Definition | Escherichia coli BW2952, complete genome. |
---|---|
Accession | NC_012759 |
Length | 4,578,159 |
Legend
Hits against Virus and prophage DB | |
Hits against Bacterial DB or GenBank file |
Region 1, total : 13 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 8238..9191 | PHAGE_Cyanop_MED4_213: TalC; BWG_0008; phage(gi472340344) | 2e-12 | Click |
2 | 9306..9893 | molybdenum cofactor biosynthesis protein MogA; BWG_0009 | N/A | Click |
3 | complement(9928..10494) | hypothetical protein; BWG_0010 | N/A | Click |
4 | complement(10643..11356) | hypothetical protein; BWG_0011 | N/A | Click |
5 | complement(11382..11786) | hypothetical protein; BWG_0012 | N/A | Click |
6 | 12163..14079 | PHAGE_Bathyc_BpV1: hypothetical protein; BWG_0013; phage(gi313768007) | 2e-154 | Click |
7 | 14168..15298 | PHAGE_Cafete_BV_PW1: putative DnaJ/Hsp40; BWG_0014; phage(gi310831116) | 4e-46 | Click |
8 | 15445..16557 | PROPHAGE_Escher_MG1655: IS186 transposase; BWG_0015; phage(gi90111427) | 0.0 | Click |
9 | complement(16751..16960) | PHAGE_Entero_Min27: mokW; BWG_0016; phage(gi170783687) | 3e-22 | Click |
10 | complement(16751..16903) | PHAGE_Entero_Min27: mokW; BWG_4269; phage(gi170783687) | 8e-17 | Click |
11 | 17489..18655 | pH-dependent sodium/proton antiporter; BWG_0017 | N/A | Click |
12 | 18715..19620 | transcriptional activator NhaR; BWG_0018 | N/A | Click |
13 | complement(19811..20314) | PROPHAGE_Escher_MG1655: IS1 transposase B; BWG_0019; phage(gi16131317) | 1e-96 | Click |
Region 2, total : 25 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 466738..466784 | attL CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT | N/A | Click |
2 | complement(466798..467961) | PHAGE_Salmon_epsilon34: Tyrosine integrase; putative; phage integrase; BWG_0411(gi221328640) | 0.0 | Click |
3 | 468816..469124 | PROPHAGE_Escher_MG1655: IS3 transposase A; BWG_0412; phage(gi226524700) | 4e-49 | Click |
4 | 469121..469987 | PROPHAGE_Escher_MG1655: IS3 transposase B; BWG_0413; phage(gi16128284) | 3e-173 | Click |
5 | 470298..470630 | PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; BWG_0414; phage(gi311992758) | 1e-10 | Click |
6 | 470688..470699 | attL TTTTATGCTTTT | N/A | Click |
7 | 470885..472411 | PHAGE_Bacill_WBeta: putative site-specific recombinase; putative; phage recombinase; BWG_0415(gi85701406) | 5e-09 | Click |
8 | 472876..473427 | putative kinase inhibitor; BWG_0416 | N/A | Click |
9 | 473437..474234 | DLP12 prophage; putative DNA-binding transcriptional regulator; BWG_0417 | N/A | Click |
10 | 474351..474452 | hypothetical protein; BWG_0418 | N/A | Click |
11 | 474449..474904 | PHAGE_Cronob_phiES15: hypothetical protein; BWG_0419; phage(gi401817579) | 6e-61 | Click |
12 | 474904..475074 | PHAGE_Escher_HK639: NinE; BWG_0420; phage(gi356870663) | 6e-15 | Click |
13 | 475067..475357 | PHAGE_Entero_mEp237: hypothetical protein; hypothetical; phage protein; BWG_0421(gi435439317) | 8e-49 | Click |
14 | 475354..475716 | PHAGE_Entero_mEp237: Holliday junction resolvase RusA; BWG_0422; phage(gi435439318) | 5e-62 | Click |
15 | 475713..475853 | PHAGE_Entero_mEp237: hypothetical protein; hypothetical; phage protein; BWG_0423(gi435439319) | 1e-10 | Click |
16 | 475939..476322 | PHAGE_Entero_2008: antitermination protein Q; putative; phage antitermination protein; BWG_0424(gi209427762) | 5e-56 | Click |
17 | complement(476720..477736) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; BWG_0425; phage(gi16131377) | 0.0 | Click |
