| Definition | Clostridium cellulolyticum H10, complete genome. |
|---|---|
| Accession | NC_011898 |
| Length | 4,068,724 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 30 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2163638..2163650 | attL TTATTATAATATT | N/A | Click |
| 2 | complement(2176828..2177292) | PROPHAGE_Salmon_Ty2: transposase; Ccel_1820; phage(gi29143766) | 4e-44 | Click |
| 3 | 2177909..2178955 | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_1821; phage(gi160688404) | 1e-07 | Click |
| 4 | 2179043..2179108 | attL GAAGTGCCGAATAAACAAAACTTAATATTTCCCAGAGGAGTGTCAACCCAAGTACCGTTCAGGACA | N/A | Click |
| 5 | complement(2179171..2179539) | hypothetical protein; Ccel_1822 | N/A | Click |
| 6 | complement(2179709..2180521) | PROPHAGE_Escher_CFT073: transposase insF; Ccel_1823; phage(gi26249410) | 1e-74 | Click |
| 7 | complement(2180569..2180853) | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; Ccel_1824; phage(gi24373865) | 6e-12 | Click |
| 8 | complement(2180919..2181212) | hypothetical protein; Ccel_1825 | N/A | Click |
| 9 | complement(2181290..2182054) | DNA binding domain protein, excisionase family; Ccel_1826 | N/A | Click |
| 10 | complement(2182144..2182887) | PHAGE_Vibrio_kappa: putative NAD-dependent DNA ligase; Ccel_1827; phage(gi165970237) | 2e-16 | Click |
| 11 | 2182980..2183264 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; Ccel_1828; phage(gi24373865) | 2e-11 | Click |
| 12 | 2183312..2184124 | PROPHAGE_Escher_CFT073: transposase insF; Ccel_1829; phage(gi26249410) | 9e-75 | Click |
| 13 | complement(2184187..2184351) | hypothetical protein; Ccel_1830 | N/A | Click |
| 14 | 2185189..2185785 | RelA/SpoT domain protein; Ccel_1831 | N/A | Click |
| 15 | 2186079..2187125 | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_1832; phage(gi160688404) | 1e-07 | Click |
| 16 | 2187213..2187279 | attL GAAGTGCCGAATAAACAAAACTTAATATTTCCCAGAGGAGTGTCAACCCAAGTACCGTTCAGGACAG | N/A | Click |
| 17 | 2188302..2188640 | hypothetical protein; Ccel_1834 | N/A | Click |
| 18 | 2188634..2188990 | PROPHAGE_Pseudo_KT2440: ISPpu15, transposase Orf1; Ccel_1835; phage(gi26990788) | 5e-17 | Click |
| 19 | 2189066..2190655 | PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; Ccel_1836; phage(gi26989833) | 2e-83 | Click |
| 20 | complement(2191601..2192692) | 20S proteasome A and subunit betas; Ccel_1837 | N/A | Click |
| 21 | complement(2193208..2194254) | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_1838; phage(gi160688404) | 1e-07 | Click |
| 22 | complement(2194342..2194809) | PHAGE_Bacill_phBC6A52: prohead protease; Ccel_1839; phage(gi31415851) | 9e-12 | Click |
| 23 | complement(2194847..2195545) | hypothetical protein; Ccel_1840 | N/A | Click |
| 24 | complement(2195627..2196319) | RNA polymerase, sigma-24 subunit, ECF subfamily; Ccel_1841 | N/A | Click |
| 25 | complement(2196385..2196762) | hypothetical protein; Ccel_1842 | N/A | Click |
| 26 | complement(2196792..2197046) | hypothetical protein; Ccel_1843 | N/A | Click |
| 27 | complement(2197043..2197618) | hypothetical protein; Ccel_1844 | N/A | Click |
| 28 | complement(2197596..2198342) | PHAGE_Lactob_c5: putative DNA replication protein; Ccel_1845; phage(gi418488187) | 4e-10 | Click |
