| Definition | Pseudomonas aeruginosa LESB58, complete genome. |
|---|---|
| Accession | NC_011770 |
| Length | 6,601,757 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 21 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(663919..664233) | PHAGE_Burkho_AH2: excisionase; PLES_06071; phage(gi399529070) | 1e-06 | Click |
| 2 | complement(664333..665103) | PHAGE_Pseudo_F116: transcriptional regulator; PLES_06081; phage(gi56692918) | 9e-56 | Click |
| 3 | 665561..665761 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp42; PLES_06091; phage(gi17313259) | 7e-11 | Click |
| 4 | 665809..666168 | hypothetical protein; PLES_06101 | N/A | Click |
| 5 | 666531..666980 | putative holin; PLES_06111 | N/A | Click |
| 6 | 667002..667517 | hypothetical protein; PLES_06121 | N/A | Click |
| 7 | 667514..668071 | PHAGE_Pseudo_phiCTX: predicted baseplate; PLES_06131; phage(gi17313235) | 3e-21 | Click |
| 8 | 668224..668550 | PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; PLES_06141; phage(gi428782737) | 8e-20 | Click |
| 9 | 668547..669434 | PROPHAGE_Salmon_Ty2: phage baseplate assembly protein; PLES_06151; phage(gi29143752) | 4e-94 | Click |
| 10 | 669427..669960 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp21; PLES_06161; phage(gi17313238) | 2e-63 | Click |
| 11 | 669962..672067 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp22; PLES_06171; phage(gi17313239) | 3e-137 | Click |
| 12 | 672558..673718 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp24; PLES_06181; phage(gi17313241) | 2e-61 | Click |
| 13 | 673731..674234 | PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; PLES_06191; phage(gi428782747) | 2e-31 | Click |
| 14 | 674249..674593 | hypothetical protein; PLES_06201 | N/A | Click |
| 15 | 674763..677000 | PHAGE_Vibrio_VP882: phage-related tail protein; PLES_06211; phage(gi126010872) | 1e-22 | Click |
| 16 | 677010..677882 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp29; PLES_06221; phage(gi17313246) | 1e-12 | Click |
| 17 | 677857..678063 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp09; PLES_06231; phage(gi17313226) | 4e-07 | Click |
| 18 | 678121..679110 | PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PLES_06241; phage(gi428782753) | 6e-52 | Click |
| 19 | 679143..679772 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PLES_06251; phage(gi148912826) | 7e-49 | Click |
| 20 | 679769..680131 | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp28; PLES_06261; phage(gi209552447) | 9e-24 | Click |
| 21 | 680128..680385 | PHAGE_Pseudo_phi297: hypothetical protein; PLES_06271; phage(gi374531310) | 1e-20 | Click |
Region 2, total : 44 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 863855..863866 | attL CCGAGGCGGCGG | N/A | Click |
| 2 | complement(863965..865014) | PHAGE_Pseudo_F10: Integrase; PLES_07891; phage(gi148912793) | 0.0 | Click |
| 3 | complement(865240..865596) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp030; PLES_07901; phage(gi148912795) | 9e-11 | Click |
| 4 | complement(865601..866290) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp030; PLES_07911; phage(gi148912795) | 8e-31 | Click |
| 5 | complement(866463..866654) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp031; PLES_07921; phage(gi148912796) | 1e-29 | Click |
| 6 | complement(866767..868254) | PHAGE_Pseudo_F10: Conserved hypothetical protein; potential EaA homolog; PLES_07931; phage(gi148912798) | 2e-49 | Click |
| 7 | complement(868765..869349) | PHAGE_Entero_WV8: hypothetical protein WV8_gp096; PLES_07941; phage(gi238801828) | 1e-37 | Click |
| 8 | complement(869820..870203) | PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PLES_07951; phage(gi148912803) | 1e-23 | Click |
| 9 | complement(870555..871343) | PHAGE_Pseudo_F116: transcriptional regulator; PLES_07961; phage(gi56692918) | 2e-86 | Click |
| 10 | 871763..872272 | PHAGE_Xantho_Xp10: endonuclease of the HNH family with predicted DNA-binding module at C-terminus; PLES_07971; phage(gi32128470) | 5e-35 | Click |
| 11 | 873107..873601 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp045; PLES_07981; phage(gi148912810) | 2e-46 | Click |