18 | 479381..479596 | PHAGE_Stx2_c_II: holin; putative; phage phage lysis protein; BWG_0426(gi302393164) | 1e-28 | Click |
19 | 479596..480093 | PHAGE_Entero_cdtI: lysin; putative; phage lysozyme; BWG_0427(gi148609440) | 3e-92 | Click |
20 | 480090..480551 | PHAGE_Entero_HK629: cell lysis protein Rz; putative; phage murein endopeptidase; BWG_0428(gi428782076) | 2e-79 | Click |
21 | 480310..480492 | PHAGE_Entero_HK629: Rz1 protein; putative; phage lipoprotein; BWG_0429(gi428782077) | 1e-29 | Click |
22 | complement(480583..480876) | PHAGE_Escher_TL_2011c: Bor protein precursor; putative; phage lipoprotein; BWG_0430(gi418487071) | 2e-49 | Click |
23 | complement(481167..481577) | PHAGE_Entero_HK629: putative envelope protein; hypothetical; phage protein; BWG_0431(gi428782079) | 7e-75 | Click |
24 | 481863..482069 | PHAGE_Entero_HK629: hypothetical protein; hypothetical; phage protein; BWG_0432(gi428782080) | 1e-32 | Click |
25 | complement(482234..482428) | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; BWG_0433; phage(gi209427772) | 2e-19 | Click |
26 | 482817..483362 | PHAGE_Entero_HK629: terminase small subunit nu1; DNA; phage packaging protein; BWG_0434(gi428782012) | 1e-96 | Click |
27 | 485664..486413 | DLP12 prophage; DNA-binding transcriptional activator; BWG_0435 | N/A | Click |
28 | 487802..487813 | attR TTTTATGCTTTT | N/A | Click |
29 | 488040..488086 | attR CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT | N/A | Click |
Region 3, total : 26 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 1284825..1284837 | attL CGTCATGCCGGAA | N/A | Click |
2 | 1289661..1289673 | attL TTCGCACCTTCCC | N/A | Click |
3 | 1299594..1300967 | PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; BWG_1177; phage(gi310831360) | 1e-46 | Click |
4 | complement(1301096..1302031) | PHAGE_Parame_FR483: hypothetical protein FR483_N404R; BWG_1178; phage(gi155370502) | 3e-08 | Click |
5 | complement(1302083..1303318) | PHAGE_Gifsy_2: bacteriophage integrase; integrase;; phage BWG_1179(gi169257268) | 2e-90 | Click |
6 | complement(1303320..1303535) | Rac prophage; hypothetical protein; BWG_1180 | N/A | Click |
7 | complement(1303614..1303823) | hypothetical protein; BWG_1181 | N/A | Click |
8 | complement(1303816..1304010) | restriction alleviation and modification protein; BWG_1182 | N/A | Click |
9 | complement(1304067..1304876) | PHAGE_Entero_epsilon15: RecT; BWG_1183; phage(gi30387413) | 1e-81 | Click |
10 | complement(1304869..1307469) | PHAGE_Erwini_phiEt88: exodeoxyribonuclease; BWG_1184; phage(gi327198600) | 1e-83 | Click |
11 | complement(1307571..1307846) | hypothetical protein; BWG_1185 | N/A | Click |
12 | complement(1307921..1308091) | PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; hypothetical; phage protein; BWG_1186(gi169257274) | 5e-06 | Click |
13 | complement(1308091..1308312) | PHAGE_Escher_P13374: host killing protein; BWG_1187; phage(gi410491620) | 9e-06 | Click |
14 | 1308754..1309242 | PHAGE_Entero_lambda: Superinfection exclusion protein B; phage; phage superinfection exclusion protein; BWG_1188(gi19263394) | 1e-07 | Click |
15 | complement(1309239..1309394) | PHAGE_Salico_CGphi29: hypothetical protein; hypothetical; phage protein; BWG_1189(gi472340166) | 7e-10 | Click |
16 | complement(1309405..1309539) | Rac prophage; hypothetical protein; BWG_1190 | N/A | Click |
17 | complement(1309848..1310324) | Rac prophage; putative DNA-binding transcriptional regulator; BWG_1191 | N/A | Click |
18 | 1310448..1310744 | PHAGE_Aggreg_S1249: phage protein; putative; phage DNA-binding transcriptional regulator; BWG_1192(gi273809591) | 2e-14 | Click |
