The gene/protein map for AP011170 is currently unavailable.

Definition Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 chromosome, complete genome.
Accession NC_011883
Length 2,873,437
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 42 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 273168..274910  PHAGE_Microm_MpV1: hypothetical protein; Ddes_0220; phage(gi313768236)  6e-41  Click
2 275079..276551  amino acid permease-associated region; Ddes_0221  N/A  Click
3 277300..277379  attL    GACGTTTAGTCATAAGCCTTTGATTTTCTTGGTGGGTCGTGCGGGGTTCGAACCTGCGACTCTCTGCTTAAAAGGCAGAT  N/A  Click
4 complement(277508..278539)  PHAGE_Bacill_phIS3501: phage integrase; Ddes_0222; phage(gi422934298)  2e-10  Click
5 complement(278544..278927)  hypothetical protein; Ddes_0223  N/A  Click
6 279047..279469  hypothetical protein; Ddes_0224  N/A  Click
7 279541..280083  PHAGE_Liberi_SC2: putative Bro-N family phage antirepressor; Ddes_0225; phage(gi423262542)  3e-16  Click
8 280583..280843  PHAGE_Burkho_phiE202: gp6, pANL56; Ddes_0226; phage(gi134288760)  2e-05  Click
9 280833..281087  hypothetical protein; Ddes_0227  N/A  Click
10 281236..281439  PHAGE_Haemop_HP1: hypothetical protein HP1p03; Ddes_0228; phage(gi9628603)  7e-11  Click
11 281464..281712  PHAGE_Haemop_HP1: hypothetical protein HP1p04; Ddes_0229; phage(gi9628604)  1e-08  Click
12 281725..282606  hypothetical protein; Ddes_0230  N/A  Click
13 282615..283364  PHAGE_Mycoba_Che9c: gp68; Ddes_0231; phage(gi29566174)  1e-50  Click
14 complement(283391..283552)  hypothetical protein; Ddes_0232  N/A  Click
15 complement(283688..283942)  hypothetical protein; Ddes_0233  N/A  Click
16 284293..284514  hypothetical protein; Ddes_0234  N/A  Click
17 284511..284972  hypothetical protein; Ddes_0235  N/A  Click
18 complement(285017..285397)  PHAGE_Rhodov_RS1: hypothetical protein; Ddes_0236; phage(gi472342905)  5e-05  Click
19 complement(285407..285649)  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_19; Ddes_0237; phage(gi148727148)  2e-10  Click
20 complement(285696..286730)  PHAGE_Aeromo_phiO18P: putative portal protein; Ddes_0238; phage(gi148727149)  8e-64  Click
21 complement(286741..288588)  PHAGE_Aeromo_phiO18P: putative terminase large subunit; Ddes_0239; phage(gi148727151)  1e-126  Click
22 288701..289531  PHAGE_Aeromo_phiO18P: putative capsid scaffolding protein; Ddes_0240; phage(gi148727152)  1e-27  Click
23 289565..290599  PHAGE_Burkho_phiE202: gp2, phage major capsid protein, P2 family; Ddes_0241; phage(gi134288740)  6e-59  Click
24 290599..291348  PHAGE_Vibrio_kappa: putative terminase endonuclease subunit; Ddes_0242; phage(gi165970259)  3e-17  Click
25 291453..291920  PHAGE_Aeromo_phiO18P: putative head completion protein; Ddes_0243; phage(gi148727155)  1e-11  Click
26 291920..292444  PHAGE_Haemop_HP2: orf21; Ddes_0244; phage(gi17981835)  2e-07  Click
27 292441..293124  PHAGE_Aeromo_phiO18P: putative tail completion protein; Ddes_0245; phage(gi148727157)  2e-10  Click
28 293136..294245  PHAGE_Aeromo_phiO18P: putative tail sheath protein; Ddes_0246; phage(gi148727158)  5e-85  Click
29 294255..294725  PHAGE_Aeromo_phiO18P: putative tail tube protein; Ddes_0247; phage(gi148727159)  4e-31  Click
30 294737..295120  PHAGE_Pectob_PP1: peptidase M15A domain-containing protein; Ddes_0248; phage(gi423262089)  8e-12  Click
31 295402..295674  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_35; Ddes_0249; phage(gi148727163)  4e-06  Click
32 295674..296006  hypothetical protein; Ddes_0250  N/A  Click
33 296009..296269  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_36; Ddes_0251; phage(gi148727164)  5e-12  Click
34 296302..296454  hypothetical protein; Ddes_0252  N/A  Click
35 296460..298313  PHAGE_Aeromo_phiO18P: putative tail tape measure protein; Ddes_0253; phage(gi148727166)  4e-73  Click
36 298313..298675  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_39; Ddes_0254; phage(gi148727167)  1e-13  Click
37 298675..299865  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_40; Ddes_0255; phage(gi148727168)  4e-85  Click
38 299862..300476  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_41; Ddes_0256; phage(gi148727169)  3e-30  Click
39 300473..302302  PHAGE_Aeromo_phiO18P: putative tail fiber protein; Ddes_0257; phage(gi158518662)  5e-35  Click
40 302589..303167  hypothetical protein; Ddes_0258  N/A  Click
41 303177..303983  hypothetical protein; Ddes_0259  N/A  Click
42 303980..304954  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_44; Ddes_0260; phage(gi148727173)  1e-07  Click
43 304942..305478  PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_45; Ddes_0261; phage(gi148727174)  3e-20  Click
44 309854..309933  attR    GACGTTTAGTCATAAGCCTTTGATTTTCTTGGTGGGTCGTGCGGGGTTCGAACCTGCGACTCTCTGCTTAAAAGGCAGAT  N/A  Click