| 12 | 873714..873890 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp046; PLES_07991; phage(gi148912811) | 1e-22 | Click |
| 13 | 874209..874973 | PHAGE_Cronob_ENT47670: phage antirepressor protein; PLES_08001; phage(gi431810509) | 1e-31 | Click |
| 14 | 875391..876269 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp052; PLES_08011; phage(gi148912817) | 4e-166 | Click |
| 15 | 876266..877054 | PHAGE_Pseudo_F10: DNA replication protein DnaC; PLES_08021; phage(gi148912818) | 7e-149 | Click |
| 16 | 877087..878481 | PHAGE_Pseudo_F10: Putative DnaB-like replicative helicase; PLES_08031; phage(gi148912819) | 0.0 | Click |
| 17 | 878846..879535 | PHAGE_Pseudo_F10: Putative metallophosphoesterase; PLES_08041; phage(gi148912821) | 1e-130 | Click |
| 18 | 879550..879810 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp057; PLES_08051; phage(gi148912822) | 4e-41 | Click |
| 19 | 879951..880196 | hypothetical protein; PLES_08061 | N/A | Click |
| 20 | complement(880514..880840) | DNA-binding protein; PLES_08071 | N/A | Click |
| 21 | 881215..881287 | tRNA | N/A | Click |
| 22 | 881354..881686 | PHAGE_Pseudo_F10: Putative Holin; PLES_08081; phage(gi148912825) | 1e-33 | Click |
| 23 | 881683..882300 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; lytic; phage protein; PLES_08091(gi148912826) | 9e-113 | Click |
| 24 | 882536..883006 | PHAGE_Pseudo_F10: Putative lysis protein Rz; PLES_08101; phage(gi148912827) | 3e-75 | Click |
| 25 | 883003..883746 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; PLES_08111; phage(gi148912828) | 1e-136 | Click |
| 26 | 884141..884443 | PHAGE_Pseudo_F10: Putative small subunit (Nu1 homolog) of DNA packaging dimer; PLES_08121; phage(gi148912766) | 2e-32 | Click |
| 27 | 884436..886391 | PHAGE_Pseudo_F10: Putative large subunit (GpA homolog) of DNA packaging dimer; PLES_08131; phage(gi148912767) | 0.0 | Click |
| 28 | 886603..888249 | PHAGE_Pseudo_F10: Putative portal protein; PLES_08141; phage(gi148912769) | 0.0 | Click |
| 29 | 888578..890314 | PHAGE_Pseudo_F10: Putative Clp protease; heat; phage shock protein; PLES_08151(gi148912770) | 0.0 | Click |
| 30 | 890381..890698 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp006; PLES_08161; phage(gi148912771) | 9e-50 | Click |
| 31 | 890889..891491 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp008; PLES_08171; phage(gi148912773) | 3e-87 | Click |
| 32 | 891495..891689 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp009; PLES_08181; phage(gi148912774) | 1e-28 | Click |
| 33 | 891691..892443 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; PLES_08191; phage(gi148912775) | 1e-127 | Click |
| 34 | 892525..893166 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp011; PLES_08201; phage(gi148912776) | 3e-80 | Click |
| 35 | 893631..896114 | PHAGE_Pseudo_F10: Putative tail length tape measure protein; PLES_08211; phage(gi148912778) | 0.0 | Click |
| 36 | 897077..898372 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp016; PLES_08221; phage(gi148912781) | 0.0 | Click |
| 37 | 898375..898785 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp017; PLES_08231; phage(gi148912782) | 2e-72 | Click |
| 38 | 898785..899330 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp018; PLES_08241; phage(gi148912783) | 3e-101 | Click |
| 39 | 899341..899763 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp019; PLES_08251; phage(gi148912784) | 8e-43 | Click |
| 40 | 899750..901243 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp020; PLES_08261; phage(gi148912785) | 3e-06 | Click |
| 41 | 901322..901852 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp021; PLES_08271; phage(gi148912786) | 1e-93 | Click |
| 42 | 902041..902601 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp023; PLES_08281; phage(gi148912788) | 9e-104 | Click |
| 43 | 902602..902883 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp024; PLES_08291; phage(gi148912789) | 4e-48 | Click |
| 44 | 903430..903741 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp026; PLES_08301; phage(gi148912791) | 6e-46 | Click |
| 45 | 903738..903977 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp027; PLES_08311; phage(gi148912792) | 4e-35 | Click |