| 29 | complement(2198355..2198597) | hypothetical protein; Ccel_1846 | N/A | Click |
| 30 | complement(2198601..2198825) | hypothetical protein; Ccel_1847 | N/A | Click |
| 31 | 2198987..2199832 | hypothetical protein; Ccel_1848 | N/A | Click |
| 32 | 2199898..2201139 | PROPHAGE_Mesorh_MAFF303099: bacteriophage integrase; Ccel_1849; phage(gi13470699) | 6e-37 | Click |
| 33 | complement(2201311..2201386) | tRNA | N/A | Click |
| 34 | 2201539..2202585 | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_1850; phage(gi160688404) | 1e-07 | Click |
| 35 | 2202673..2202738 | attR GAAGTGCCGAATAAACAAAACTTAATATTTCCCAGAGGAGTGTCAACCCAAGTACCGTTCAGGACA | N/A | Click |
| 36 | 2202673..2202739 | attR GAAGTGCCGAATAAACAAAACTTAATATTTCCCAGAGGAGTGTCAACCCAAGTACCGTTCAGGACAG | N/A | Click |
| 37 | 2215817..2215829 | attR TTATTATAATATT | N/A | Click |
Region 2, total : 11 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2364215..2364226 | attL TGCCAGTTTCAC | N/A | Click |
| 2 | complement(2364565..2365497) | PHAGE_Lactob_1: Mg2+/Co2+ transport protein CorA; Ccel_2001; phage(gi226377699) | 1e-11 | Click |
| 3 | complement(2365966..2366433) | 6,7-dimethyl-8-ribityllumazine synthase; Ccel_2003 | N/A | Click |
| 4 | complement(2366423..2367685) | PHAGE_Synech_S_SKS1: 3,4-dihydroxy-2-butanone 4-phosphate synthase; Ccel_2004; phage(gi472340887) | 8e-35 | Click |
| 5 | complement(2367713..2368369) | riboflavin synthase subunit alpha; Ccel_2005 | N/A | Click |
| 6 | complement(2368390..2369493) | PHAGE_Thermu_phiYS40: deoxycytidylate deaminase; Ccel_2006; phage(gi118197658) | 8e-06 | Click |
| 7 | 2369950..2371191 | PHAGE_Cronob_ENT39118: DNA polymerase; Ccel_2007; phage(gi431811050) | 5e-13 | Click |
| 8 | 2371202..2371435 | hypothetical protein; Ccel_2008 | N/A | Click |
| 9 | 2371904..2372188 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; Ccel_2010; phage(gi24373865) | 2e-11 | Click |
| 10 | 2372236..2373048 | PROPHAGE_Escher_CFT073: transposase insF; Ccel_2011; phage(gi26249410) | 9e-75 | Click |
| 11 | complement(2373103..2374347) | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; Ccel_2012; phage(gi414087138) | 5e-07 | Click |
| 12 | 2374548..2375168 | PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p118; Ccel_2013; phage(gi9630243) | 5e-21 | Click |
| 13 | 2379053..2379064 | attR TGCCAGTTTCAC | N/A | Click |
Region 3, total : 7 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2549674..2550823) | PROPHAGE_Escher_MG1655: IS150 transposase B; Ccel_2178; phage(gi16131429) | 5e-30 | Click |
| 2 | 2551002..2552249 | PHAGE_Escher_bV_EcoS_AKFV33: pore-forming tail tip protein; Ccel_2179; phage(gi388570502) | 5e-08 | Click |
| 3 | complement(2552340..2553599) | phosphoribosylamine--glycine ligase; Ccel_2180 | N/A | Click |
| 4 | complement(2553672..2555216) | PHAGE_Prochl_P_SSM2: 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase; Ccel_2181; phage(gi61806062) | 6e-75 | Click |
| 5 | complement(2555247..2555870) | PHAGE_Burkho_phiE255: gp30, formyl transferase, putative; Ccel_2182; phage(gi134288807) | 1e-07 | Click |
| 6 | complement(2555864..2556886) | PHAGE_Prochl_P_SSM2: phosphoribosylaminoimidazole synthetase; Ccel_2183; phage(gi61806048) | 1e-69 | Click |
