| Definition | Acinetobacter baumannii AB0057, complete genome. |
|---|---|
| Accession | NC_011586 |
| Length | 4,050,513 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 23 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1315286..1315630) | PHAGE_Entero_CC31: hypothetical protein; AB57_1226; phage(gi311993020) | 1e-06 | Click |
| 2 | complement(1315627..1316136) | hypothetical protein; AB57_1227 | N/A | Click |
| 3 | complement(1316133..1316669) | hypothetical protein; AB57_1228 | N/A | Click |
| 4 | complement(1316662..1316841) | hypothetical protein; AB57_1229 | N/A | Click |
| 5 | complement(1316842..1317003) | hypothetical protein; AB57_1230 | N/A | Click |
| 6 | complement(1317273..1318301) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1231; phage(gi423262039) | 9e-12 | Click |
| 7 | complement(1318314..1318994) | PHAGE_Entero_vB_KleM_RaK2: putative exonuclease; AB57_1232; phage(gi422937007) | 3e-12 | Click |
| 8 | complement(1319169..1319540) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1233; phage(gi423262041) | 2e-13 | Click |
| 9 | complement(1319537..1319866) | hypothetical protein; AB57_1234 | N/A | Click |
| 10 | complement(1319947..1320285) | PHAGE_Vibrio_VvAW1: hypothetical protein; AB57_1235; phage(gi460042912) | 5e-13 | Click |
| 11 | complement(1320480..1320764) | hypothetical protein; AB57_1236 | N/A | Click |
| 12 | complement(1320768..1321532) | PHAGE_Pseudo_F116: transcriptional regulator; AB57_1237; phage(gi56692918) | 1e-20 | Click |
| 13 | 1321668..1321871 | hypothetical protein; AB57_1238 | N/A | Click |
| 14 | 1321907..1322281 | hypothetical protein; AB57_1239 | N/A | Click |
| 15 | 1322315..1322515 | hypothetical protein; AB57_1240 | N/A | Click |
| 16 | 1322512..1322697 | hypothetical protein; AB57_1241 | N/A | Click |
| 17 | 1322694..1323149 | hypothetical protein; AB57_1242 | N/A | Click |
| 18 | 1323146..1323784 | PHAGE_Pseudo_F116: hypothetical protein F116p07; AB57_1243; phage(gi56692934) | 2e-31 | Click |
| 19 | 1323824..1324756 | PHAGE_Burkho_2: gp56; AB57_1244; phage(gi134288648) | 3e-76 | Click |
| 20 | 1324726..1325148 | hypothetical protein; AB57_1245 | N/A | Click |
| 21 | 1325145..1326623 | PHAGE_Pectob_ZF40: putative methylase; AB57_1246; phage(gi422936661) | 2e-96 | Click |
| 22 | 1326627..1327670 | PHAGE_Vibrio_VvAW1: hypothetical protein; AB57_1247; phage(gi460042921) | 7e-14 | Click |
| 23 | 1327667..1328431 | PHAGE_Acinet_Bphi_B1251: phage replication protein; AB57_1248; phage(gi423261990) | 7e-66 | Click |
Region 2, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1371140..1371152 | attL ATATAGGTAAATG | N/A | Click |
| 2 | 1384398..1384685 | PHAGE_Pseudo_F116: holin; AB57_1299; phage(gi56692925) | 4e-11 | Click |
| 3 | 1384682..1385452 | PHAGE_Vibrio_ICP1: putative Gp5 baseplate hub subunit and tail lysozyme; AB57_1300; phage(gi325171175) | 6e-18 | Click |
| 4 | complement(1385583..1385933) | hypothetical protein; AB57_1301 | N/A | Click |
| 5 | complement(1386049..1386744) | hypothetical protein; AB57_1302 | N/A | Click |
| 6 | complement(1386748..1387290) | PHAGE_Burkho_KL3: gp51; AB57_1303; phage(gi327198096) | 2e-14 | Click |
| 7 | complement(1387432..1388082) | hypothetical protein; AB57_1304 | N/A | Click |
| 8 | complement(1388237..1389535) | PHAGE_Cronob_ENT39118: DNA polymerase; AB57_1305; phage(gi431811050) | 2e-70 | Click |
| 9 | complement(1389532..1390032) | PHAGE_Cronob_ENT39118: protein umuD; AB57_1306; phage(gi431811072) | 3e-25 | Click |
| 10 | complement(1390174..1390809) | PHAGE_Burkho_KS9: hypothetical protein gp28; AB57_1307; phage(gi255033760) | 5e-27 | Click |
| 11 | complement(1390814..1391830) | hypothetical protein; AB57_1308 | N/A | Click |
| 12 | 1391909..1391921 | attR ATATAGGTAAATG | N/A | Click |
| 13 | complement(1391963..1392175) | hypothetical protein; AB57_1309 | N/A | Click |
| 14 | complement(1392209..1393414) | PHAGE_Entero_cdtI: Phage integrase; AB57_1310; phage(gi148609414) | 6e-101 | Click |
Region 3, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1468133..1468675 | PHAGE_Pectob_ZF40: putative transposase; AB57_1386; phage(gi422936679) | 6e-46 | Click |