| 46 | 904050..904274 | PHAGE_Pseudo_JBD88a: hypothetical protein; PLES_08321; phage(gi448244741) | 8e-33 | Click |
| 47 | 906071..907309 | PHAGE_Cronob_vB_CsaM_GAP32: tyrosyl-tRNA synthetase; PLES_08331; phage(gi414087049) | 7e-60 | Click |
| 48 | 915497..915508 | attR CCGAGGCGGCGG | N/A | Click |
Region 3, total : 50 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1433756..1433781 | attL CAGGCTTTGATGCCGTAGAGAACGTA | N/A | Click |
| 2 | complement(1433854..1434957) | PHAGE_Entero_HK106: integrase; PLES_13211; phage(gi428783305) | 4e-63 | Click |
| 3 | complement(1434938..1435180) | PHAGE_Entero_mEp235: excisionase; PLES_13221; phage(gi428781837) | 7e-06 | Click |
| 4 | complement(1435396..1435713) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_13231; phage(gi374531688) | 5e-43 | Click |
| 5 | complement(1436168..1436377) | hypothetical protein; PLES_13241 | N/A | Click |
| 6 | complement(1436451..1436591) | hypothetical protein; PLES_13251 | N/A | Click |
| 7 | complement(1436690..1438276) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_13261; phage(gi374531692) | 6e-77 | Click |
| 8 | complement(1438273..1438479) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_13271; phage(gi374531693) | 5e-28 | Click |
| 9 | complement(1438443..1438691) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_13281; phage(gi374531248) | 2e-40 | Click |
| 10 | complement(1438774..1439643) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_13291; phage(gi374531705) | 1e-105 | Click |
| 11 | complement(1439735..1440271) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_13301; phage(gi374531251) | 1e-23 | Click |
| 12 | complement(1440268..1441263) | PHAGE_Salico_CGphi29: DNA methylase; PLES_13311; phage(gi472340158) | 8e-100 | Click |
| 13 | complement(1441328..1441630) | hypothetical protein; PLES_13321 | N/A | Click |
| 14 | complement(1441838..1442086) | hypothetical protein; PLES_13322 | N/A | Click |
| 15 | complement(1442097..1442483) | PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PLES_13331; phage(gi148912803) | 3e-24 | Click |
| 16 | complement(1442793..1443659) | PHAGE_Burkho_BcepF1: ParB-like nuclease domain; PLES_13341; phage(gi126010943) | 2e-53 | Click |
| 17 | complement(1443886..1444092) | PHAGE_Pseudo_F116: hypothetical protein F116p26; PLES_13351; phage(gi56692944) | 4e-33 | Click |
| 18 | 1444616..1444870 | PHAGE_Pseudo_F116: hypothetical protein F116p28; PLES_13361; phage(gi56692946) | 3e-26 | Click |
| 19 | complement(1444923..1445282) | hypothetical protein; PLES_13371 | N/A | Click |
| 20 | complement(1445686..1446441) | PHAGE_Pseudo_F116: transcriptional regulator; PLES_13381; phage(gi56692918) | 2e-76 | Click |
| 21 | 1446952..1447656 | PHAGE_Salmon_SETP3: putative DNA-binding protein; PLES_13391; phage(gi134288608) | 7e-22 | Click |
| 22 | 1447721..1448554 | PHAGE_Pseudo_F116: hypothetical protein F116p32; PLES_13401; phage(gi56692948) | 3e-21 | Click |
| 23 | 1448541..1449338 | PHAGE_Pseudo_F116: hypothetical protein F116p33; PLES_13411; phage(gi56692949) | 1e-50 | Click |
| 24 | 1449538..1450119 | PHAGE_Pseudo_PAJU2: putative NinG; PLES_13421; phage(gi209552490) | 1e-64 | Click |
| 25 | 1450414..1450788 | PHAGE_Pseudo_PAJU2: putative antitermination protein Q; PLES_13431; phage(gi209552491) | 6e-12 | Click |
| 26 | complement(1450939..1451367) | PHAGE_Yersin_PY54: hypothetical protein PY54p57; PLES_13441; phage(gi33770566) | 2e-30 | Click |
| 27 | complement(1451414..1451596) | hypothetical protein; PLES_13451 | N/A | Click |
| 28 | 1451722..1452111 | PHAGE_Aeromo_phiO18P: putative holin; PLES_13461; phage(gi148727161) | 3e-07 | Click |
| 29 | 1452111..1452728 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PLES_13471; phage(gi148912826) | 1e-109 | Click |
| 30 | complement(1452932..1453165) | hypothetical protein; PLES_13481 | N/A | Click |
| 31 | 1453195..1453938 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp063; PLES_13491; phage(gi148912828) | 1e-136 | Click |
| 32 | 1454019..1454603 | PHAGE_Pseudo_F10: Putative small subunit (Nu1 homolog) of DNA packaging dimer; PLES_13501; phage(gi148912766) | 3e-69 | Click |