19 | 1310767..1311189 | PHAGE_Entero_mEp237: CII protein; hypothetical; phage protein; BWG_1193(gi435439306) | 3e-08 | Click |
20 | 1311202..1312059 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; hypothetical; phage protein; BWG_1194(gi169257279) | 9e-23 | Click |
21 | 1312066..1312812 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; BWG_1195; phage(gi169257280) | 3e-76 | Click |
22 | 1313483..1313668 | PHAGE_Entero_HK630: Rz1 protein; putative; phage lipoprotein; BWG_1196(gi428782853) | 7e-29 | Click |
23 | 1313865..1315322 | Rac prophage; potassium transporter subunit; BWG_1197 | N/A | Click |
24 | 1315460..1315723 | PHAGE_Psychr_pOW20_A: DNA methylase; hypothetical; phage protein; BWG_1198(gi472339820) | 6e-21 | Click |
25 | complement(1317829..1318809) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; BWG_1199; phage(gi16131377) | 0.0 | Click |
26 | 1318866..1318878 | attR TTCGCACCTTCCC | N/A | Click |
27 | 1319132..1322494 | PHAGE_Entero_mEp460: side tail fiber protein; putative; phage tail fiber protein; BWG_1200(gi428782336) | 2e-149 | Click |
28 | 1322494..1323069 | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; putative; phage tail fiber assembly protein; BWG_1201(gi16129505) | 9e-109 | Click |
29 | complement(1323167..1323757) | PHAGE_Escher_D108: G region invertase; putative; phage site-specific recombinase; BWG_1202(gi281199698) | 7e-25 | Click |
30 | 1325134..1325146 | attR CGTCATGCCGGAA | N/A | Click |
Region 4, total : 33 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(1519536..1520996) | PHAGE_Microm_MpV1: hypothetical protein; BWG_1362; phage(gi313768442) | 1e-40 | Click |
2 | 1523122..1523388 | Qin prophage; putative DNA-binding transcriptional regulator; BWG_1363 | N/A | Click |
3 | 1523544..1523555 | attL CCATTTTTCACA | N/A | Click |
4 | 1523705..1524295 | PHAGE_Escher_D108: G region invertase; putative; phage site-specific recombinase; BWG_1364(gi281199698) | 5e-25 | Click |
5 | complement(1524393..1524968) | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; putative; phage tail fibre assembly protein; BWG_1365(gi16129505) | 2e-109 | Click |
6 | complement(1524968..1525930) | PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; putative; phage side tail fibre assembly protein; BWG_1366(gi16129506) | 0.0 | Click |
7 | 1526839..1527072 | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; BWG_1367; phage(gi209427772) | 7e-21 | Click |
8 | 1527130..1527540 | PHAGE_Entero_HK629: putative envelope protein; hypothetical; phage protein; BWG_1368(gi428782079) | 2e-60 | Click |
9 | complement(1527692..1527865) | Qin prophage; hypothetical protein; BWG_1369 | N/A | Click |
10 | complement(1528037..1528192) | Qin prophage; hypothetical protein; BWG_1370 | N/A | Click |
11 | complement(1528538..1528750) | PHAGE_Lactoc_bIL312: Csp; cold; phage shock protein; BWG_1371(gi13095918) | 1e-15 | Click |
12 | complement(1529113..1529610) | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; hypothetical; phage protein; BWG_1372(gi16765210) | 2e-53 | Click |
13 | complement(1529607..1530140) | PHAGE_Entero_mEp460: endolysin; putative; phage lysozyme; BWG_1373(gi428782372) | 2e-97 | Click |
14 | complement(1530137..1530448) | PHAGE_Entero_mEp460: hypothetical protein; hypothetical; phage protein; BWG_1374(gi428782371) | 1e-29 | Click |
15 | complement(1530453..1530668) | PHAGE_Entero_mEp460: porin; putative; phage S lysis protein; BWG_1375(gi428782370) | 3e-33 | Click |