| 2 | 1468929..1469204 | PHAGE_Acinet_Bphi_B1251: phage protein; AB57_1387; phage(gi423261999) | 6e-10 | Click |
| 3 | 1469215..1470672 | PHAGE_Xantho_vB_XveM_DIBBI: terminase large subunit; AB57_1388; phage(gi389060404) | 8e-89 | Click |
| 4 | 1470681..1472015 | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_1389; phage(gi472339823) | 1e-85 | Click |
| 5 | 1472275..1472772 | PHAGE_Psychr_pOW20_A: phage head morphogenesis protein; AB57_1390; phage(gi472339824) | 8e-44 | Click |
| 6 | 1472852..1473040 | hypothetical protein; AB57_1391 | N/A | Click |
| 7 | 1473081..1473713 | hypothetical protein; AB57_1392 | N/A | Click |
| 8 | 1473767..1474966 | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_1393; phage(gi472339828) | 9e-62 | Click |
| 9 | 1474985..1475455 | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_1394; phage(gi472339829) | 1e-21 | Click |
| 10 | 1475459..1475950 | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_1395; phage(gi472339830) | 9e-13 | Click |
| 11 | 1475947..1476945 | fibronectin type III domain protein; AB57_1396 | N/A | Click |
| 12 | complement(1477006..1477992) | PHAGE_Bacill_SPO1: gp19.1; AB57_1397; phage(gi209972930) | 2e-18 | Click |
| 13 | 1478143..1478532 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1398; phage(gi423262030) | 9e-67 | Click |
| 14 | 1478678..1479424 | hypothetical protein; AB57_1399 | N/A | Click |
| 15 | 1479499..1479636 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1400; phage(gi423262031) | 5e-08 | Click |
| 16 | 1479633..1479896 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1401; phage(gi423262031) | 4e-35 | Click |
| 17 | 1479898..1480044 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_1402; phage(gi423262031) | 8e-20 | Click |
Region 4, total : 37 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2760640..2761194) | PHAGE_Acinet_AP22: putative endolysin/autolysin; AB57_2671; phage(gi388570824) | 1e-82 | Click |
| 2 | complement(2761184..2761402) | hypothetical protein; AB57_2672 | N/A | Click |
| 3 | complement(2761399..2761755) | hypothetical protein; AB57_2673 | N/A | Click |
| 4 | complement(2761822..2765268) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2674; phage(gi423262029) | 0.0 | Click |
| 5 | complement(2765261..2765623) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2675; phage(gi423262028) | 6e-51 | Click |
| 6 | complement(2765620..2766126) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2676; phage(gi423262027) | 2e-92 | Click |
| 7 | complement(2766126..2766296) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2677; phage(gi423262026) | 1e-25 | Click |
| 8 | complement(2766289..2766525) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2678; phage(gi423262026) | 3e-29 | Click |
| 9 | complement(2766661..2767368) | hypothetical protein; AB57_2679 | N/A | Click |
| 10 | complement(2767395..2768039) | hypothetical protein; AB57_2680 | N/A | Click |
| 11 | complement(2768029..2768760) | hypothetical protein; AB57_2681 | N/A | Click |
| 12 | complement(2769229..2773536) | PHAGE_Acinet_Bphi_B1251: tail tape measure protein; AB57_2682; phage(gi423262023) | 5e-165 | Click |
| 13 | complement(2773908..2774396) | hypothetical protein; AB57_2683 | N/A | Click |
| 14 | 2774959..2775888 | PHAGE_Escher_TL_2011c: hypothetical protein; AB57_2684; phage(gi418487090) | 4e-32 | Click |
| 15 | complement(2776003..2776695) | hypothetical protein; AB57_2685 | N/A | Click |
| 16 | complement(2777264..2777779) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2686; phage(gi423262018) | 2e-91 | Click |
| 17 | complement(2777849..2778766) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2687; phage(gi423262017) | 2e-157 | Click |
| 18 | complement(2778862..2779959) | PHAGE_Acinet_Bphi_B1251: putative tail fiber; AB57_2688; phage(gi423262016) | 2e-70 | Click |
| 19 | complement(2779959..2780309) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2689; phage(gi423262015) | 9e-56 | Click |