| 33 | 1454575..1456539 | PHAGE_Pseudo_F10: Putative large subunit (GpA homolog) of DNA packaging dimer; PLES_13511; phage(gi148912767) | 0.0 | Click |
| 34 | 1456667..1458391 | PHAGE_Pseudo_F10: Putative portal protein; PLES_13521; phage(gi148912769) | 0.0 | Click |
| 35 | 1458363..1460444 | PHAGE_Pseudo_F10: Putative Clp protease; PLES_13531; phage(gi148912770) | 0.0 | Click |
| 36 | 1460511..1460828 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp006; PLES_13541; phage(gi148912771) | 2e-52 | Click |
| 37 | 1461019..1461621 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp008; PLES_13551; phage(gi148912773) | 8e-87 | Click |
| 38 | 1461821..1462573 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; PLES_13561; phage(gi148912775) | 1e-137 | Click |
| 39 | 1462655..1463296 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp011; PLES_13571; phage(gi148912776) | 8e-80 | Click |
| 40 | 1463761..1466244 | PHAGE_Pseudo_F10: Putative tail length tape measure protein; PLES_13581; phage(gi148912778) | 0.0 | Click |
| 41 | 1466272..1466805 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp014; PLES_13591; phage(gi148912779) | 2e-98 | Click |
| 42 | 1466805..1468502 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp016; PLES_13601; phage(gi148912781) | 0.0 | Click |
| 43 | 1468505..1468915 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp017; PLES_13611; phage(gi148912782) | 1e-67 | Click |
| 44 | 1468915..1469460 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp018; PLES_13621; phage(gi148912783) | 1e-98 | Click |
| 45 | 1469471..1469875 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp019; PLES_13631; phage(gi148912784) | 2e-70 | Click |
| 46 | 1469872..1471530 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp020; PLES_13641; phage(gi148912785) | 0.0 | Click |
| 47 | 1471560..1472147 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp021; PLES_13651; phage(gi148912786) | 3e-106 | Click |
| 48 | 1472336..1472896 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp023; PLES_13661; phage(gi148912788) | 2e-101 | Click |
| 49 | 1473171..1474103 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp025; PLES_13671; phage(gi148912790) | 4e-18 | Click |
| 50 | 1474103..1474402 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp026; PLES_13681; phage(gi148912791) | 7e-27 | Click |
| 51 | 1474399..1474626 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp027; PLES_13691; phage(gi148912792) | 2e-10 | Click |
| 52 | 1476548..1476573 | attR CAGGCTTTGATGCCGTAGAGAACGTA | N/A | Click |
Region 4, total : 50 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1684131..1684844) | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15491; phage(gi448244986) | 7e-131 | Click |
| 2 | 1685013..1685369 | PHAGE_Pseudo_MP22: Ner-like protein; PLES_15501; phage(gi157834974) | 4e-61 | Click |
| 3 | 1685372..1685806 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15511; phage(gi448244988) | 1e-77 | Click |
| 4 | 1685806..1686012 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15521; phage(gi448244989) | 3e-16 | Click |
| 5 | 1686005..1688074 | PHAGE_Pseudo_MP38: transposase A; PLES_15531; phage(gi215479930) | 0.0 | Click |
| 6 | 1688071..1688841 | PHAGE_Pseudo_MP29: DNA transposition protein; PLES_15541; phage(gi215479983) | 7e-141 | Click |
| 7 | 1688838..1689485 | PHAGE_Pseudo_JBD24: hypothetical protein; PLES_15551; phage(gi448245052) | 2e-125 | Click |
| 8 | 1689586..1689999 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15561; phage(gi448244995) | 6e-75 | Click |
| 9 | 1689989..1690273 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15571; phage(gi448244996) | 5e-46 | Click |
| 10 | 1690290..1690808 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15581; phage(gi448244997) | 4e-92 | Click |
| 11 | 1690810..1691187 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15591; phage(gi448244998) | 7e-63 | Click |
| 12 | 1691189..1691470 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15601; phage(gi448245001) | 7e-47 | Click |