16 | complement(1531422..1531637) | PHAGE_Lactoc_bIL312: Csp; cold; phage shock protein; BWG_1376(gi13095918) | 5e-16 | Click |
17 | 1531938..1532150 | Qin prophage; cold shock protein; BWG_1377 | N/A | Click |
18 | complement(1532572..1533324) | PHAGE_Entero_mEp460: late gene regulator; putative; phage antitermination protein Q; BWG_1378(gi428782366) | 4e-137 | Click |
19 | complement(1533338..1534285) | PHAGE_Entero_mEp460: hypothetical protein; hypothetical; phage protein; BWG_1379(gi428782365) | 1e-104 | Click |
20 | complement(1534734..1534985) | Qin prophage; hypothetical protein; BWG_1380 | N/A | Click |
21 | complement(1535202..1535357) | PHAGE_Stx2_c_II: putative host killer protein; small; phage toxic polypeptide; BWG_1381(gi302393105) | 3e-19 | Click |
22 | complement(1535429..1535716) | Qin prophage; toxin of the RelE-RelB toxin-antitoxin system; BWG_1382 | N/A | Click |
23 | complement(1535716..1535955) | bifunctional antitoxin/transcriptional repressor RelB; BWG_1383 | N/A | Click |
24 | 1535980..1536285 | Qin prophage; hypothetical protein; BWG_1384 | N/A | Click |
25 | 1536488..1536820 | Qin prophage; hypothetical protein; BWG_1385 | N/A | Click |
26 | complement(1537205..1537432) | Qin prophage; hypothetical protein; BWG_1386 | N/A | Click |
27 | complement(1537429..1537719) | Qin prophage; hypothetical protein; BWG_1387 | N/A | Click |
28 | complement(1537703..1537933) | PHAGE_Pectob_ZF40: putative cro anti-repressor; BWG_1388; phage(gi422936651) | 1e-08 | Click |
29 | 1538017..1538424 | PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; BWG_1389; phage(gi401817574) | 5e-33 | Click |
30 | 1538591..1538746 | PHAGE_Salico_CGphi29: hypothetical protein; hypothetical; phage protein; BWG_1390(gi472340166) | 2e-09 | Click |
31 | 1538748..1538876 | Qin prophage; hypothetical protein; BWG_1391 | N/A | Click |
32 | 1539692..1539880 | Qin prophage; cell division inhibition protein; BWG_1392 | N/A | Click |
33 | 1539877..1540068 | Qin prophage; hypothetical protein; BWG_1393 | N/A | Click |
34 | complement(1542979..1543998) | PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; BWG_1394; phage(gi326781942) | 2e-18 | Click |
35 | 1554594..1554605 | attR CCATTTTTCACA | N/A | Click |
Region 5, total : 8 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(1959459..1960364) | PROPHAGE_Escher_MG1655: IS2 transposase TnpB; BWG_1789; phage(gi16130763) | 6e-179 | Click |
2 | complement(1960322..1960687) | PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; BWG_1790; phage(gi17546153) | 1e-45 | Click |
3 | 1962046..1965165 | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; antigen; phage 43 (Ag43) phase-variable biofilm formation autotransporter; BWG_1791(gi414087138) | 2e-18 | Click |
4 | 1965286..1966818 | CP4-44 prophage; putative membrane protein; BWG_1792 | N/A | Click |
5 | 1966815..1967261 | CP4-44 prophage; putative DNA repair protein; BWG_1793 | N/A | Click |
6 | 1967324..1967545 | CP4-44 prophage; hypothetical protein; BWG_1794 | N/A | Click |
7 | 1967619..1967987 | CP4-44 prophage; antitoxin of the YeeV-YeeU toxin-antitoxin system; BWG_1795 | N/A | Click |
8 | 1968076..1968450 | CP4-44 prophage; toxin of the YeeV-YeeU toxin-antitoxin system; BWG_1796 | N/A | Click |
Region 6, total : 13 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 2350181..2350196 | attL TTGCAGGTTCGATTCC | N/A | Click |
2 | 2350372..2351529 | PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; putative; phage prophage CPS-53 integrase; BWG_2120(gi16130281) | 0.0 | Click |