| 20 | complement(2780405..2780623) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2690; phage(gi423262014) | 2e-31 | Click |
| 21 | complement(2780625..2781068) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2691; phage(gi423262013) | 5e-62 | Click |
| 22 | complement(2781025..2781393) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2692; phage(gi423262012) | 2e-47 | Click |
| 23 | complement(2781365..2781769) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2693; phage(gi423262011) | 5e-68 | Click |
| 24 | complement(2781778..2782191) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2694; phage(gi423262010) | 3e-72 | Click |
| 25 | complement(2782148..2782537) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2695; phage(gi423262009) | 3e-68 | Click |
| 26 | complement(2782542..2783207) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2696; phage(gi423262008) | 9e-117 | Click |
| 27 | complement(2783272..2784228) | PHAGE_Acinet_Bphi_B1251: major capsid protein; AB57_2697; phage(gi423262007) | 4e-178 | Click |
| 28 | complement(2784256..2785023) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2698; phage(gi423262006) | 2e-144 | Click |
| 29 | complement(2785137..2785328) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2699; phage(gi423262005) | 8e-31 | Click |
| 30 | complement(2785546..2785788) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2700; phage(gi423262004) | 8e-41 | Click |
| 31 | complement(2785887..2786165) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2701; phage(gi423262003) | 2e-47 | Click |
| 32 | complement(2786326..2787429) | PHAGE_Acinet_Bphi_B1251: phage putative head morphogenesis protein; AB57_2702; phage(gi423262002) | 0.0 | Click |
| 33 | complement(2787431..2788882) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2703; phage(gi423262001) | 0.0 | Click |
| 34 | complement(2788879..2790231) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2704; phage(gi423262000) | 0.0 | Click |
| 35 | complement(2790296..2790766) | PHAGE_Acinet_Bphi_B1251: phage protein; AB57_2705; phage(gi423261999) | 8e-85 | Click |
| 36 | complement(2790825..2791466) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2706; phage(gi423261998) | 5e-125 | Click |
| 37 | complement(2791435..2791869) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2707; phage(gi423261997) | 1e-73 | Click |
Region 5, total : 34 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2785201..2785212 | attL GATTTTTCAGGC | N/A | Click |
| 2 | complement(2796165..2796557) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2713; phage(gi423261993) | 4e-37 | Click |
| 3 | complement(2796554..2796706) | hypothetical protein; AB57_2714 | N/A | Click |
| 4 | complement(2796856..2797305) | hypothetical protein; AB57_2715 | N/A | Click |
| 5 | complement(2797309..2797641) | hypothetical protein; AB57_2716 | N/A | Click |
| 6 | complement(2797634..2797819) | hypothetical protein; AB57_2717 | N/A | Click |
| 7 | complement(2797947..2798063) | hypothetical protein; AB57_2718 | N/A | Click |
| 8 | complement(2798056..2798367) | hypothetical protein; AB57_2719 | N/A | Click |
| 9 | complement(2798364..2798540) | hypothetical protein; AB57_2720 | N/A | Click |
| 10 | complement(2798537..2798704) | hypothetical protein; AB57_2721 | N/A | Click |
| 11 | complement(2798785..2800110) | PHAGE_Acinet_AP22: putative replicative DNA helicase; AB57_2722; phage(gi388570844) | 7e-61 | Click |
| 12 | complement(2800110..2800853) | PHAGE_Acinet_AP22: hypothetical protein; AB57_2723; phage(gi388570843) | 2e-23 | Click |
| 13 | complement(2800850..2801023) | PHAGE_Acinet_AP22: hypothetical protein; AB57_2724; phage(gi388570842) | 3e-05 | Click |
| 14 | complement(2800986..2801168) | hypothetical protein; AB57_2725 | N/A | Click |
| 15 | complement(2801220..2801486) | hypothetical protein; AB57_2726 | N/A | Click |
| 16 | complement(2801497..2801727) | regulator protein, putative; AB57_2727 | N/A | Click |
| 17 | 2801851..2802597 | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_2728; phage(gi472339799) | 5e-23 | Click |
