The gene/protein map for NC_000914 is currently unavailable.

Definition Slackia heliotrinireducens DSM 20476, complete genome.
Accession NC_013165
Length 3,165,038
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 13 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 943512..943523  attL    TTGGCTCGGCGG  N/A  Click
2 complement(950917..952557)  PHAGE_Clostr_phiMMP04: terminase; Shel_08190; phage(gi414090443)  4e-137  Click
3 complement(952564..952869)  PHAGE_Clostr_phiMMP04: hypothetical protein; Shel_08200; phage(gi414090493)  1e-09  Click
4 complement(953537..953830)  PHAGE_Clostr_phiMMP04: HNH endonuclease; Shel_08210; phage(gi414090491)  1e-15  Click
5 complement(953833..954153)  hypothetical protein; Shel_08220  N/A  Click
6 complement(954173..955384)  PHAGE_Clostr_phiMMP04: major capsid protein; Shel_08230; phage(gi414090446)  2e-22  Click
7 complement(955377..955949)  PHAGE_Staphy_StB20: prohead protease; Shel_08240; phage(gi431809768)  2e-15  Click
8 complement(955958..957208)  PHAGE_Clostr_phiMMP04: phage portal protein; Shel_08250; phage(gi414090444)  1e-33  Click
9 complement(957330..957578)  hypothetical protein; Shel_08260  N/A  Click
10 complement(958977..959984)  hypothetical protein; Shel_08280  N/A  Click
11 complement(960105..960344)  hypothetical protein; Shel_08290  N/A  Click
12 complement(960344..960553)  Helix-turn-helix protein; Shel_08300  N/A  Click
13 960673..961653  hypothetical protein; Shel_08310  N/A  Click
14 961257..961268  attR    TTGGCTCGGCGG  N/A  Click
15 961656..963038  PHAGE_Clostr_phiC2: putative integrase; Shel_08320; phage(gi134287379)  1e-19  Click
Region 2, total : 53 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1758975..1759048  attL    AAGTGTGTAATATCGTGCCTAAATGCGCCTAAGTTGTTCCCTACTTGTTCCCTACCTGTTCCCGCCCCGGACGC  N/A  Click
2 complement(1764221..1765225)  PHAGE_Lactoc_lato: putative tail-host specificity protein; Shel_15430; phage(gi30089906)  6e-15  Click
3 complement(1765242..1766792)  PHAGE_Clostr_phi8074_B1: putative phage tail protein; Shel_15440; phage(gi431810378)  4e-11  Click
4 complement(1766805..1767305)  PHAGE_Entero_WV8: putative tail fiber protein GP37; Shel_15450; phage(gi238801815)  2e-11  Click
5 complement(1767306..1768136)  hypothetical protein; Shel_15460  N/A  Click
6 complement(1768137..1770560)  PHAGE_Strept_phiNJ2: putative envelope protein; Shel_15470; phage(gi414090212)  2e-61  Click
7 complement(1770561..1770914)  hypothetical protein; Shel_15480  N/A  Click
8 complement(1770947..1771231)  hypothetical protein; Shel_15490  N/A  Click
9 complement(1771231..1771812)  PHAGE_Mycoba_TM4: major tail subunit gp14; Shel_15500; phage(gi18496900)  5e-12  Click
10 complement(1771825..1772190)  hypothetical protein; Shel_15510  N/A  Click
11 complement(1772204..1772458)  hypothetical protein; Shel_15520  N/A  Click
12 complement(1772448..1772792)  hypothetical protein; Shel_15530  N/A  Click
13 complement(1772785..1773177)  hypothetical protein; Shel_15540  N/A  Click
14 complement(1773177..1773344)  hypothetical protein; Shel_15550  N/A  Click
15 complement(1773347..1774231)  PHAGE_Rhodoc_RER2: major capsid protein; Shel_15560; phage(gi372449909)  2e-26  Click
16 complement(1774244..1774711)  PHAGE_Mycoba_LeBron: gp7; Shel_15570; phage(gi304360956)  1e-09  Click
17 complement(1774845..1775210)  hypothetical protein; Shel_15580  N/A  Click