3 | 2351682..2352044 | PHAGE_Entero_SfV: putative flippase; bactoprenol-linked; phage glucose translocase (flippase); BWG_2121(gi19549013) | 1e-58 | Click |
4 | 2352041..2352961 | PHAGE_Entero_SfV: bactoprenol glucosyltransferase; bactoprenol; phage glucosyl transferase; BWG_2122(gi19549012) | 6e-163 | Click |
5 | 2352958..2354289 | CPS-53 (KpLE1) prophage; putative inner membrane protein; BWG_2123 | N/A | Click |
6 | complement(2354904..2355344) | PHAGE_Entero_mEp213: tail fiber assembly protein; hypothetical; phage protein; BWG_2124(gi428782612) | 2e-26 | Click |
7 | complement(2356214..2356708) | PHAGE_Entero_SfV: hypothetical protein SfVp40; hypothetical; phage protein; BWG_2125(gi19549027) | 2e-87 | Click |
8 | 2357431..2357793 | PHAGE_Entero_SfV: hypothetical protein SfVp32; hypothetical; phage protein; BWG_2126(gi19549019) | 6e-63 | Click |
9 | 2357859..2358683 | PHAGE_Entero_SfV: hypothetical protein SfVp31; hypothetical; phage protein; BWG_2127(gi19549018) | 3e-151 | Click |
10 | 2358811..2359347 | PHAGE_Entero_SfV: hypothetical protein SfVp30; hypothetical; phage protein; BWG_2128(gi19549017) | 3e-99 | Click |
11 | 2359338..2359700 | PHAGE_Entero_SfV: hypothetical protein SfVp29; hypothetical; phage protein; BWG_2129(gi19549016) | 5e-67 | Click |
12 | 2359700..2360005 | PHAGE_Entero_SfV: hypothetical protein SfVp28; hypothetical; phage protein; BWG_2130(gi19549015) | 3e-52 | Click |
13 | 2360102..2360117 | attR TTGCAGGTTCGATTCC | N/A | Click |
14 | 2360137..2360337 | PHAGE_Entero_HK633: hypothetical protein; BWG_2131; phage(gi428782548) | 3e-34 | Click |
15 | 2360411..2360425 | tRNA | N/A | Click |
16 | complement(2360521..2361456) | PHAGE_Burkho_phi1026b: gp58; BWG_2132; phage(gi38707948) | 1e-15 | Click |
Region 7, total : 23 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 2639631..2639643 | attL GAAGCCCTGCCTG | N/A | Click |
2 | 2639993..2641234 | PHAGE_Entero_P4: integrase; BWG_2379; phage(gi9627511) | 1e-65 | Click |
3 | complement(2641478..2642434) | CP4-57 prophage; hypothetical protein; BWG_2380 | N/A | Click |
4 | 2642478..2642690 | PHAGE_Entero_P4: transcriptional regulator; DNA-binding; phage transcriptional activator; BWG_2381(gi9627517) | 9e-05 | Click |
5 | 2642819..2644228 | PHAGE_Entero_TLS: YfiJ; hypothetical; phage protein; BWG_2382(gi148734544) | 1e-06 | Click |
6 | 2644381..2645007 | CP4-57 prophage; hypothetical protein; BWG_2383 | N/A | Click |
7 | complement(2645185..2647374) | CP4-57 prophage; hypothetical protein; BWG_2384 | N/A | Click |
8 | complement(2647371..2648987) | CP4-57 prophage; hypothetical protein; BWG_2385 | N/A | Click |
9 | complement(2649347..2649610) | CP4-57 prophage; hypothetical protein; BWG_2386 | N/A | Click |
10 | 2649752..2650825 | CP4-57 prophage; RNase LS; BWG_2387 | N/A | Click |
11 | 2650818..2651189 | CP4-57 prophage; hypothetical protein; BWG_2388 | N/A | Click |
12 | 2651544..2652407 | CP4-57 prophage; putative GTP-binding protein; BWG_2389 | N/A | Click |
13 | 2652499..2653320 | PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; hypothetical; phage protein; BWG_2390(gi414086954) | 6e-45 | Click |
14 | 2653537..2654238 | CP4-57 prophage; putative DNA-binding transcriptional regulator; BWG_2391 | N/A | Click |
15 | 2654279..2654515 | CP4-57 prophage; putative inner membrane protein; BWG_2392 | N/A | Click |
16 | 2654515..2654958 | CP4-57 prophage; hypothetical protein; BWG_2393 | N/A | Click |
17 | 2654982..2655449 | CP4-57 prophage; hypothetical protein; BWG_2394 | N/A | Click |
