| Definition | Pseudomonas fluorescens SBW25 chromosome, complete genome. |
|---|---|
| Accession | NC_012660 |
| Length | 6,722,539 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 29 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1295604..1297655) | PHAGE_Megavi_lba: methionyl-tRNA synthetase; PFLU1161; phage(gi448825763) | 5e-50 | Click |
| 2 | 1297828..1298922 | PHAGE_Burkho_2: gp12, partition protein; PFLU1162; phage(gi134288738) | 8e-06 | Click |
| 3 | complement(1299417..1299740) | ferredoxin I; PFLU1163 | N/A | Click |
| 4 | complement(1299883..1302474) | PHAGE_Cafete_BV_PW1: putative DNA mismatch repair protein MutS; PFLU1164; phage(gi310831476) | 2e-32 | Click |
| 5 | complement(1302644..1303015) | hypothetical protein; PFLU1165 | N/A | Click |
| 6 | complement(1303008..1303502) | PHAGE_Aggreg_S1249: phage-associated protein; PFLU1166; phage(gi273809596) | 4e-29 | Click |
| 7 | 1303763..1304497 | PHAGE_Pseudo_F116: transcriptional regulator; PFLU1167; phage(gi56692918) | 2e-38 | Click |
| 8 | 1305089..1305433 | hypothetical protein; PFLU1169 | N/A | Click |
| 9 | 1305455..1305970 | PHAGE_Halomo_1: hypothetical protein HAPgp08; PFLU1170; phage(gi167832353) | 4e-17 | Click |
| 10 | 1306031..1306585 | PHAGE_Halomo_1: putative baseplate assembly protein V; PFLU1171; phage(gi167832354) | 9e-29 | Click |
| 11 | 1306595..1306927 | PHAGE_Halomo_1: putative baseplate assembly protein; PFLU1172; phage(gi167832355) | 4e-23 | Click |
| 12 | 1306930..1307919 | PHAGE_Halomo_1: putative baseplate assembly protein J; PFLU1173; phage(gi167832356) | 4e-84 | Click |
| 13 | 1307916..1308545 | PHAGE_Halomo_1: putative tail protein; PFLU1174; phage(gi167832357) | 9e-23 | Click |
| 14 | 1308546..1310522 | PROPHAGE_Salmon_Ty2: variable tail fiber protein; PFLU1175; phage(gi29143754) | 1e-29 | Click |
| 15 | 1310519..1310917 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp23; PFLU1176; phage(gi17313240) | 1e-14 | Click |
| 16 | 1310982..1311194 | hypothetical protein; PFLU1177 | N/A | Click |
| 17 | 1311197..1312363 | PHAGE_Halomo_1: putative tail sheath protein; PFLU1178; phage(gi167832365) | 3e-127 | Click |
| 18 | 1312363..1312869 | PHAGE_Halomo_1: putative tail tube protein; PFLU1179; phage(gi167832366) | 3e-24 | Click |
| 19 | 1312921..1313493 | PHAGE_Halomo_1: hypothetical protein HAPgp22; PFLU1180; phage(gi167832367) | 2e-28 | Click |
| 20 | 1313490..1313615 | putative phage hypothetical protein; PFLU1181 | N/A | Click |
| 21 | 1313622..1314773 | PHAGE_Vibrio_VP882: phage-related tail protein; PFLU1182; phage(gi126010872) | 6e-18 | Click |
| 22 | 1314770..1315156 | PHAGE_Halomo_1: putative tail tape measure; PFLU1183; phage(gi167832368) | 7e-37 | Click |
| 23 | 1315149..1315361 | PHAGE_Vibrio_VP882: phage tail X; PFLU1184; phage(gi126010875) | 5e-12 | Click |
| 24 | 1315371..1316381 | PHAGE_Halomo_1: putative tail protein; PFLU1185; phage(gi167832370) | 1e-94 | Click |