| 13 | 1691472..1691678 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15611; phage(gi448245002) | 3e-32 | Click |
| 14 | 1691681..1691950 | PHAGE_Pseudo_JBD88a: hypothetical protein; PLES_15621; phage(gi448244702) | 8e-41 | Click |
| 15 | 1692255..1692662 | PHAGE_Pseudo_MP42: hypothetical protein; PLES_15631; phage(gi399528598) | 5e-73 | Click |
| 16 | 1692649..1693098 | PHAGE_Pseudo_MP42: putative integral membrane protein; PLES_15641; phage(gi399528599) | 4e-81 | Click |
| 17 | 1693541..1693963 | PHAGE_Pseudo_JBD88a: hypothetical protein; PLES_15651; phage(gi448244707) | 3e-76 | Click |
| 18 | 1693963..1694379 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15661; phage(gi448245009) | 3e-69 | Click |
| 19 | 1694379..1694621 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15671; phage(gi448245010) | 2e-40 | Click |
| 20 | 1694618..1695019 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15681; phage(gi448245011) | 5e-70 | Click |
| 21 | 1695130..1695318 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15691; phage(gi448245013) | 1e-28 | Click |
| 22 | 1695327..1695827 | PHAGE_Pseudo_MP42: hypothetical protein; PLES_15701; phage(gi399528604) | 2e-87 | Click |
| 23 | 1695824..1696600 | PHAGE_Mycoba_Llij: gp66; PLES_15711; phage(gi109392252) | 2e-09 | Click |
| 24 | 1696605..1698254 | PHAGE_Pseudo_D3112: hypothetical protein D3112p26; PLES_15721; phage(gi38229138) | 0.0 | Click |
| 25 | 1698266..1699852 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15731; phage(gi448245016) | 0.0 | Click |
| 26 | 1699852..1701138 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15741; phage(gi448245017) | 0.0 | Click |
| 27 | 1701718..1701882 | PHAGE_Pseudo_D3112: hypothetical protein D3112p31; PLES_15751; phage(gi38229143) | 7e-22 | Click |
| 28 | 1701879..1702298 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15761; phage(gi448245020) | 8e-74 | Click |
| 29 | 1702379..1702534 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15771; phage(gi448245021) | 9e-21 | Click |
| 30 | 1702531..1702752 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15781; phage(gi448245022) | 1e-36 | Click |
| 31 | 1702972..1704078 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15791; phage(gi448245023) | 0.0 | Click |
| 32 | 1704088..1704486 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15801; phage(gi448245024) | 4e-71 | Click |
| 33 | 1704514..1705422 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15811; phage(gi448245025) | 2e-173 | Click |
| 34 | 1705434..1705748 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15821; phage(gi448245026) | 8e-49 | Click |
| 35 | 1705811..1705987 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15831; phage(gi448245027) | 1e-26 | Click |
| 36 | 1706397..1706876 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15841; phage(gi448245029) | 1e-89 | Click |
| 37 | 1707076..1707846 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15851; phage(gi448245031) | 9e-143 | Click |
| 38 | 1707850..1708335 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15861; phage(gi448245032) | 1e-88 | Click |
| 39 | 1708646..1712026 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15871; phage(gi448245034) | 0.0 | Click |
| 40 | 1712033..1712989 | PHAGE_Pseudo_MP29: hypothetical protein PPMP29_gp43; PLES_15881; phage(gi215480017) | 0.0 | Click |
| 41 | 1712991..1713914 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15891; phage(gi448245036) | 3e-177 | Click |
| 42 | 1713950..1715617 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15901; phage(gi448245037) | 0.0 | Click |
| 43 | 1715652..1716428 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15911; phage(gi448245038) | 6e-156 | Click |
| 44 | 1716437..1716676 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15921; phage(gi448245039) | 2e-41 | Click |
| 45 | 1716881..1719088 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15931; phage(gi448245041) | 0.0 | Click |
| 46 | 1719085..1720236 | PHAGE_Pseudo_JBD5: hypothetical protein; PLES_15941; phage(gi448245042) | 0.0 | Click |
| 47 | 1720233..1720526 | PHAGE_Pseudo_MP29: hypothetical protein PPMP29_gp51; PLES_15951; phage(gi215480025) | 3e-50 | Click |