| 7 | complement(2556922..2558385) | PHAGE_Parame_1: Glutamine:fructose-6-phosphate amidotransferase; Ccel_2184; phage(gi340025710) | 6e-18 | Click |
Region 4, total : 28 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3370767..3372338) | PHAGE_Bacill_Gamma: site-specific recombinase; Ccel_2814; phage(gi77020163) | 4e-26 | Click |
| 2 | complement(3372342..3372755) | PHAGE_Entero_phiFL3A: integrase; Ccel_2815; phage(gi281416214) | 3e-05 | Click |
| 3 | complement(3372756..3374321) | PHAGE_Bacill_WBeta: putative site-specific recombinase; Ccel_2816; phage(gi85701406) | 2e-39 | Click |
| 4 | complement(3374383..3374619) | hypothetical protein; Ccel_2817 | N/A | Click |
| 5 | complement(3374814..3375515) | N-acetylmuramyl-L-alanine amidase, negative regulator of AmpC, AmpD; Ccel_2818 | N/A | Click |
| 6 | complement(3375512..3375928) | PHAGE_Bacill_WBeta: phage holin; Ccel_2819; phage(gi85701395) | 4e-28 | Click |
| 7 | complement(3376013..3378481) | hypothetical protein; Ccel_2820 | N/A | Click |
| 8 | complement(3378478..3379047) | hypothetical protein; Ccel_2821 | N/A | Click |
| 9 | complement(3379057..3379260) | hypothetical protein; Ccel_2822 | N/A | Click |
| 10 | complement(3379270..3381789) | PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp32; Ccel_2823; phage(gi158267613) | 1e-29 | Click |
| 11 | complement(3381795..3382568) | PHAGE_Bacill_BtCS33: phage tail fiber protein; Ccel_2824; phage(gi392972723) | 1e-09 | Click |
| 12 | complement(3382584..3385040) | PHAGE_Strept_Dp_1: TMP; Ccel_2825; phage(gi327198366) | 7e-57 | Click |
| 13 | complement(3385059..3385238) | hypothetical protein; Ccel_2826 | N/A | Click |
| 14 | complement(3385250..3385633) | hypothetical protein; Ccel_2827 | N/A | Click |
| 15 | complement(3385636..3386235) | PHAGE_Bacill_WBeta: putative major tail protein; Ccel_2828; phage(gi85701389) | 3e-14 | Click |
| 16 | complement(3386238..3386582) | hypothetical protein; Ccel_2829 | N/A | Click |
| 17 | complement(3386579..3387010) | phage protein, HK97 gp10 family; Ccel_2830 | N/A | Click |
| 18 | complement(3387003..3387323) | phage head-tail adaptor; Ccel_2831 | N/A | Click |
| 19 | complement(3387340..3387660) | phage protein; Ccel_2832 | N/A | Click |
| 20 | complement(3387687..3387899) | PHAGE_Salini_CW02: possible head fiber; Ccel_2833; phage(gi423261955) | 1e-05 | Click |
| 21 | complement(3387912..3389105) | PHAGE_Entero_phiP27: putative major capsid protein; Ccel_2834; phage(gi18249904) | 5e-44 | Click |
| 22 | complement(3389125..3389814) | PHAGE_Geobac_E2: putative Clp peptidase; Ccel_2835; phage(gi148747731) | 7e-48 | Click |
| 23 | complement(3389815..3391059) | PHAGE_Klebsi_phiKO2: putative portal protein; Ccel_2836; phage(gi46402090) | 8e-72 | Click |
| 24 | complement(3391103..3392707) | PHAGE_Nocard_NBR1: terminase large subunit; Ccel_2837; phage(gi372217589) | 2e-91 | Click |
| 25 | complement(3392797..3392985) | hypothetical protein; Ccel_2838 | N/A | Click |
| 26 | complement(3393009..3393236) | hypothetical protein; Ccel_2839 | N/A | Click |
| 27 | complement(3393233..3393925) | hypothetical protein; Ccel_2840 | N/A | Click |