| 25 | 1316400..1316960 | PHAGE_Salmon_PVP_SE1: lysozyme; PFLU1186; phage(gi363539668) | 1e-45 | Click |
| 26 | 1316948..1317448 | PHAGE_Burkho_Bcep22: Bcep22gp80; PFLU1187; phage(gi38640385) | 3e-11 | Click |
| 27 | 1317530..1318030 | hypothetical protein; PFLU1188 | N/A | Click |
| 28 | 1318115..1319173 | PROPHAGE_Escher_MG1655: DNA strand exchange and recombination protein with protease and nuclease activity; PFLU1189; phage(gi16130606) | 4e-138 | Click |
| 29 | 1319182..1319649 | recombination regulator RecX; PFLU1190 | N/A | Click |
| 30 | complement(1319893..1321005) | PHAGE_Synech_S_CBS2: DprA superfamily protein; PFLU1191; phage(gi331027974) | 2e-17 | Click |
Region 2, total : 11 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1733709..1733730 | attL CGGGAGCAAGCTCCCTCGCCAC | N/A | Click |
| 2 | 1734379..1735560 | PHAGE_Feldma_virus: putative sensor histidine kinase; PFLU1583; phage(gi197322366) | 1e-06 | Click |
| 3 | 1735560..1736042 | hypothetical protein; PFLU1584 | N/A | Click |
| 4 | complement(1736243..1737169) | PHAGE_Prochl_Syn1: transaldolase-like protein; PFLU1585; phage(gi326784174) | 2e-15 | Click |
| 5 | complement(1737423..1738433) | tRNA-dihydrouridine synthase A; PFLU1586 | N/A | Click |
| 6 | 1738537..1739688 | PHAGE_Burkho_AH2: integrase; PFLU1587; phage(gi399529076) | 2e-98 | Click |
| 7 | complement(1739762..1740658) | PHAGE_Burkho_KS14: gp33; PFLU1588; phage(gi327198302) | 3e-100 | Click |
| 8 | complement(1740704..1741582) | PHAGE_Burkho_KS14: gp34; PFLU1589; phage(gi327198303) | 4e-65 | Click |
| 9 | 1741734..1743491 | PHAGE_Burkho_KS14: gp35; PFLU1590; phage(gi327198304) | 0.0 | Click |
| 10 | 1743491..1744543 | PHAGE_Pseudo_phiCTX: predicted capsid packaging protein; PFLU1591; phage(gi17313219) | 4e-146 | Click |
| 11 | complement(1744680..1745666) | hypothetical protein; PFLU1591A | N/A | Click |
| 12 | complement(1745663..1746196) | hypothetical protein; PFLU1591B | N/A | Click |
| 13 | complement(1746412..1747092) | PHAGE_Pseudo_F116: hypothetical protein F116p67; PFLU1592; phage(gi56692976) | 4e-93 | Click |
| 14 | 1754047..1754068 | attR CGGGAGCAAGCTCCCTCGCCAC | N/A | Click |
Region 3, total : 21 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3102873..3102885 | attL GAGCTGACTTATC | N/A | Click |
| 2 | complement(3104806..3105987) | PHAGE_Lactob_KC5a: putative minor tail protein; PFLU2815; phage(gi90592623) | 3e-06 | Click |
| 3 | complement(3106241..3107803) | PHAGE_Parame_AR158: hypothetical protein AR158_C788L; PFLU2816; phage(gi157953978) | 4e-29 | Click |
| 4 | complement(3107848..3109080) | PHAGE_Bordet_1: integrase; PFLU2817; phage(gi45569541) | 5e-50 | Click |
| 5 | complement(3109229..3109450) | hypothetical protein; PFLU2818 | N/A | Click |
| 6 | complement(3109487..3109726) | hypothetical protein; PFLU2819 | N/A | Click |
| 7 | complement(3109938..3110396) | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp33; PFLU2820; phage(gi209552452) | 4e-61 | Click |