| 48 | 1720605..1720829 | PHAGE_Pseudo_JBD88a: hypothetical protein; PLES_15961; phage(gi448244741) | 3e-36 | Click |
| 49 | complement(1720932..1721162) | hypothetical protein; PLES_15971 | N/A | Click |
| 50 | complement(1721214..1723970) | PHAGE_Ectoca_1: EsV-1-65; PLES_15981; phage(gi13242537) | 3e-37 | Click |
Region 5, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2527947..2527958 | attL GTTTGCGCAGGA | N/A | Click |
| 2 | 2537197..2538426 | PHAGE_Megavi_lba: putative serine/threonine-protein kinase/receptor; PLES_23641; phage(gi448826028) | 6e-11 | Click |
| 3 | complement(2538613..2539950) | PHAGE_Pseudo_phi297: integrase; PLES_23651; phage(gi374531312) | 1e-16 | Click |
| 4 | complement(2540392..2541504) | PHAGE_Entero_mEp235: integrase; PLES_23661; phage(gi428781836) | 2e-35 | Click |
| 5 | complement(2541793..2542125) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_23671; phage(gi374531245) | 5e-38 | Click |
| 6 | complement(2542291..2542821) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_23681; phage(gi374531246) | 2e-47 | Click |
| 7 | 2543025..2543819 | PHAGE_Entero_HK140: minor tail protein K; PLES_23701; phage(gi428781957) | 3e-58 | Click |
| 8 | complement(2544219..2545061) | PROPHAGE_Xantho_33913: IS1477 transposase; PLES_23711; phage(gi77747809) | 1e-86 | Click |
| 9 | complement(2545094..2545357) | PROPHAGE_Xantho_33913: IS1477 transposase; PLES_23721; phage(gi21230912) | 2e-28 | Click |
| 10 | 2545741..2546067 | PHAGE_Entero_N15: gp49; PLES_23731; phage(gi9630516) | 1e-08 | Click |
| 11 | 2546711..2548018 | phage minor tail protein L; PLES_23741 | N/A | Click |
| 12 | 2548759..2549055 | PHAGE_Entero_Sf6: putative transposase OrfB; PLES_23751; phage(gi41057343) | 7e-13 | Click |
| 13 | 2549609..2549620 | attR GTTTGCGCAGGA | N/A | Click |
| 14 | complement(2550676..2556972) | PHAGE_Marseillevirus: serine/threonine protein kinase; PLES_23771; phage(gi284504154) | 6e-05 | Click |
Region 6, total : 65 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2689497..2690165) | PHAGE_Camelp_virus: CMLV006; PLES_25011; phage(gi18640240) | 1e-14 | Click |
| 2 | 2690295..2690381 | tRNA | N/A | Click |
| 3 | 2690327..2690341 | attL CTTGAAAACCGTCGA | N/A | Click |
| 4 | complement(2690501..2691526) | PHAGE_Pseudo_F10: Integrase; PLES_25021; phage(gi148912793) | 1e-100 | Click |
| 5 | complement(2691570..2691806) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp029; PLES_25031; phage(gi148912794) | 7e-19 | Click |
| 6 | complement(2691885..2693795) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25041; phage(gi374531692) | 8e-77 | Click |
| 7 | complement(2693792..2693998) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25051; phage(gi374531693) | 5e-28 | Click |
| 8 | complement(2693962..2694210) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_25061; phage(gi374531248) | 2e-40 | Click |
| 9 | complement(2694293..2695231) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25071; phage(gi374531705) | 1e-105 | Click |
| 10 | complement(2695254..2695790) | PHAGE_Pseudo_phi297: hypothetical protein; PLES_25081; phage(gi374531251) | 1e-23 | Click |
| 11 | complement(2695787..2696728) | PHAGE_Salico_CGphi29: DNA methylase; PLES_25091; phage(gi472340158) | 9e-96 | Click |
| 12 | complement(2696847..2697149) | hypothetical protein; PLES_25101 | N/A | Click |
| 13 | complement(2697357..2697605) | hypothetical protein; PLES_25111 | N/A | Click |
| 14 | complement(2697616..2698002) | PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PLES_25121; phage(gi148912803) | 3e-24 | Click |
| 15 | complement(2698312..2699178) | PHAGE_Burkho_BcepF1: ParB-like nuclease domain; PLES_25131; phage(gi126010943) | 2e-53 | Click |
| 16 | complement(2699405..2699611) | PHAGE_Pseudo_F116: hypothetical protein F116p26; PLES_25141; phage(gi56692944) | 4e-33 | Click |
| 17 | complement(2699962..2700540) | hypothetical protein; PLES_25151 | N/A | Click |
| 18 | complement(2700847..2701596) | PHAGE_Burkho_2: gp47, conserved hypothetical protein; PLES_25161; phage(gi134288670) | 3e-20 | Click |