| 18 | 2802613..2802816 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_2729; phage(gi423261982) | 5e-30 | Click |
| 19 | 2802962..2803471 | hypothetical protein; AB57_2730 | N/A | Click |
| 20 | complement(2803899..2804114) | hypothetical protein; AB57_2731 | N/A | Click |
| 21 | 2804317..2804694 | PHAGE_Acinet_AP22: hypothetical protein; AB57_2732; phage(gi388570833) | 6e-15 | Click |
| 22 | 2804714..2804980 | hypothetical protein; AB57_2733 | N/A | Click |
| 23 | 2804980..2805270 | hypothetical protein; AB57_2734 | N/A | Click |
| 24 | 2805280..2806131 | PHAGE_Synech_S_CBS1: exonuclease VIII; AB57_2735; phage(gi356870827) | 3e-36 | Click |
| 25 | 2806134..2807030 | hypothetical protein; AB57_2736 | N/A | Click |
| 26 | 2807035..2807292 | PHAGE_Acinet_AP22: hypothetical protein; AB57_2737; phage(gi388570801) | 8e-06 | Click |
| 27 | 2807289..2807552 | hypothetical protein; AB57_2738 | N/A | Click |
| 28 | 2807564..2807905 | PHAGE_Acinet_AP22: hypothetical protein; AB57_2739; phage(gi388570773) | 1e-23 | Click |
| 29 | 2807902..2808111 | PHAGE_Acinet_AP22: hypothetical protein; AB57_2740; phage(gi388570775) | 2e-31 | Click |
| 30 | 2808108..2808323 | hypothetical protein; AB57_2741 | N/A | Click |
| 31 | 2808270..2808281 | attR GATTTTTCAGGC | N/A | Click |
| 32 | 2808335..2808604 | hypothetical protein; AB57_2743 | N/A | Click |
| 33 | complement(2808601..2809587) | PHAGE_Mannhe_phiMHaA1: integrase; AB57_2742; phage(gi109289985) | 7e-57 | Click |
| 34 | 2809885..2810820 | PHAGE_Amsact_: putative ATP-binding cassette transporter; AB57_2744; phage(gi9964444) | 4e-18 | Click |
| 35 | 2810817..2811590 | ABC transporter permease protein; AB57_2745 | N/A | Click |
| 36 | 2811587..2812399 | PHAGE_Vibrio_KVP40: GTP cyclohydrolase I family protein; AB57_2746; phage(gi34419358) | 6e-39 | Click |
Region 6, total : 67 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3311832..3311852 | attL TTCGAGTCCCGCAGGGCGCAC | N/A | Click |
| 2 | 3312021..3313265 | PHAGE_Stenot_S1: putative integrase; AB57_3187; phage(gi213163927) | 8e-85 | Click |
| 3 | complement(3313258..3313455) | hypothetical protein; AB57_3186 | N/A | Click |
| 4 | 3313593..3313997 | hypothetical protein; AB57_3188 | N/A | Click |
| 5 | 3314038..3314544 | hypothetical protein; AB57_3189 | N/A | Click |
| 6 | 3314664..3314930 | hypothetical protein; AB57_3190 | N/A | Click |
| 7 | complement(3315136..3315678) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3191; phage(gi423262031) | 2e-91 | Click |
| 8 | complement(3315681..3316070) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3192; phage(gi423262030) | 9e-61 | Click |
| 9 | complement(3316139..3319585) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3193; phage(gi423262029) | 0.0 | Click |
| 10 | complement(3319578..3319691) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3194; phage(gi423262028) | 3e-15 | Click |
| 11 | complement(3319937..3320443) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3195; phage(gi423262027) | 2e-92 | Click |
| 12 | complement(3320443..3320841) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3196; phage(gi423262026) | 4e-74 | Click |
| 13 | complement(3320892..3325550) | PHAGE_Acinet_Bphi_B1251: tail tape measure protein; AB57_3197; phage(gi423262023) | 0.0 | Click |
| 14 | complement(3325552..3325665) | PHAGE_Acinet_Bphi_B1251: tail tape measure protein; AB57_3198; phage(gi423262023) | 4e-06 | Click |
| 15 | complement(3325647..3325784) | PHAGE_Acinet_Bphi_B1251: tail tape measure protein; AB57_3199; phage(gi423262023) | 3e-05 | Click |
| 16 | complement(3325845..3326192) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3200; phage(gi423262018) | 9e-05 | Click |
| 17 | complement(3326244..3326363) | hypothetical protein; AB57_3201 | N/A | Click |
| 18 | complement(3326523..3327524) | PHAGE_Entero_SfV: hypothetical protein SfVp44; AB57_3202; phage(gi19549031) | 3e-23 | Click |
| 19 | complement(3327521..3327691) | hypothetical protein; AB57_3203 | N/A | Click |
| 20 | 3327807..3328118 | PHAGE_Salmon_SPN3UB: Arc-like DNA binding domain protein; AB57_3204; phage(gi423262396) | 2e-05 | Click |