18 complement(1775447..1776709)  PHAGE_Mycoba_Ramsey: gp5; Shel_15590; phage(gi206600186)  2e-06  Click
19 complement(1776681..1777091)  hypothetical protein; Shel_15600  N/A  Click
20 complement(1777072..1778535)  PHAGE_Propio_P105: putative portal; Shel_15610; phage(gi410491778)  1e-27  Click
21 complement(1778529..1779974)  PHAGE_Propio_ATCC29399B_T: putative terminase large subunit; Shel_15620; phage(gi410491676)  5e-57  Click
22 complement(1779964..1780179)  hypothetical protein; Shel_15630  N/A  Click
23 complement(1780321..1780656)  hypothetical protein; Shel_15640  N/A  Click
24 complement(1780646..1780855)  hypothetical protein; Shel_15650  N/A  Click
25 complement(1780999..1781490)  hypothetical protein; Shel_15660  N/A  Click
26 complement(1781472..1781621)  hypothetical protein; Shel_15670  N/A  Click
27 complement(1781931..1782149)  hypothetical protein; Shel_15680  N/A  Click
28 complement(1782146..1782412)  hypothetical protein; Shel_15690  N/A  Click
29 complement(1782412..1782684)  hypothetical protein; Shel_15700  N/A  Click
30 complement(1782681..1783064)  hypothetical protein; Shel_15710  N/A  Click
31 complement(1783061..1783420)  hypothetical protein; Shel_15720  N/A  Click
32 complement(1783420..1784022)  hypothetical protein; Shel_15730  N/A  Click
33 complement(1784019..1784204)  hypothetical protein; Shel_15740  N/A  Click
34 complement(1784219..1784470)  hypothetical protein; Shel_15750  N/A  Click
35 complement(1784467..1784673)  hypothetical protein; Shel_15760  N/A  Click
36 complement(1784679..1784891)  hypothetical protein; Shel_15770  N/A  Click
37 complement(1784888..1785238)  hypothetical protein; Shel_15780  N/A  Click
38 complement(1785238..1785624)  hypothetical protein; Shel_15790  N/A  Click
39 complement(1785637..1785732)  hypothetical protein; Shel_15800  N/A  Click
40 complement(1785729..1786079)  hypothetical protein; Shel_15810  N/A  Click
41 complement(1786076..1787071)  PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; Shel_15820; phage(gi31415769)  9e-14  Click
42 complement(1787073..1787306)  PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; Shel_15830; phage(gi31415768)  2e-07  Click
43 complement(1787303..1787542)  hypothetical protein; Shel_15840  N/A  Click
44 complement(1787544..1788296)  hypothetical protein; Shel_15850  N/A  Click
45 complement(1788306..1789502)  PROPHAGE_Mesorh_MAFF303099: bacteriophage integrase; Shel_15860; phage(gi13470699)  5e-18  Click
46 complement(1789499..1789843)  hypothetical protein; Shel_15870  N/A  Click
47 complement(1789840..1790001)  hypothetical protein; Shel_15880  N/A  Click
48 complement(1790212..1790379)  hypothetical protein; Shel_15890  N/A  Click
49 complement(1790384..1790791)  hypothetical protein; Shel_15900  N/A  Click
50 complement(1790803..1790964)  hypothetical protein; Shel_15910  N/A  Click
51 complement(1790961..1791161)  hypothetical protein; Shel_15920  N/A  Click
52 complement(1791206..1791424)  PHAGE_Vibrio_CTX: RstR; Shel_15930; phage(gi332672299)  9e-05  Click
53 1791580..1791939  predicted transcriptional regulator; Shel_15940  N/A  Click
54 1792044..1793165  PHAGE_Gifsy_2: bacteriophage integrase; Shel_15950; phage(gi169257268)  3e-07  Click
55 1793313..1793386  attR    AAGTGTGTAATATCGTGCCTAAATGCGCCTAAGTTGTTCCCTACTTGTTCCCTACCTGTTCCCGCCCCGGACGC  N/A  Click