| 19 | complement(2702162..2702968) | PHAGE_Pseudo_vB_PaeS_PMG1: cI repressor protein; PLES_25171; phage(gi374531715) | 3e-34 | Click |
| 20 | 2703084..2703281 | PHAGE_Pseudo_F116: Cro-like protein; PLES_25181; phage(gi56692919) | 2e-07 | Click |
| 21 | 2703314..2703658 | hypothetical protein; PLES_25191 | N/A | Click |
| 22 | 2703995..2704459 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp36; PLES_25201; phage(gi17313253) | 5e-47 | Click |
| 23 | 2704841..2705263 | PHAGE_Sulfit_pCB2047_A: hypothetical protein; PLES_25211; phage(gi472341905) | 5e-10 | Click |
| 24 | 2705260..2706150 | PHAGE_Pseudo_PAJU2: putative replication protein O; PLES_25221; phage(gi209552482) | 5e-11 | Click |
| 25 | 2706147..2707976 | PHAGE_Pseudo_AF: putative DNA primase\helicase; PLES_25231; phage(gi431810342) | 0.0 | Click |
| 26 | 2708092..2708601 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25241; phage(gi374531722) | 8e-92 | Click |
| 27 | 2708796..2709428 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25251; phage(gi374531724) | 3e-125 | Click |
| 28 | 2709421..2710008 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25261; phage(gi374531725) | 5e-111 | Click |
| 29 | 2710005..2710274 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25271; phage(gi374531726) | 1e-10 | Click |
| 30 | 2710633..2711274 | PHAGE_Pseudo_vB_PaeS_PMG1: NinG protein; PLES_25281; phage(gi374531728) | 2e-58 | Click |
| 31 | 2711271..2711957 | PHAGE_Pseudo_phi297: hypothetical protein; PLES_25291; phage(gi374531281) | 3e-16 | Click |
| 32 | 2712547..2712619 | tRNA | N/A | Click |
| 33 | 2712635..2712706 | tRNA | N/A | Click |
| 34 | 2712714..2712786 | tRNA | N/A | Click |
| 35 | 2712838..2713212 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25311; phage(gi374531734) | 7e-64 | Click |
| 36 | 2713205..2713489 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25321; phage(gi374531735) | 6e-51 | Click |
| 37 | 2713489..2713740 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25331; phage(gi374531736) | 4e-24 | Click |
| 38 | 2713858..2714019 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25341; phage(gi374531738) | 9e-14 | Click |
| 39 | 2714019..2714327 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25351; phage(gi374531739) | 1e-23 | Click |
| 40 | 2714417..2714818 | PHAGE_Pseudo_vB_PaeS_PMG1: putative HNH endonuclease; PLES_25361; phage(gi374531741) | 3e-58 | Click |
| 41 | 2715031..2715411 | PHAGE_Pseudo_vB_PaeS_PMG1: terminase small subunit; PLES_25371; phage(gi374531646) | 4e-65 | Click |
| 42 | 2715413..2717104 | PHAGE_Pseudo_vB_PaeS_PMG1: terminase large subunit; PLES_25381; phage(gi374531647) | 0.0 | Click |
| 43 | 2717101..2717265 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25391; phage(gi374531648) | 1e-23 | Click |
| 44 | 2717258..2718520 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25401; phage(gi374531649) | 0.0 | Click |
| 45 | 2718652..2719542 | PHAGE_Pseudo_vB_PaeS_PMG1: Clp protease; PLES_25411; phage(gi374531650) | 2e-167 | Click |
| 46 | 2719539..2720726 | PHAGE_Pseudo_vB_PaeS_PMG1: major capsid protein; PLES_25421; phage(gi374531651) | 0.0 | Click |
| 47 | 2720893..2721489 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25431; phage(gi374531653) | 4e-110 | Click |
| 48 | 2721470..2721790 | PHAGE_Pseudo_vB_PaeS_PMG1: putative head-tail connector protein; PLES_25441; phage(gi374531654) | 3e-55 | Click |
| 49 | 2721791..2722147 | PHAGE_Pseudo_vB_PaeS_PMG1: putative head-tail adaptor; PLES_25451; phage(gi374531655) | 8e-57 | Click |
| 50 | 2722934..2723293 | PHAGE_Entero_epsilon15: hypothetical protein epsilon15p50; PLES_25461; phage(gi117371479) | 1e-35 | Click |
| 51 | 2723312..2724124 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25471; phage(gi374531657) | 2e-133 | Click |
| 52 | 2724135..2724692 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25481; phage(gi374531658) | 2e-97 | Click |
| 53 | 2724685..2725179 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25491; phage(gi374531659) | 3e-87 | Click |
| 54 | 2725182..2725547 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25501; phage(gi374531660) | 3e-64 | Click |