| 8 | complement(3110389..3110712) | hypothetical protein; PFLU2821 | N/A | Click |
| 9 | complement(3110762..3111319) | PHAGE_Myxoco_Mx8: hypothetical protein Mx8p15; PFLU2822; phage(gi15320585) | 6e-38 | Click |
| 10 | complement(3111316..3111927) | PHAGE_Pseudo_F116: hypothetical protein F116p07; PFLU2823; phage(gi56692934) | 1e-37 | Click |
| 11 | complement(3111921..3112352) | hypothetical protein; PFLU2824 | N/A | Click |
| 12 | 3112580..3113188 | hypothetical protein; PFLU2824A | N/A | Click |
| 13 | complement(3113203..3113373) | PHAGE_Pseudo_phi297: hypothetical protein; PFLU2826; phage(gi374531251) | 1e-05 | Click |
| 14 | complement(3113370..3114011) | PHAGE_Salmon_SSU5: hypothetical protein; PFLU2827; phage(gi410491510) | 2e-17 | Click |
| 15 | 3114063..3114494 | hypothetical protein; PFLU2828 | N/A | Click |
| 16 | complement(3114565..3116478) | PHAGE_Pseudo_F116: DNA cytosine methyltransferase; PFLU2829; phage(gi56692910) | 3e-97 | Click |
| 17 | 3116527..3117210 | hypothetical protein; PFLU2830 | N/A | Click |
| 18 | 3117442..3117762 | PHAGE_Clostr_phiC2: hypothetical protein phiC2p84; PFLU2832; phage(gi134287416) | 4e-11 | Click |
| 19 | complement(3117746..3118090) | hypothetical protein; PFLU2833 | N/A | Click |
| 20 | complement(3118160..3118630) | hypothetical protein; PFLU2834 | N/A | Click |
| 21 | complement(3118627..3118869) | hypothetical protein; PFLU2835 | N/A | Click |
| 22 | complement(3118866..3120494) | PHAGE_Pseudo_F116: hypothetical protein F116p18; PFLU2836; phage(gi56692937) | 1e-06 | Click |
| 23 | 3134545..3134557 | attR GAGCTGACTTATC | N/A | Click |
Region 4, total : 59 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3125592..3126737) | PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; PFLU2845; phage(gi209901309) | 2e-08 | Click |
| 2 | complement(3126846..3127103) | hypothetical protein; PFLU2846 | N/A | Click |
| 3 | 3127198..3127386 | hypothetical protein; PFLU2847 | N/A | Click |
| 4 | complement(3127470..3127697) | hypothetical protein; PFLU2848 | N/A | Click |
| 5 | complement(3127716..3128423) | PHAGE_Entero_mEp213: prophage repressor; putative; phage phage repressor; PFLU2849(gi428782641) | 2e-55 | Click |
| 6 | 3128467..3128694 | PHAGE_Entero_mEp213: prophage anti-repressor; PFLU2850; phage(gi428782642) | 2e-14 | Click |
| 7 | 3128749..3129366 | hypothetical protein; PFLU2851 | N/A | Click |
| 8 | 3129420..3130520 | PHAGE_Pseudo_F116: hypothetical protein F116p32; PFLU2852; phage(gi56692948) | 1e-36 | Click |
| 9 | 3130498..3131304 | PHAGE_Pseudo_F116: hypothetical protein F116p33; PFLU2853; phage(gi56692949) | 6e-44 | Click |
| 10 | 3131301..3131771 | hypothetical protein; PFLU2854 | N/A | Click |
| 11 | 3131768..3132346 | PHAGE_Pseudo_PAJU2: putative NinG; PFLU2855; phage(gi209552490) | 6e-69 | Click |
| 12 | 3132343..3132888 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp058; PFLU2856; phage(gi148912823) | 4e-34 | Click |
