Definition Vibrio cholerae MJ-1236 chromosome 1, complete genome.
Accession NC_012668
Length 3,149,584
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 40 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1260229..1260252  attL    GAAAAGGGGCTTTTCTTTTTTCTG  N/A  Click
2 complement(1260462..1261499)  PHAGE_Vibrio_K139: Int; VCD_002150; phage(gi17975106)  0.0  Click
3 complement(1261912..1262817)  PHAGE_Vibrio_K139: hypothetical protein K139p03; VCD_002151; phage(gi17975108)  1e-173  Click
4 complement(1262843..1263100)  PHAGE_Vibrio_K139: CI; VCD_002152; phage(gi17975109)  6e-42  Click
5 1263567..1263848  PHAGE_Vibrio_K139: Cox; VCD_002153; phage(gi17975110)  3e-34  Click
6 1263959..1264498  PHAGE_Vibrio_K139: CII; VCD_002154; phage(gi17975111)  1e-95  Click
7 1264511..1264945  PHAGE_Vibrio_K139: hypothetical protein K139p07; VCD_002155; phage(gi17975112)  2e-78  Click
8 1265021..1265560  PHAGE_Vibrio_K139: hypothetical protein K139p08; VCD_002156; phage(gi17975113)  8e-94  Click
9 1265557..1265967  PHAGE_Vibrio_K139: hypothetical protein K139p09; VCD_002157; phage(gi17975114)  4e-34  Click
10 1266181..1266444  PHAGE_Vibrio_K139: hypothetical protein K139p11; VCD_002158; phage(gi17975116)  1e-38  Click
11 1266441..1267058  PHAGE_Vibrio_K139: putative DNA methyltransferase; VCD_002159; phage(gi17975117)  9e-119  Click
12 1267055..1267165  hypothetical protein; VCD_002160  N/A  Click
13 1267108..1267746  PHAGE_Vibrio_K139: hypothetical protein K139p13; VCD_002161; phage(gi17975118)  2e-97  Click
14 1267743..1270328  PHAGE_Vibrio_K139: rep; VCD_002162; phage(gi17975119)  0.0  Click
15 complement(1270948..1271286)  PHAGE_Vibrio_K139: hypothetical protein K139p16; VCD_002163; phage(gi17975121)  1e-56  Click
16 complement(1272092..1272307)  PHAGE_Vibrio_K139: hypothetical protein K139p19; VCD_002164; phage(gi17975124)  5e-36  Click
17 complement(1272291..1273352)  PHAGE_Vibrio_K139: putative capsid portal protein; VCD_002165; phage(gi17975125)  0.0  Click
18 complement(1273334..1275151)  PHAGE_Vibrio_K139: putative terminase, ATPase subunit; VCD_002166; phage(gi17975126)  0.0  Click
19 1275415..1276224  PHAGE_Vibrio_K139: putative capsid scaffolding protein; VCD_002167; phage(gi17975127)  2e-158  Click
20 1276261..1277271  PHAGE_Vibrio_K139: putative major capsid protein; VCD_002168; phage(gi17975128)  3e-173  Click
21 1277287..1278003  PHAGE_Vibrio_K139: putative terminase, endonuclease subunit; VCD_002169; phage(gi17975129)  2e-135  Click
22 1278110..1278571  PHAGE_Vibrio_K139: putative head completion protein; VCD_002170; phage(gi17975130)  1e-81  Click
23 1278568..1279056  PHAGE_Vibrio_K139: hypothetical protein K139p26; VCD_002171; phage(gi17975131)  3e-91  Click
24 1279031..1279702  PHAGE_Vibrio_K139: putative tail completion protein; VCD_002172; phage(gi17975132)  4e-75  Click
25 1279704..1280813  PHAGE_Vibrio_K139: putative tail sheath protein; VCD_002173; phage(gi17975134)  0.0  Click
26 1280813..1281271  PHAGE_Vibrio_K139: putative tail tube protein; VCD_002174; phage(gi17975135)  1e-83  Click
27 1281450..1281719  PHAGE_Vibrio_K139: hypothetical protein K139p32; VCD_002175; phage(gi17975137)  2e-39  Click
28 1281706..1282293  PHAGE_Vibrio_K139: putative endolysin; VCD_002176; phage(gi17975138)  2e-112  Click
29 1282259..1282609  PHAGE_Vibrio_K139: hypothetical protein K139p34; VCD_002177; phage(gi17975139)  2e-60  Click
30 1282626..1282820  PHAGE_Vibrio_K139: hypothetical protein K139p35; VCD_002178; phage(gi17975140)  2e-27  Click
31 1282817..1283098  PHAGE_Vibrio_K139: hypothetical protein K139p35; VCD_002179; phage(gi17975140)  7e-48  Click
32 1283149..1283283  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_37; VCD_002180; phage(gi148727165)  3e-06  Click
33 1283295..1285112  PHAGE_Vibrio_K139: putative tail length determinator; VCD_002181; phage(gi17975141)  0.0  Click
34 1285093..1285434  PHAGE_Vibrio_K139: hypothetical protein K139p37; VCD_002182; phage(gi17975142)  2e-57  Click
35 1285431..1286630  PHAGE_Vibrio_K139: hypothetical protein K139p38; VCD_002183; phage(gi17975143)  0.0  Click