| 55 | complement(2725544..2726101) | PHAGE_Xantho_Xop411: p31.1; PLES_25511; phage(gi157933340) | 6e-28 | Click |
| 56 | 2726292..2726813 | PHAGE_Pseudo_vB_PaeS_PMG1: putative major tail protein; PLES_25521; phage(gi374531661) | 2e-97 | Click |
| 57 | 2726823..2727182 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25531; phage(gi374531662) | 1e-60 | Click |
| 58 | 2727188..2727460 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25541; phage(gi374531663) | 9e-43 | Click |
| 59 | 2727510..2729903 | PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; PLES_25551; phage(gi374531664) | 3e-89 | Click |
| 60 | 2729900..2730379 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25561; phage(gi374531665) | 7e-90 | Click |
| 61 | 2730363..2730854 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25571; phage(gi374531666) | 2e-90 | Click |
| 62 | 2730859..2731266 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25581; phage(gi374531669) | 3e-72 | Click |
| 63 | 2731238..2733967 | PHAGE_Pseudo_vB_PaeS_PMG1: putative tail protein; PLES_25591; phage(gi374531670) | 0.0 | Click |
| 64 | 2734027..2735715 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25601; phage(gi374531671) | 7e-45 | Click |
| 65 | 2735728..2737803 | PHAGE_Pseudo_vB_PaeS_PMG1: O-polysaccharide acetyltransferase protein; PLES_25611; phage(gi374531673) | 1e-64 | Click |
| 66 | 2737848..2738477 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PLES_25621; phage(gi148912826) | 7e-55 | Click |
| 67 | 2738552..2738800 | PHAGE_Rhodob_RcapMu: hypothetical protein; PLES_25631; phage(gi356870872) | 1e-17 | Click |
| 68 | 2738797..2739174 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25641; phage(gi374531677) | 3e-45 | Click |
| 69 | 2739536..2739799 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PLES_25651; phage(gi374531679) | 6e-44 | Click |
| 70 | complement(2739803..2740315) | PHAGE_Pseudo_F116: hypothetical protein F116p69; PLES_25661; phage(gi56692978) | 4e-88 | Click |
| 71 | 2740547..2740561 | attR CTTGAAAACCGTCGA | N/A | Click |
Region 7, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(4544321..4545145) | PHAGE_Parame_FR483: hypothetical protein FR483_N404R; PLES_41171; phage(gi155370502) | 1e-07 | Click |
| 2 | 4545082..4545094 | attL CCTCGCCGGCCAG | N/A | Click |
| 3 | complement(4545251..4546267) | PROPHAGE_Pseudo_PAO1: bacteriophage integrase; PLES_41181; phage(gi15595925) | 1e-94 | Click |
| 4 | complement(4546267..4547559) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p08; PLES_41191; phage(gi9625374) | 0.0 | Click |
| 5 | complement(4547817..4549079) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p07; PLES_41201; phage(gi9625373) | 2e-127 | Click |
| 6 | complement(4549081..4549431) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p06; PLES_41211; phage(gi9625372) | 2e-16 | Click |
| 7 | complement(4549441..4550565) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p05; PLES_41221; phage(gi9625371) | 1e-30 | Click |
| 8 | complement(4550705..4550923) | hypothetical protein; PLES_41231 | N/A | Click |
| 9 | complement(4550937..4551188) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p03; PLES_41241; phage(gi9625369) | 1e-17 | Click |
| 10 | complement(4551200..4551292) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p02; PLES_41242; phage(gi9625368) | 1e-10 | Click |
| 11 | complement(4551309..4551743) | PHAGE_Pseudo_Pf1: ssDNA binding protein; PLES_41251; phage(gi9625367) | 7e-79 | Click |
| 12 | complement(4551946..4552278) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p14; PLES_41261; phage(gi9625380) | 1e-55 | Click |
| 13 | complement(4552282..4552572) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p13; PLES_41271; phage(gi9625379) | 9e-56 | Click |
| 14 | complement(4552576..4552788) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p11; PLES_41281; phage(gi9625377) | 8e-33 | Click |
| 15 | 4553482..4555278 | PHAGE_Burkho_KS5: gp28; PLES_41291; phage(gi327198026) | 1e-04 | Click |
| 16 | 4555807..4556400 | PHAGE_Aeromo_65: hypothetical protein; PLES_41301; phage(gi326536530) | 2e-05 | Click |
| 17 | 4563204..4563216 | attR CCTCGCCGGCCAG | N/A | Click |