| 28 | complement(3394039..3396198) | PHAGE_Entero_P1: Dmt; Ccel_2841; phage(gi46401691) | 5e-29 | Click |
Region 5, total : 23 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3497642..3497653 | attL ATTTTTAACTTT | N/A | Click |
| 2 | 3499733..3500530 | PHAGE_Bacill_36: baseplate hub protein; Ccel_2940; phage(gi156564128) | 9e-14 | Click |
| 3 | 3500650..3501402 | PHAGE_Bacill_Eoghan: cell wall hydrolase/autolysin; Ccel_2941; phage(gi460041965) | 9e-23 | Click |
| 4 | complement(3501368..3502330) | hypothetical protein; Ccel_2942 | N/A | Click |
| 5 | 3502648..3502660 | attL GACCAATAAAAAA | N/A | Click |
| 6 | complement(3502987..3503454) | PHAGE_Clostr_phi3626: holin; Ccel_2943; phage(gi20065982) | 5e-08 | Click |
| 7 | complement(3503481..3504182) | peptidase M15B and M15C DD-carboxypeptidase VanY/endolysin; Ccel_2944 | N/A | Click |
| 8 | complement(3504314..3504814) | MazF family transcriptional regulator; Ccel_2945 | N/A | Click |
| 9 | complement(3504818..3505066) | hypothetical protein; Ccel_2946 | N/A | Click |
| 10 | complement(3505395..3505511) | hypothetical protein; Ccel_2947 | N/A | Click |
| 11 | complement(3505516..3505911) | hypothetical protein; Ccel_2948 | N/A | Click |
| 12 | complement(3506177..3506989) | PROPHAGE_Escher_CFT073: transposase insF; Ccel_2949; phage(gi26249410) | 9e-75 | Click |
| 13 | complement(3507037..3507321) | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; Ccel_2950; phage(gi24373865) | 2e-11 | Click |
| 14 | complement(3507346..3507504) | PHAGE_Clostr_CD119: XkdK protein; Ccel_2951; phage(gi90592650) | 5e-05 | Click |
| 15 | complement(3507509..3507967) | PHAGE_Clostr_phiMMP04: hypothetical protein; Ccel_2952; phage(gi414090450) | 4e-10 | Click |
| 16 | complement(3507977..3508396) | PHAGE_Clostr_phiMMP04: hypothetical protein; Ccel_2953; phage(gi414090449) | 6e-08 | Click |
| 17 | complement(3508397..3508729) | phage head-tail adaptor; Ccel_2954 | N/A | Click |
| 18 | complement(3508726..3509007) | PHAGE_Clostr_PhiS63: gp7; Ccel_2955; phage(gi388570636) | 6e-14 | Click |
| 19 | complement(3509057..3510019) | PHAGE_Clostr_PhiS63: gp6; Ccel_2956; phage(gi388570635) | 3e-90 | Click |
| 20 | complement(3510049..3510144) | hypothetical protein; Ccel_2957 | N/A | Click |
| 21 | complement(3510191..3510802) | PHAGE_Entero_EFRM31: prohead protease; Ccel_2958; phage(gi327198114) | 9e-25 | Click |
| 22 | complement(3510792..3512039) | PHAGE_Clostr_PhiS63: gp4; Ccel_2959; phage(gi388570634) | 3e-101 | Click |
| 23 | 3512164..3512176 | attR GACCAATAAAAAA | N/A | Click |
| 24 | complement(3512258..3513925) | PHAGE_Clostr_PhiS63: gp2; Ccel_2960; phage(gi388570632) | 2e-170 | Click |
| 25 | complement(3514083..3515129) | PROPHAGE_Shewan_MR-1: ISSod13, transposase; Ccel_2961; phage(gi24375047) | 8e-112 | Click |
| 26 | complement(3515217..3517409) | phage related protein; Ccel_2962 | N/A | Click |
| 27 | 3519285..3519296 | attR ATTTTTAACTTT | N/A | Click |
Region 6, total : 16 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3519058..3519069 | attL TACTTATTCTTA | N/A | Click |
| 2 | 3521477..3521489 | attL CTATATTGAATAA | N/A | Click |
| 3 | 3521531..3521746 | PHAGE_Clostr_phiCD38_2: hypothetical protein; Ccel_2966; phage(gi333798131) | 9e-08 | Click |