36 1286627..1287286  PHAGE_Vibrio_K139: hypothetical protein K139p39; VCD_002184; phage(gi17975144)  4e-128  Click
37 1287283..1289145  PHAGE_Vibrio_K139: putative tail fiber protein; VCD_002185; phage(gi17975145)  0.0  Click
38 1289145..1289669  PHAGE_Vibrio_K139: putative tail fiber assembly protein; VCD_002186; phage(gi17975146)  7e-99  Click
39 1289672..1290565  PHAGE_Vibrio_K139: hypothetical protein K139p42; VCD_002187; phage(gi17975147)  8e-166  Click
40 1290553..1291026  PHAGE_Vibrio_K139: hypothetical protein K139p43; VCD_002188; phage(gi17975148)  5e-83  Click
41 1291023..1292654  PHAGE_Vibrio_K139: hypothetical protein K139p44; VCD_002189; phage(gi17975149)  0.0  Click
42 1293338..1293361  attR    GAAAAGGGGCTTTTCTTTTTTCTG  N/A  Click
Region 2, total : 15 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1701363..1703120  PHAGE_Pseudo_B3: putative transposase A subunit; VCD_002572; phage(gi56692580)  2e-93  Click
2 1703161..1704201  PHAGE_Pseudo_B3: putative transposase B subunit; VCD_002573; phage(gi56692579)  1e-45  Click
3 1704204..1704665  hypothetical protein; VCD_002574  N/A  Click
4 1704807..1705073  phage protein; VCD_002575  N/A  Click
5 1705475..1705849  PHAGE_Entero_Mu: Mor; VCD_002576; phage(gi9633507)  3e-07  Click
6 1706175..1706753  hypothetical protein; VCD_002577  N/A  Click
7 1706808..1707185  hypothetical protein; VCD_002578  N/A  Click
8 1707234..1707593  PHAGE_Entero_Mu: hypothetical protein Mup41; VCD_002579; phage(gi9633532)  2e-09  Click
9 1707809..1708768  PHAGE_Mannhe_phiMHaA1: tail protein T; VCD_002580; phage(gi109289951)  4e-25  Click
10 1708775..1709119  PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; VCD_002581; phage(gi24373865)  7e-08  Click
11 1709116..1709988  PHAGE_Entero_Sf6: putative transposase OrfB; VCD_002582; phage(gi41057343)  3e-115  Click
12 1709985..1710680  hypothetical protein; VCD_002583  N/A  Click
13 complement(1710776..1710913)  hypothetical protein; VCD_002584  N/A  Click
14 complement(1710910..1711386)  DNA repair protein RadC; VCD_002585  N/A  Click
15 1711500..1711706  PHAGE_Entero_P4: transcriptional regulator; VCD_002586; phage(gi9627517)  3e-09  Click
Region 3, total : 16 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2940144..2940156  attL    AGAAAATAATGAT  N/A  Click
2 complement(2951691..2953229)  PHAGE_Acanth_moumouvirus: asparaginyl t-RNA synthetase; VCD_003655; phage(gi441432571)  1e-09  Click
3 complement(2953254..2954153)  PHAGE_Pseudo_73: hypothetical protein ORF037; VCD_003656; phage(gi148912865)  8e-09  Click
4 complement(2954522..2955799)  PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; VCD_003657; phage(gi163932195)  9e-07  Click
5 2956144..2956866  PHAGE_Parame_NY2A: hypothetical protein NY2A_B016L; VCD_003658; phage(gi157952320)  3e-08  Click
6 2956954..2958225  PHAGE_Cafete_BV_PW1: putative superfamily II helicase/eIF-4AIII; VCD_003659; phage(gi310831360)  7e-44  Click
7 complement(2958347..2959936)  PHAGE_Lausan: putative translation elongation factor 1-alpha; VCD_003660; phage(gi327409596)  4e-05  Click
8 complement(2960193..2960840)  PHAGE_Entero_IME10: repressor protein; VCD_003661; phage(gi422934295)  8e-36  Click
9 2960958..2961209  PHAGE_Aggreg_S1249: phage protein; VCD_003662; phage(gi273809591)  8e-09  Click
10 2961265..2962134  hypothetical protein; VCD_003663  N/A  Click
11 2962055..2962783  PHAGE_Vibrio_VvAW1: hypothetical protein; VCD_003664; phage(gi460042923)  2e-39  Click
12 2962770..2963318  soluble lytic murein transglycosylase and related regulatory proteins (some contain LysM/invasin domains); VCD_003665  N/A  Click
13 2963315..2963614  hypothetical protein; VCD_003666  N/A  Click
14 complement(2964666..2968235)  IncF plasmid conjugative transfer protein TraG; VCD_003667  N/A  Click
15 complement(2968239..2969627)  IncF plasmid conjugative transfer pilus assembly protein TraH; VCD_003668  N/A  Click
16 complement(2969630..2970574)  IncF plasmid conjugative transfer pilus assembly protein TraF; VCD_003669  N/A  Click
17 2970514..2970526  attR    AGAAAATAATGAT  N/A  Click
18 complement(2970831..2971790)  PHAGE_Strept_MM1: integrase; VCD_003670; phage(gi15088744)  1e-08  Click