hypothetical protein; SAAV_0828; phage(gi460042246) | 4e-10 | Click |
13 | complement(860955..861125) | hypothetical protein; SAAV_0829 | N/A | Click |
14 | 861196..861417 | PHAGE_Staphy_88: ORF071; SAAV_0830; phage(gi66396392) | 1e-34 | Click |
15 | 861665..861925 | PHAGE_Staphy_26: hypothetical protein SAP26_gp39; SAAV_0831; phage(gi304443277) | 8e-46 | Click |
16 | 861933..862169 | PHAGE_Staphy_StB27: hypothetical protein; SAAV_0832; phage(gi431809688) | 7e-19 | Click |
17 | 862162..862641 | PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp17; SAAV_0833; phage(gi119443669) | 8e-85 | Click |
18 | 862641..863279 | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p17; SAAV_0834; phage(gi9635694) | 6e-118 | Click |
19 | 863279..863704 | PHAGE_Staphy_IPLA88: putative ssDNA binding protein; SAAV_0835; phage(gi215401185) | 1e-74 | Click |
20 | 864389..864508 | PHAGE_Staphy_26: hypothetical protein SAP26_gp44; SAAV_0836; phage(gi304443282) | 3e-16 | Click |
21 | complement(864502..865152) | PHAGE_Staphy_26: hypothetical protein SAP26_gp45; SAAV_0837; phage(gi304443283) | 2e-121 | Click |
22 | 865207..865977 | PHAGE_Staphy_26: hypothetical protein SAP26_gp46; SAAV_0838; phage(gi304443284) | 2e-150 | Click |
23 | 865987..866760 | PHAGE_Staphy_CN125: hypothetical protein CUR020; SAAV_0839; phage(gi239507381) | 1e-147 | Click |
24 | 866754..866912 | PHAGE_Staphy_CN125: hypothetical protein CUR021; SAAV_0840; phage(gi239507382) | 2e-23 | Click |
25 | 867156..867473 | PHAGE_Staphy_phiMR11: putative resolvase; SAAV_0841; phage(gi162290129) | 2e-56 | Click |
26 | 867563..867748 | PHAGE_Staphy_phiETA: hypothetical protein phiETA_26; SAAV_0842; phage(gi17426254) | 2e-29 | Click |
27 | 867749..868108 | PHAGE_Staphy_42E: ORF039; SAAV_0843; phage(gi66395547) | 6e-63 | Click |
28 | 868369..868620 | PHAGE_Staphy_69: ORF060; SAAV_0844; phage(gi66395341) | 1e-38 | Click |
29 | 868613..869146 | PHAGE_Staphy_3A: ORF020; SAAV_0845; phage(gi66395608) | 4e-92 | Click |
30 | 869183..869428 | PHAGE_Staphy_CN125: hypothetical protein CUR029; SAAV_0846; phage(gi239507390) | 2e-38 | Click |
31 | 869425..869631 | PHAGE_Staphy_phiMR11: hypothetical protein; SAAV_0847; phage(gi162290141) | 1e-31 | Click |
32 | 869628..870014 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp36; SAAV_0848; phage(gi156603985) | 3e-68 | Click |
33 | 870319..870969 | PHAGE_Staphy_CN125: hypothetical protein CUR031; SAAV_0849; phage(gi239507392) | 1e-121 | Click |
34 | 870966..871169 | PHAGE_Staphy_CN125: hypothetical protein CUR032; SAAV_0850; phage(gi239507393) | 4e-32 | Click |
35 | 871192..871662 | PHAGE_Staphy_CN125: hypothetical protein CUR033; SAAV_0851; phage(gi239507394) | 1e-79 | Click |
36 | 871777..872229 | PHAGE_Staphy_CN125: hypothetical protein CUR034; SAAV_0852; phage(gi239507395) | 2e-82 | Click |
37 | 872236..872589 | PHAGE_Staphy_CN125: hypothetical protein CUR035; SAAV_0853; phage(gi239507396) | 6e-68 | Click |
38 | 872717..873187 | PHAGE_Staphy_CN125: terminase small subunit; SAAV_0854; phage(gi239507397) | 9e-81 | Click |
39 | 873187..874881 | PHAGE_Staphy_phiPV83: phi PVL ORF 2 homologue; SAAV_0855; phage(gi9635715) | 0.0 | Click |
40 | 874895..875095 | PHAGE_Staphy_CN125: hypothetical protein CUR038; SAAV_0856; phage(gi239507399) | 8e-28 | Click |
41 | 875161..876351 | PHAGE_Staphy_CN125: portal protein; SAAV_0857; phage(gi239507400) | 0.0 | Click |
42 | 876344..876928 | PHAGE_Staphy_CN125: prohead protease; SAAV_0858; phage(gi239507401) | 4e-109 | Click |
43 | 877016..878263 | PHAGE_Staphy_CN125: putative capsid protein; SAAV_0859; phage(gi239507402) | 0.0 | Click |
44 | 878299..878457 | PHAGE_Staphy_phiPV83: phi PVL ORF 8 homologue; SAAV_0860; phage(gi9635720) | 2e-23 | Click |