| 13 | 3132885..3133739 | hypothetical protein; PFLU2857 | N/A | Click |
| 14 | 3133861..3134046 | PHAGE_Pseudo_B3: Com translational regulator; PFLU2857A; phage(gi56692616) | 2e-09 | Click |
| 15 | 3134055..3134390 | hypothetical protein; PFLU2858 | N/A | Click |
| 16 | 3134600..3134971 | PHAGE_Erwini_PEp14: holin; PFLU2860; phage(gi374531877) | 6e-09 | Click |
| 17 | 3134971..3135309 | putative lipoprotein; PFLU2861 | N/A | Click |
| 18 | 3135363..3135578 | hypothetical protein; PFLU2862 | N/A | Click |
| 19 | 3135575..3135766 | hypothetical protein; PFLU2863 | N/A | Click |
| 20 | 3135763..3136017 | hypothetical protein; PFLU2864 | N/A | Click |
| 21 | complement(3136068..3136289) | hypothetical protein; PFLU2865 | N/A | Click |
| 22 | 3136379..3136978 | PHAGE_Escher_HK639: terminase small subunit; PFLU2866; phage(gi356870601) | 3e-27 | Click |
| 23 | 3136980..3138470 | PHAGE_Cronob_phiES15: terminase large subunit; PFLU2867; phage(gi401817592) | 0.0 | Click |
| 24 | 3138470..3139930 | PHAGE_Salmon_vB_SenS_Ent1: putative portal protein; PFLU2868; phage(gi423261849) | 2e-21 | Click |
| 25 | 3139914..3140960 | PHAGE_Salmon_vB_SenS_Ent1: putative head morphogenesis protein, SPP1 gp7 family; PFLU2869; phage(gi423261851) | 2e-57 | Click |
| 26 | 3140969..3141457 | PHAGE_Escher_HK639: hypothetical protein; PFLU2870; phage(gi356870608) | 3e-09 | Click |
| 27 | 3141528..3141746 | hypothetical protein; PFLU2871 | N/A | Click |
| 28 | 3141845..3142612 | PHAGE_Xantho_Xp15: putative phage structural protein; PFLU2872; phage(gi66392059) | 1e-18 | Click |
| 29 | 3142616..3143593 | PHAGE_Salmon_vB_SenS_Ent1: putative major coat protein; PFLU2873; phage(gi423261856) | 4e-61 | Click |
| 30 | 3143649..3143954 | hypothetical protein; PFLU2874 | N/A | Click |
| 31 | 3143965..3144342 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; PFLU2875; phage(gi423262009) | 3e-07 | Click |
| 32 | 3144345..3144737 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; PFLU2876; phage(gi423262010) | 3e-14 | Click |
| 33 | 3144739..3145395 | PHAGE_Escher_HK639: hypothetical protein; PFLU2877; phage(gi356870610) | 1e-26 | Click |
| 34 | 3145392..3145808 | PHAGE_Escher_HK639: hypothetical protein; PFLU2878; phage(gi356870611) | 3e-11 | Click |
| 35 | 3145882..3146538 | PHAGE_Escher_HK639: major tail protein; PFLU2879; phage(gi356870612) | 3e-36 | Click |
| 36 | 3146542..3146922 | PHAGE_Escher_HK639: hypothetical protein; PFLU2880; phage(gi356870614) | 3e-06 | Click |
| 37 | 3146940..3147242 | PHAGE_Entero_HK578: hypothetical protein; PFLU2881; phage(gi428782873) | 1e-09 | Click |
| 38 | 3147270..3150323 | PHAGE_Pseudo_MP29: putative tail component protein; PFLU2882; phage(gi215480016) | 5e-156 | Click |
| 39 | 3150323..3150661 | PHAGE_Entero_mEp234: minor tail protein M; PFLU2883; phage(gi428782269) | 4e-30 | Click |
| 40 | 3150672..3151424 | PHAGE_Entero_mEp237: minor tail protein L; PFLU2884; phage(gi435439282) | 2e-79 | Click |