| 4 | 3521869..3523473 | PHAGE_Clostr_st: XerC/D family recombinase; Ccel_2967; phage(gi80159790) | 5e-08 | Click |
| 5 | 3523877..3524215 | hypothetical protein; Ccel_2968 | N/A | Click |
| 6 | 3524209..3524565 | PROPHAGE_Pseudo_KT2440: ISPpu15, transposase Orf1; Ccel_2969; phage(gi26990788) | 5e-17 | Click |
| 7 | 3524641..3526230 | PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf2; Ccel_2970; phage(gi26989833) | 3e-83 | Click |
| 8 | complement(3526361..3526501) | hypothetical protein; Ccel_2971 | N/A | Click |
| 9 | complement(3526664..3527710) | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_2972; phage(gi160688404) | 1e-07 | Click |
| 10 | complement(3527790..3527909) | hypothetical protein; Ccel_2973 | N/A | Click |
| 11 | complement(3527949..3528818) | PHAGE_Lactob_LP65: hypothetical protein LP65_gp070; Ccel_2974; phage(gi56693118) | 5e-05 | Click |
| 12 | 3528945..3529757 | hypothetical protein; Ccel_2975 | N/A | Click |
| 13 | complement(3529814..3530119) | hypothetical protein; Ccel_2976 | N/A | Click |
| 14 | 3530165..3531211 | PHAGE_Spirop_3x: hypothetical protein SkV1VCR23x_ORF3; Ccel_2977; phage(gi160688404) | 1e-07 | Click |
| 15 | 3531368..3531380 | attR CTATATTGAATAA | N/A | Click |
| 16 | complement(3531425..3531718) | PHAGE_Lactob_Lj928: putative major head protein; Ccel_2978; phage(gi41179318) | 1e-06 | Click |
| 17 | complement(3531741..3532283) | PHAGE_Bacill_SPBc2: putative ATP/GTP-binding protein; Ccel_2979; phage(gi9630203) | 8e-22 | Click |
| 18 | complement(3532292..3532546) | hypothetical protein; Ccel_2980 | N/A | Click |
| 19 | complement(3532674..3533597) | PHAGE_Thermu_45: XerD-like integrase; Ccel_2981; phage(gi157265299) | 2e-15 | Click |
| 20 | 3533748..3533759 | attR TACTTATTCTTA | N/A | Click |
Region 7, total : 46 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3582720..3584711) | PHAGE_Entero_phiFL3A: PblB-like tail protein; Ccel_3033; phage(gi281416271) | 1e-13 | Click |
| 2 | complement(3584716..3585075) | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0323; Ccel_3034; phage(gi41179261) | 3e-14 | Click |
| 3 | complement(3585089..3587614) | PHAGE_Clostr_phiCP26F: phage tail tape measure protein; Ccel_3035; phage(gi422933964) | 4e-33 | Click |
| 4 | complement(3587607..3588017) | hypothetical protein; Ccel_3036 | N/A | Click |
| 5 | complement(3587959..3588264) | hypothetical protein; Ccel_3037 | N/A | Click |
| 6 | complement(3588302..3588754) | PHAGE_Bacill_PBC1: major capsid protein gpP; Ccel_3038; phage(gi389060336) | 4e-14 | Click |
| 7 | complement(3588754..3589152) | hypothetical protein; Ccel_3039 | N/A | Click |
| 8 | complement(3589149..3589532) | PHAGE_Bacill_PBC1: putative minor capsid protein 2; Ccel_3040; phage(gi389060334) | 1e-07 | Click |
| 9 | complement(3589532..3589849) | hypothetical protein; Ccel_3041 | N/A | Click |
| 10 | complement(3589852..3590214) | PHAGE_Bacill_PBC1: hypothetical protein; Ccel_3042; phage(gi389060332) | 2e-12 | Click |
| 11 | complement(3590227..3590502) | PHAGE_Clostr_phiC2: hypothetical protein phiC2p08; Ccel_3043; phage(gi134287343) | 8e-06 | Click |