18 | 2657152..2658855 | CP4-57 prophage; putative inner membrane protein; BWG_2395 | N/A | Click |
19 | 2659753..2660211 | PHAGE_Pseudo_YuA: hypothetical protein; putative; phage antirestriction protein; BWG_2396(gi162135127) | 4e-15 | Click |
20 | 2660220..2660702 | CP4-57 prophage; putative DNA repair protein; BWG_2397 | N/A | Click |
21 | 2660711..2660911 | hypothetical protein; BWG_2398 | N/A | Click |
22 | 2660949..2661266 | CP4-57 prophage; antitoxin of the YpjF-YfjZ toxin-antitoxin system; BWG_2399 | N/A | Click |
23 | 2661287..2661616 | CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system; BWG_2400 | N/A | Click |
24 | 2661322..2661334 | attR GAAGCCCTGCCTG | N/A | Click |
25 | complement(2661980..2666560) | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; BWG_2401; phage(gi414087138) | 2e-19 | Click |
Region 8, total : 53 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(4131538..4132128) | PHAGE_Entero_Mu: transposase; BWG_3689; phage(gi9633496) | 2e-09 | Click |
2 | 4132527..4133786 | PHAGE_Entero_Mu: transposase; BWG_3690; phage(gi9633496) | 0.0 | Click |
3 | 4133862..4134518 | PHAGE_Entero_Mu: transposase; BWG_3691; phage(gi9633496) | 7e-88 | Click |
4 | complement(4135063..4135245) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; BWG_3692; phage(gi20065893) | 7e-24 | Click |
5 | complement(4135356..4135469) | PHAGE_Entero_lambda: hypothetical protein lambdap38; BWG_3693; phage(gi9626278) | 3e-13 | Click |
6 | complement(4135699..4136379) | PHAGE_Entero_lambda: exonuclease; BWG_3694; phage(gi9626280) | 2e-132 | Click |
7 | complement(4136376..4137161) | PHAGE_Entero_lambda: bet; BWG_3695; phage(gi9626281) | 3e-151 | Click |
8 | complement(4137167..4137463) | PHAGE_Entero_lambda: host-nuclease inhibitor protein Gam; BWG_3696; phage(gi9626282) | 9e-53 | Click |
9 | complement(4137538..4137681) | PHAGE_Entero_lambda: host-killing protein; BWG_3697; phage(gi9626283) | 2e-20 | Click |
10 | complement(4138158..4138919) | Aminoglucoside phosphotransferase derived originally from Tn903; BWG_3698 | N/A | Click |
11 | complement(4139137..4139505) | PHAGE_Entero_lambda: Putative single-stranded DNA binding protein; BWG_3699; phage(gi9626285) | 2e-68 | Click |
12 | complement(4139688..4139810) | PHAGE_Entero_lambda: restriction alleviation protein; BWG_3700; phage(gi9626286) | 3e-17 | Click |
13 | complement(4140638..4140961) | PHAGE_Entero_lambda: early gene regulator; BWG_3701; phage(gi9626289) | 1e-56 | Click |
14 | complement(4141876..4142715) | PHAGE_Entero_lambda: exclusion protein; BWG_3702; phage(gi9626291) | 9e-158 | Click |
15 | complement(4142828..4143541) | PHAGE_Entero_lambda: repressor; BWG_3703; phage(gi9626292) | 2e-134 | Click |
16 | 4143642..4143842 | PHAGE_Entero_lambda: antirepressor; BWG_3704; phage(gi9626293) | 7e-32 | Click |
17 | 4144117..4144254 | PHAGE_Entero_lambda: cII protein; BWG_3705; phage(gi9626294) | 1e-18 | Click |
18 | 4144287..4145186 | PHAGE_Entero_lambda: DNA replication protein; BWG_3706; phage(gi9626295) | 7e-177 | Click |
19 | 4145183..4145884 | PHAGE_Entero_lambda: DNA replication protein; BWG_3707; phage(gi9626296) | 2e-132 | Click |
20 | 4146245..4146685 | PHAGE_Entero_lambda: NinB; BWG_3708; phage(gi9626298) | 2e-82 | Click |
21 | 4146664..4147554 | PHAGE_Entero_lambda: NinC protein; BWG_3709; phage(gi9626299) | 6e-176 | Click |
22 | 4148447..4148644 | PHAGE_Entero_lambda: NinG protein; BWG_3710; phage(gi9626303) | 3e-32 | Click |