45 | 878466..878798 | PHAGE_Staphy_CN125: DNA packaging protein; SAAV_0861; phage(gi239507403) | 3e-59 | Click |
46 | 879120..879497 | PHAGE_Staphy_CN125: hypothetical protein CUR044; SAAV_0862; phage(gi239507405) | 4e-66 | Click |
47 | 879494..879874 | PHAGE_Staphy_CN125: hypothetical protein CUR045; SAAV_0863; phage(gi239507406) | 7e-71 | Click |
48 | 879875..880828 | PHAGE_Staphy_CN125: hypothetical protein CUR046; SAAV_0864; phage(gi239507407) | 1e-180 | Click |
49 | 880893..881339 | PHAGE_Staphy_CN125: hypothetical protein CUR047; SAAV_0865; phage(gi239507408) | 4e-80 | Click |
50 | 881399..881521 | PHAGE_Staphy_CN125: hypothetical protein CUR048; SAAV_0866; phage(gi239507409) | 1e-13 | Click |
51 | 881577..886226 | PHAGE_Staphy_CN125: tail length tape measure protein; SAAV_0867; phage(gi239507410) | 0.0 | Click |
52 | 886226..887716 | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp49; SAAV_0868; phage(gi156604066) | 0.0 | Click |
53 | 887732..891514 | PHAGE_Staphy_phiN315: hypothetical protein SA1764; SAAV_0869; phage(gi30043941) | 0.0 | Click |
54 | 891507..891659 | PHAGE_Staphy_phiN315: hypothetical protein SAS061; SAAV_0870; phage(gi30043940) | 2e-22 | Click |
55 | 891705..891992 | PHAGE_Staphy_CN125: hypothetical protein CUR057; SAAV_0871; phage(gi239507418) | 2e-46 | Click |
56 | 892048..892422 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAAV_0872; phage(gi431810282) | 6e-65 | Click |
57 | 892952..893227 | PHAGE_Staphy_phiETA: similar to phage phi PVL holin; SAAV_0873; phage(gi17426292) | 1e-48 | Click |
58 | 893214..894626 | PHAGE_Staphy_phiETA: similar to phage phi PVL amidase; SAAV_0874; phage(gi17426293) | 0.0 | Click |
59 | complement(894686..895243) | PHAGE_Staphy_71: ORF024; SAAV_0875; phage(gi66396064) | 5e-99 | Click |
60 | 895618..895770 | hypothetical protein; SAAV_0876 | N/A | Click |
61 | 895841..895951 | PHAGE_Staphy_55: ORF187; SAAV_0877; phage(gi66396189) | 6e-15 | Click |
62 | 895938..896138 | PHAGE_Staphy_55: ORF073; SAAV_0878; phage(gi66396175) | 3e-28 | Click |
63 | 896681..896700 | attR TATTGATACCATTTTGATAC | N/A | Click |
Region 3, total : 10 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(1745082..1746050) | PHAGE_Ostreo_OsV5: hypothetical protein OsV5_197f; SAAV_1688; phage(gi163955169) | 2e-12 | Click |
2 | complement(1746451..1746771) | PHAGE_Spirop_R8A2B: putative transposase; SAAV_1689; phage(gi9626114) | 5e-12 | Click |
3 | complement(1746902..1747414) | PHAGE_Spirop_R8A2B: putative transposase; SAAV_1690; phage(gi9626114) | 2e-05 | Click |
4 | complement(1747525..1747887) | putative lipoprotein; SAAV_1691 | N/A | Click |
5 | complement(1747934..1748527) | transposon-related protein; SAAV_1692 | N/A | Click |
6 | complement(1748533..1749561) | PHAGE_Staphy_vB_SauM_Romulus: tail lysin; SAAV_1693; phage(gi472437801) | 1e-12 | Click |
7 | complement(1749551..1751482) | PHAGE_Microm_12T: hypothetical protein; SAAV_1694; phage(gi472342674) | 2e-07 | Click |
8 | complement(1751505..1751738) | hypothetical protein; SAAV_1695 | N/A | Click |
9 | complement(1751757..1751924) | hypothetical protein; SAAV_1696 | N/A | Click |
10 | complement(1751928..1753289) | PHAGE_Bacill_B4: cell division FtsK/SpoIIIE-like protein; SAAV_1697; phage(gi410493290) | 1e-13 | Click |
Region 4, total : 64 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(2044774..2046228) | PHAGE_Staphy_SMSAP5: putative amidase; SAAV_2010; phage(gi422935803) | 0.0 | Click |
2 | complement(2046239..2046541) | PHAGE_Staphy_SMSAP5: holin; SAAV_2011; phage(gi422935838) | 1e-49 | Click |
3 | complement(2047080..2047379) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2012; phage(gi448244681) | 3e-52 | Click |
4 | complement(2047425..2047589) | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp63; SAAV_2013; phage(gi156604012) | 3e-26 | Click |