| 12 | complement(3590514..3591419) | PHAGE_Bacill_IEBH: main capsid protein; Ccel_3044; phage(gi197261563) | 1e-68 | Click |
| 13 | complement(3591434..3592015) | PHAGE_Clostr_CD119: putative scaffold protein; Ccel_3045; phage(gi90592645) | 7e-22 | Click |
| 14 | complement(3592165..3592398) | hypothetical protein; Ccel_3046 | N/A | Click |
| 15 | complement(3592456..3592674) | hypothetical protein; Ccel_3047 | N/A | Click |
| 16 | complement(3592679..3594610) | PHAGE_Strept_SV1: putative head assembly protein; Ccel_3048; phage(gi410491724) | 4e-26 | Click |
| 17 | complement(3594591..3596093) | PHAGE_Strept_SV1: putative portal protein; Ccel_3049; phage(gi410491723) | 2e-08 | Click |
| 18 | complement(3596097..3597449) | PHAGE_Bacill_PBC1: terminase large subunit; Ccel_3050; phage(gi389060324) | 7e-15 | Click |
| 19 | complement(3597452..3597964) | PHAGE_Cronob_phiES15: terminase small subunit; Ccel_3051; phage(gi401817591) | 2e-25 | Click |
| 20 | complement(3598019..3598348) | hypothetical protein; Ccel_3052 | N/A | Click |
| 21 | complement(3598547..3598981) | hypothetical protein; Ccel_3053 | N/A | Click |
| 22 | complement(3598994..3599179) | hypothetical protein; Ccel_3054 | N/A | Click |
| 23 | complement(3599179..3600552) | PHAGE_Bacill_PBC1: SNF2-like protein; Ccel_3055; phage(gi389060372) | 5e-159 | Click |
| 24 | complement(3600542..3600802) | PHAGE_Bacter_2: hypothetical protein APSE235; Ccel_3056; phage(gi212499740) | 2e-17 | Click |
| 25 | complement(3601092..3603461) | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp32; Ccel_3057; phage(gi215401140) | 3e-173 | Click |
| 26 | complement(3603481..3603897) | hypothetical protein; Ccel_3058 | N/A | Click |
| 27 | complement(3603909..3604886) | PHAGE_Synech_S_CBS3: DNA methylase; Ccel_3059; phage(gi331028047) | 3e-101 | Click |
| 28 | complement(3604870..3606252) | PHAGE_Synech_S_CBS3: DNA methylase; Ccel_3060; phage(gi331028047) | 1e-135 | Click |
| 29 | complement(3606288..3606437) | hypothetical protein; Ccel_3061 | N/A | Click |
| 30 | complement(3606409..3608367) | PHAGE_Bacill_PBC1: DNA polymerase; Ccel_3062; phage(gi389060355) | 0.0 | Click |
| 31 | complement(3608381..3608614) | hypothetical protein; Ccel_3063 | N/A | Click |
| 32 | complement(3608653..3608928) | hypothetical protein; Ccel_3064 | N/A | Click |
| 33 | complement(3609012..3609578) | PHAGE_Staphy_SMSAP5: hypothetical protein; Ccel_3065; phage(gi422935814) | 4e-56 | Click |
| 34 | complement(3609595..3610830) | PHAGE_Staphy_phi7401PVL: hypothetical protein; Ccel_3066; phage(gi448244653) | 3e-97 | Click |
| 35 | complement(3610832..3611233) | PHAGE_Bacill_PBC1: hypothetical protein; Ccel_3067; phage(gi389060349) | 1e-06 | Click |
| 36 | complement(3611258..3611833) | PHAGE_Entero_ES18: gp53; Ccel_3068; phage(gi62362266) | 4e-26 | Click |
| 37 | complement(3611892..3612179) | hypothetical protein; Ccel_3069 | N/A | Click |
| 38 | complement(3612179..3612424) | PHAGE_Bacill_phBC6A51: Transcription state regulatory protein abrB; Ccel_3070; phage(gi31415778) | 6e-14 | Click |
| 39 | complement(3612393..3612593) | hypothetical protein; Ccel_3071 | N/A | Click |
| 40 | complement(3612598..3612852) | hypothetical protein; Ccel_3072 | N/A | Click |