23 | 4148641..4148847 | PHAGE_Entero_mEp234: NinH protein; BWG_3711; phage(gi428782305) | 3e-34 | Click |
24 | 4148825..4149490 | PHAGE_Entero_lambda: NinI protein; BWG_3712; phage(gi9626305) | 3e-131 | Click |
25 | 4149487..4150110 | PHAGE_Entero_lambda: late gene regulator; BWG_3713; phage(gi9626306) | 1e-117 | Click |
26 | 4150787..4151110 | PHAGE_Entero_lambda: anti-holin; BWG_3714; phage(gi9626308) | 2e-55 | Click |
27 | 4151094..4151570 | PHAGE_Entero_lambda: endolysin; BWG_3715; phage(gi9626309) | 1e-89 | Click |
28 | 4151567..4152028 | PHAGE_Entero_lambda: cell lysis protein; putative; phage murein endopeptidase; BWG_3716(gi9626310) | 8e-82 | Click |
29 | 4151787..4151969 | PHAGE_Entero_lambda: Rz1 protein; putative; phage lipoprotein; BWG_3717(gi160338810) | 2e-31 | Click |
30 | complement(4152060..4152353) | PHAGE_Entero_lambda: Bor protein precursor; putative; phage lipoprotein; BWG_3718(gi19263395) | 2e-50 | Click |
31 | complement(4152643..4153053) | PHAGE_Entero_lambda: putative envelope protein; hypothetical; phage protein; BWG_3719(gi19263396) | 7e-75 | Click |
32 | 4153339..4153545 | PHAGE_Entero_lambda: hypothetical protein lambdap79; hypothetical; phage protein; BWG_3720(gi19263397) | 1e-32 | Click |
33 | 4154293..4154838 | PHAGE_Entero_lambda: DNA packaging protein; DNA; phage packaging protein; BWG_3721(gi9626244) | 4e-98 | Click |
34 | 4156735..4156941 | PHAGE_Entero_lambda: head-tail joining protein; BWG_3722; phage(gi9626246) | 4e-32 | Click |
35 | 4156938..4158539 | PHAGE_Entero_lambda: capsid component; BWG_3723; phage(gi9626247) | 0.0 | Click |
36 | 4158520..4159839 | PHAGE_Entero_lambda: capsid component; BWG_3724; phage(gi9626248) | 0.0 | Click |
37 | 4159849..4160181 | PHAGE_Entero_lambda: head-DNA stabilization protein; BWG_3725; phage(gi9626250) | 1e-58 | Click |
38 | 4160243..4161262 | PHAGE_Entero_lambda: capsid component; BWG_3726; phage(gi9626251) | 0.0 | Click |
39 | 4161304..4161702 | PHAGE_Entero_lambda: DNA packaging protein; BWG_3727; phage(gi9626252) | 4e-68 | Click |
40 | 4161714..4162067 | PHAGE_Entero_lambda: head-tail joining protein; BWG_3728; phage(gi9626253) | 4e-64 | Click |
41 | 4162079..4162657 | PHAGE_Entero_lambda: tail component; BWG_3729; phage(gi9626254) | 1e-101 | Click |
42 | 4162654..4163049 | PHAGE_Entero_lambda: tail component; BWG_3730; phage(gi9626255) | 2e-72 | Click |
43 | 4163057..4163797 | PHAGE_Entero_lambda: tail component; BWG_3731; phage(gi9626256) | 4e-139 | Click |
44 | 4163813..4164235 | PHAGE_Entero_lambda: tail component; BWG_3732; phage(gi9626257) | 5e-76 | Click |
45 | 4164217..4164651 | PHAGE_Entero_lambda: tail component; BWG_3733; phage(gi9626258) | 3e-81 | Click |
46 | 4164644..4167205 | PHAGE_Entero_lambda: tail component; BWG_3734; phage(gi9626259) | 0.0 | Click |
47 | 4167202..4167531 | PHAGE_Entero_lambda: tail component; BWG_3735; phage(gi9626260) | 4e-60 | Click |
48 | 4167531..4168229 | PHAGE_Entero_lambda: tail component; BWG_3736; phage(gi9626261) | 4e-136 | Click |
49 | 4168235..4168978 | PHAGE_Entero_mEp460: tail fiber component; BWG_3737; phage(gi428782332) | 3e-147 | Click |
50 | 4169279..4169548 | PHAGE_Entero_lambda: tail component; BWG_3738; phage(gi9626263) | 2e-44 | Click |
51 | 4169609..4173007 | PHAGE_Entero_lambda: tail:host specificity protein; BWG_3739; phage(gi9626264) | 0.0 | Click |
52 | 4173069..4173689 | PHAGE_Entero_lambda: outer host membrane; BWG_3740; phage(gi9626265) | 2e-115 | Click |
53 | 4173754..4174173 | PHAGE_Entero_lambda: Tail fiber protein; BWG_3741; phage(gi9626266) | 3e-62 | Click |