5 | complement(2047582..2047971) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2014; phage(gi448244680) | 5e-61 | Click |
6 | complement(2047971..2049437) | PHAGE_Staphy_42E: ORF005; SAAV_2015; phage(gi66395513) | 0.0 | Click |
7 | 2048691..2048703 | attL TTTTTGCCAATTT | N/A | Click |
8 | complement(2049437..2051347) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2016; phage(gi448244678) | 0.0 | Click |
9 | complement(2051363..2051653) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2017; phage(gi448244677) | 7e-51 | Click |
10 | complement(2051653..2053236) | PHAGE_Staphy_SMSAP5: prophage endopeptidase tail family protein; SAAV_2018; phage(gi422935801) | 0.0 | Click |
11 | complement(2053245..2054069) | PHAGE_Staphy_2: phage tail tape measure protein like; SAAV_2019; phage(gi156604006) | 1e-160 | Click |
12 | complement(2054069..2060245) | PHAGE_Staphy_phi7401PVL: phage tail tape measure protein; SAAV_2020; phage(gi448244674) | 0.0 | Click |
13 | complement(2060259..2060417) | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp49; SAAV_2021; phage(gi215401157) | 4e-21 | Click |
14 | complement(2060459..2060809) | PHAGE_Staphy_12: SLT orf 116b-like protein; SAAV_2022; phage(gi29028656) | 1e-60 | Click |
15 | complement(2060867..2061322) | PHAGE_Staphy_phi7401PVL: major tail protein2; SAAV_2023; phage(gi448244672) | 6e-79 | Click |
16 | complement(2061414..2062055) | PHAGE_Staphy_phi7401PVL: major tail protein1; SAAV_2024; phage(gi448244671) | 2e-119 | Click |
17 | complement(2062090..2062485) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2025; phage(gi448244670) | 5e-69 | Click |
18 | complement(2062486..2062887) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2026; phage(gi448244669) | 6e-69 | Click |
19 | complement(2062884..2063216) | PHAGE_Staphy_SMSAP5: hypothetical protein; SAAV_2027; phage(gi422935831) | 3e-58 | Click |
20 | complement(2063228..2063506) | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp49; SAAV_2028; phage(gi156603998) | 2e-48 | Click |
21 | complement(2063575..2064738) | PHAGE_Staphy_phi7401PVL: phage major capsid protein; SAAV_2029; phage(gi448244667) | 0.0 | Click |
22 | complement(2064750..2065523) | PHAGE_Staphy_SMSAP5: protease; SAAV_2030; phage(gi422935811) | 7e-143 | Click |
23 | complement(2065507..2066745) | PHAGE_Staphy_phi7401PVL: portal protein; SAAV_2031; phage(gi448244665) | 0.0 | Click |
24 | complement(2066750..2068441) | PHAGE_Staphy_phi7401PVL: terminase large subunit; SAAV_2032; phage(gi448244664) | 0.0 | Click |
25 | complement(2068431..2068736) | PHAGE_Staphy_phi7401PVL: terminase-small subunit; SAAV_2033; phage(gi448244663) | 6e-52 | Click |
26 | complement(2068863..2069177) | PHAGE_Staphy_42E: ORF046; SAAV_2034; phage(gi66395552) | 3e-59 | Click |
27 | complement(2069332..2069748) | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAAV_2035; phage(gi431810266) | 9e-78 | Click |
28 | complement(2069776..2069976) | PHAGE_Staphy_77: 77ORF071; SAAV_2036; phage(gi41189570) | 3e-28 | Click |
29 | complement(2069976..2070218) | PHAGE_Staphy_phiMR11: hypothetical protein; SAAV_2037; phage(gi162290142) | 1e-05 | Click |
30 | complement(2070215..2070421) | PHAGE_Staphy_42E: ORF081; SAAV_2038; phage(gi66395571) | 4e-32 | Click |
31 | complement(2070458..2070994) | PHAGE_Staphy_phi2958PVL: hypothetical protein phi2958PVL_gp25; SAAV_2039; phage(gi209363577) | 1e-97 | Click |
32 | complement(2070987..2071229) | PHAGE_Staphy_11: ETA orf 33-like protein; SAAV_2040; phage(gi29028587) | 4e-38 | Click |
33 | complement(2071219..2071470) | PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp32; SAAV_2041; phage(gi122891816) | 6e-41 | Click |