| 41 | complement(3612856..3613389) | PHAGE_Megavi_lba: putative intron HNH endonuclease; Ccel_3073; phage(gi448825290) | 7e-15 | Click |
| 42 | complement(3613463..3613597) | hypothetical protein; Ccel_3074 | N/A | Click |
| 43 | complement(3613630..3613947) | PHAGE_Bacill_BCJA1c: repressor; Ccel_3075; phage(gi56694874) | 1e-12 | Click |
| 44 | 3614180..3614530 | PHAGE_Lister_2389: Rep protein; Ccel_3076; phage(gi17488532) | 7e-16 | Click |
| 45 | 3614535..3615125 | hypothetical protein; Ccel_3077 | N/A | Click |
| 46 | 3615122..3616570 | PHAGE_Geobac_E2: putative recombinase; Ccel_3078; phage(gi148747753) | 2e-31 | Click |
Region 8, total : 45 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3831151..3833145) | PHAGE_Entero_phiFL3A: PblB-like tail protein; Ccel_3280; phage(gi281416271) | 1e-13 | Click |
| 2 | complement(3833150..3833509) | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0323; Ccel_3281; phage(gi41179261) | 3e-14 | Click |
| 3 | complement(3833523..3836048) | PHAGE_Clostr_phiCP26F: phage tail tape measure protein; Ccel_3282; phage(gi422933964) | 8e-34 | Click |
| 4 | 3835300..3835311 | attL ATATTAATAAAA | N/A | Click |
| 5 | complement(3836041..3836427) | hypothetical protein; Ccel_3283 | N/A | Click |
| 6 | complement(3836393..3836698) | hypothetical protein; Ccel_3284 | N/A | Click |
| 7 | complement(3836737..3837216) | PHAGE_Bacill_PBC1: major capsid protein gpP; Ccel_3285; phage(gi389060336) | 2e-15 | Click |
| 8 | complement(3837209..3837619) | hypothetical protein; Ccel_3286 | N/A | Click |
| 9 | complement(3837616..3837999) | PHAGE_Bacill_PBC1: putative minor capsid protein 2; Ccel_3287; phage(gi389060334) | 8e-09 | Click |
| 10 | complement(3837999..3838316) | hypothetical protein; Ccel_3288 | N/A | Click |
| 11 | complement(3838319..3838681) | PHAGE_Bacill_PBC1: hypothetical protein; Ccel_3289; phage(gi389060332) | 9e-13 | Click |
| 12 | complement(3838694..3838927) | PHAGE_Clostr_phiC2: hypothetical protein phiC2p08; Ccel_3290; phage(gi134287343) | 2e-05 | Click |
| 13 | complement(3838939..3839844) | PHAGE_Bacill_IEBH: main capsid protein; Ccel_3291; phage(gi197261563) | 3e-68 | Click |
| 14 | complement(3839859..3840440) | PHAGE_Clostr_CD119: putative scaffold protein; Ccel_3292; phage(gi90592645) | 3e-21 | Click |
| 15 | complement(3840590..3840823) | hypothetical protein; Ccel_3293 | N/A | Click |
| 16 | complement(3840881..3841099) | hypothetical protein; Ccel_3294 | N/A | Click |
| 17 | complement(3841104..3843035) | PHAGE_Strept_SV1: putative head assembly protein; Ccel_3295; phage(gi410491724) | 2e-26 | Click |
| 18 | complement(3843016..3844518) | PHAGE_Strept_SV1: putative portal protein; Ccel_3296; phage(gi410491723) | 7e-09 | Click |
| 19 | complement(3844522..3845874) | PHAGE_Clostr_phiCD38_2: terminase large subunit; Ccel_3297; phage(gi333798109) | 4e-19 | Click |
| 20 | complement(3845877..3846389) | PHAGE_Cronob_phiES15: terminase small subunit; Ccel_3298; phage(gi401817591) | 4e-25 | Click |
| 21 | complement(3846443..3846739) | hypothetical protein; Ccel_3299 | N/A | Click |
| 22 | complement(3846891..3847319) | RNA polymerase, sigma-24 subunit, ECF subfamily; Ccel_3300 | N/A | Click |