| 41 | 3151427..3152191 | PHAGE_Entero_HK633: minor tail protein; PFLU2885; phage(gi428782537) | 3e-67 | Click |
| 42 | 3152217..3152462 | hypothetical protein; PFLU2886 | N/A | Click |
| 43 | 3152496..3152651 | hypothetical protein; PFLU2887 | N/A | Click |
| 44 | complement(3152747..3153853) | hypothetical protein; PFLU2888 | N/A | Click |
| 45 | complement(3154009..3154161) | putative phage-like protein; PFLU2888A | N/A | Click |
| 46 | 3154302..3154724 | PHAGE_Escher_HK639: hypothetical protein; PFLU2890; phage(gi356870616) | 8e-14 | Click |
| 47 | 3154777..3155373 | PHAGE_Escher_HK639: tail assembly protein; PFLU2891; phage(gi356870622) | 1e-47 | Click |
| 48 | 3155433..3159002 | PHAGE_Entero_HK633: central tail fiber; PFLU2892; phage(gi428782540) | 0.0 | Click |
| 49 | 3158999..3159343 | hypothetical protein; PFLU2892A | N/A | Click |
| 50 | 3159344..3159973 | PHAGE_Pseudo_LIT1: hypothetical protein PP-LIT1_gp54; PFLU2892B; phage(gi282598901) | 9e-10 | Click |
| 51 | 3159983..3161203 | PHAGE_Yersin_PY54: tail fiber protein; PFLU2894; phage(gi33770533) | 5e-13 | Click |
| 52 | 3161200..3161574 | PHAGE_Pseudo_2: hypothetical protein SBWP25_0037; PFLU2895; phage(gi281306696) | 4e-08 | Click |
| 53 | 3161617..3162057 | PHAGE_Pseudo_PAJU2: putative endolysin; PFLU2896; phage(gi209552493) | 1e-38 | Click |
| 54 | 3162054..3162557 | PHAGE_Burkho_DC1: Rz; PFLU2897; phage(gi401723083) | 2e-11 | Click |
| 55 | complement(3162711..3163469) | PHAGE_Pseudo_F116: hypothetical protein F116p67; PFLU2898; phage(gi56692976) | 8e-96 | Click |
| 56 | complement(3163676..3164035) | hypothetical protein; PFLU2900 | N/A | Click |
| 57 | complement(3164129..3164338) | hypothetical protein; PFLU2902 | N/A | Click |
| 58 | complement(3164520..3164771) | hypothetical protein; PFLU2903 | N/A | Click |
| 59 | complement(3165104..3165817) | PHAGE_Parame_AR158: hypothetical protein AR158_C015L; PFLU2904; phage(gi157953206) | 7e-12 | Click |
Region 5, total : 7 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3314102..3314116 | attL CCATCAGCAACGCCA | N/A | Click |
| 2 | complement(3315964..3317955) | PHAGE_Prochl_P_SSM7: PRGA-formyltransferase; PFLU3041; phage(gi326784531) | 2e-10 | Click |
| 3 | complement(3317958..3318983) | PHAGE_Salmon_ST160: GtrB; PFLU3042; phage(gi318065903) | 8e-40 | Click |
| 4 | 3319397..3320221 | hypothetical protein; PFLU3043 | N/A | Click |
| 5 | 3320330..3321244 | PHAGE_Achole_L2: integrase; PFLU3044; phage(gi9626516) | 8e-06 | Click |
| 6 | complement(3321668..3322525) | PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PFLU3045; phage(gi116326757) | 2e-67 | Click |
| 7 | complement(3322717..3323925) | PHAGE_Lactob_KC5a: putative minor tail protein; PFLU3046; phage(gi90592623) | 3e-05 | Click |
| 8 | 3324083..3325696 | PHAGE_Salmon_SSU5: putative phage tail protein; PFLU3047; phage(gi410491430) | 9e-07 | Click |
| 9 | 3324618..3324632 | attR CCATCAGCAACGCCA | N/A | Click |