34 | complement(2071485..2071598) | PHAGE_Staphy_phiSLT: phi PVL ORF 51 analogue; SAAV_2042; phage(gi12719418) | 1e-14 | Click |
35 | complement(2071734..2072093) | PHAGE_Staphy_42E: ORF039; SAAV_2043; phage(gi66395547) | 2e-63 | Click |
36 | complement(2072094..2072279) | PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp23; SAAV_2044; phage(gi215401193) | 2e-27 | Click |
37 | complement(2072748..2073077) | hypothetical protein; SAAV_2045 | N/A | Click |
38 | complement(2073140..2073340) | hypothetical protein; SAAV_2046 | N/A | Click |
39 | complement(2073337..2075193) | PHAGE_Lister_P40: gp32; SAAV_2047; phage(gi207270806) | 6e-125 | Click |
40 | complement(2075215..2076948) | PHAGE_Lister_P35: gp33; SAAV_2048; phage(gi157325398) | 3e-112 | Click |
41 | complement(2076968..2077603) | PHAGE_Lister_P40: gp30; SAAV_2049; phage(gi207270804) | 3e-29 | Click |
42 | complement(2077626..2078384) | PHAGE_Lister_P35: gp31; SAAV_2050; phage(gi157325396) | 9e-31 | Click |
43 | complement(2078395..2078718) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2051; phage(gi448244651) | 9e-27 | Click |
44 | complement(2078731..2079342) | PHAGE_Lister_P40: gp28; SAAV_2052; phage(gi207270802) | 1e-49 | Click |
45 | complement(2079365..2079601) | PHAGE_Staphy_StB27: hypothetical protein; SAAV_2053; phage(gi431809688) | 5e-17 | Click |
46 | complement(2079609..2079869) | PHAGE_Staphy_187: ORF060; SAAV_2054; phage(gi66395264) | 2e-18 | Click |
47 | complement(2079968..2080129) | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp11; SAAV_2055; phage(gi156604028) | 2e-24 | Click |
48 | complement(2080126..2080446) | PHAGE_Staphy_1: hypothetical protein SPTP3101_gp10; SAAV_2056; phage(gi156603899) | 1e-58 | Click |
49 | complement(2080597..2080740) | PHAGE_Staphy_71: ORF132; SAAV_2057; phage(gi66396109) | 1e-19 | Click |
50 | 2081282..2081494 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp09; SAAV_2058; phage(gi156603958) | 4e-34 | Click |
51 | complement(2081535..2081684) | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp08; SAAV_2059; phage(gi156603957) | 3e-23 | Click |
52 | complement(2081699..2082142) | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp07; SAAV_2060; phage(gi156603956) | 2e-77 | Click |
53 | complement(2082155..2082403) | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2061; phage(gi448244649) | 1e-38 | Click |
54 | 2082567..2082890 | PHAGE_Staphy_phi7401PVL: phage repressor; SAAV_2062; phage(gi448244648) | 3e-55 | Click |
55 | 2082903..2083364 | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAAV_2063; phage(gi448244647) | 2e-85 | Click |
56 | 2083381..2083827 | PHAGE_Staphy_phi7401PVL: putative lipoprotein; SAAV_2064; phage(gi448244646) | 3e-37 | Click |
57 | 2083896..2084780 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp03; SAAV_2065; phage(gi118430727) | 6e-32 | Click |
58 | 2085101..2085454 | PHAGE_Staphy_42E: ORF026; SAAV_2066; phage(gi66395534) | 1e-59 | Click |
59 | 2085553..2085720 | hypothetical protein; SAAV_2067 | N/A | Click |
60 | 2086060..2086425 | PHAGE_Staphy_phiMR25: hypothetical protein; SAAV_2068; phage(gi189427124) | 6e-25 | Click |
61 | 2086438..2086764 | PHAGE_Staphy_phiMR25: hypothetical protein; SAAV_2069; phage(gi189427124) | 9e-13 | Click |
62 | 2086899..2086911 | attR TTTTTGCCAATTT | N/A | Click |
63 | 2086926..2087963 | PHAGE_Staphy_phiN315: integrase; SAAV_2070; phage(gi30043990) | 0.0 | Click |
64 | 2088020..2088844 | truncated beta hemolysin; SAAV_2071 | N/A | Click |
65 | complement(2089082..2090098) | PHAGE_Staphy_phi7401PVL: Panton-Valentine leukocidin chain F precursor; SAAV_2072; phage(gi448244685) | 2e-56 | Click |
66 | complement(2090120..2091175) | PHAGE_Staphy_phi7401PVL: Panton-Valentine leukocidin chain S precursor; SAAV_2073; phage(gi448244684) | 4e-41 | Click |