| 23 | complement(3847458..3847877) | PHAGE_Bacill_BPS13: hypothetical protein; Ccel_3301; phage(gi410492545) | 2e-20 | Click |
| 24 | complement(3847918..3848328) | PHAGE_Bacill_BCJA1c: rus; Ccel_3302; phage(gi56694892) | 3e-55 | Click |
| 25 | complement(3848418..3848687) | hypothetical protein; Ccel_3303 | N/A | Click |
| 26 | complement(3849048..3851273) | PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp22; Ccel_3304; phage(gi56694890) | 0.0 | Click |
| 27 | complement(3851290..3852438) | PHAGE_Bacill_phBC6A51: hypothetical protein BC1869; Ccel_3305; phage(gi31415763) | 3e-33 | Click |
| 28 | complement(3852439..3853788) | PHAGE_Mycoba_Corndog: gp90; Ccel_3306; phage(gi29566374) | 3e-09 | Click |
| 29 | complement(3853810..3855420) | PHAGE_Bacill_BCJA1c: DEAD box family helicase; Ccel_3307; phage(gi56694884) | 0.0 | Click |
| 30 | complement(3855424..3855906) | PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp15; Ccel_3308; phage(gi56694883) | 3e-37 | Click |
| 31 | complement(3855932..3857098) | PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp14; Ccel_3309; phage(gi56694882) | 2e-95 | Click |
| 32 | complement(3857098..3858399) | PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp13; Ccel_3310; phage(gi56694881) | 2e-166 | Click |
| 33 | complement(3858454..3858741) | hypothetical protein; Ccel_3311 | N/A | Click |
| 34 | complement(3858741..3858986) | PHAGE_Bacill_phBC6A51: Transcription state regulatory protein abrB; Ccel_3312; phage(gi31415778) | 6e-14 | Click |
| 35 | complement(3858955..3859155) | hypothetical protein; Ccel_3313 | N/A | Click |
| 36 | complement(3859160..3859414) | hypothetical protein; Ccel_3314 | N/A | Click |
| 37 | complement(3859487..3859693) | prophage LambdaBa04, DNA binding protein; Ccel_3315 | N/A | Click |
| 38 | complement(3859716..3859898) | PHAGE_Geobac_GBSV1: immunity repressor protein; Ccel_3316; phage(gi115334658) | 8e-07 | Click |
| 39 | 3860095..3860940 | PHAGE_Staphy_2638A: ORF016; Ccel_3317; phage(gi66395466) | 2e-27 | Click |
| 40 | 3860934..3860945 | attR ATATTAATAAAA | N/A | Click |
| 41 | 3860960..3862231 | PHAGE_Strept_PH15: putative integrase; Ccel_3318; phage(gi190151416) | 7e-23 | Click |
| 42 | complement(3862355..3862430) | tRNA | N/A | Click |
| 43 | complement(3862436..3862509) | tRNA | N/A | Click |
| 44 | complement(3862595..3863239) | PHAGE_Bacill_BCP78: putative RNA polymerase sigma 28 subunit SigG; Ccel_3319; phage(gi410492878) | 3e-10 | Click |
| 45 | complement(3863373..3864320) | RNA methyltransferase, TrmH family, group 3; Ccel_3320 | N/A | Click |
| 46 | complement(3864352..3864771) | ribonuclease III; Ccel_3321 | N/A | Click |
| 47 | complement(3865074..3865835) | PHAGE_Cafete_BV_PW1: putative apurinic-apyrimidinic endonuclease 1; Ccel_3322; phage(gi310831095) | 5e-62 | Click |
| 48 | complement(3865901..3866734) | PHAGE_Lactob_phiadh: hypothetical protein phiadhp52; Ccel_3323; phage(gi9633052) | 5e-06 | Click |
| 49 | complement(3866867..3868252) | PHAGE_Megavi_lba: cysteinyl-tRNA synthetase; Ccel_3324; phage(gi448825804) | 3e-39 | Click |
| 50 | complement(3868275..3869006) | PHAGE_Thermu_phiYS40: UDP-3-O-; Ccel_3325; phage(gi118197672) | 7e-05 | Click |