| 21 | complement(3328132..3328875) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3205; phage(gi423262021) | 3e-32 | Click |
| 22 | complement(3328937..3329320) | PHAGE_Acinet_Bphi_B1251: putative lipoprotein; AB57_3206; phage(gi423262022) | 2e-47 | Click |
| 23 | complement(3329353..3329676) | PHAGE_Clostr_st: hypothetical protein CST198; AB57_3207; phage(gi80159884) | 8e-12 | Click |
| 24 | complement(3329967..3330425) | helix-turn-helix domain protein; AB57_3208 | N/A | Click |
| 25 | complement(3330434..3330733) | hypothetical protein; AB57_3209 | N/A | Click |
| 26 | complement(3331236..3331751) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3210; phage(gi423262018) | 6e-90 | Click |
| 27 | complement(3331821..3332738) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3211; phage(gi423262017) | 2e-157 | Click |
| 28 | complement(3332834..3333931) | PHAGE_Acinet_Bphi_B1251: putative tail fiber; AB57_3212; phage(gi423262016) | 2e-70 | Click |
| 29 | complement(3333931..3334281) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3213; phage(gi423262015) | 9e-56 | Click |
| 30 | complement(3334377..3334595) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3214; phage(gi423262014) | 2e-31 | Click |
| 31 | complement(3334597..3335364) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3215; phage(gi423262013) | 3e-63 | Click |
| 32 | complement(3335406..3335936) | hypothetical protein; AB57_3216 | N/A | Click |
| 33 | complement(3335998..3336366) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3217; phage(gi423262010) | 1e-64 | Click |
| 34 | complement(3336366..3336746) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3218; phage(gi423262009) | 4e-17 | Click |
| 35 | complement(3336750..3337106) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3219; phage(gi423262008) | 2e-11 | Click |
| 36 | complement(3337151..3338101) | PHAGE_Entero_phiFL3A: coat protein; AB57_3220; phage(gi281416261) | 9e-99 | Click |
| 37 | complement(3338115..3338870) | PHAGE_Caulob_CcrColossus: hypothetical protein; AB57_3221; phage(gi414088136) | 5e-18 | Click |
| 38 | complement(3338979..3339293) | PHAGE_Burkho_BcepMigl: hypothetical protein; AB57_3222; phage(gi431809906) | 4e-10 | Click |
| 39 | complement(3339345..3339497) | hypothetical protein; AB57_3223 | N/A | Click |
| 40 | complement(3339513..3339743) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3224; phage(gi423262004) | 7e-16 | Click |
| 41 | complement(3339740..3340846) | PHAGE_Acinet_Bphi_B1251: phage putative head morphogenesis protein; AB57_3225; phage(gi423262002) | 0.0 | Click |
| 42 | complement(3340856..3342196) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3226; phage(gi423262001) | 2e-40 | Click |
| 43 | complement(3342236..3343207) | PHAGE_Pseudo_H105/1: phage terminase large subunit; AB57_3227; phage(gi327198525) | 1e-75 | Click |
| 44 | complement(3343488..3344003) | PHAGE_Acinet_Bphi_B1251: phage protein; AB57_3228; phage(gi423261999) | 6e-32 | Click |
| 45 | complement(3344062..3344703) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3229; phage(gi423261998) | 2e-113 | Click |
| 46 | complement(3344672..3345139) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3230; phage(gi423261997) | 6e-40 | Click |
| 47 | complement(3345181..3345384) | hypothetical protein; AB57_3231 | N/A | Click |
| 48 | complement(3345441..3345923) | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_3232; phage(gi472339815) | 8e-24 | Click |
| 49 | complement(3345981..3346691) | hypothetical protein; AB57_3233 | N/A | Click |
| 50 | complement(3346691..3346816) | hypothetical protein; AB57_3234 | N/A | Click |
| 51 | complement(3347332..3347607) | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_3235; phage(gi472339814) | 4e-20 | Click |
| 52 | complement(3347899..3347975) | tRNA | N/A | Click |
| 53 | complement(3348307..3348843) | hypothetical protein; AB57_3236 | N/A | Click |
| 54 | complement(3349134..3349808) | PHAGE_Entero_HK225: NinI protein; AB57_3237; phage(gi428782438) | 2e-40 | Click |
| 55 | complement(3349818..3350243) | PHAGE_Psychr_pOW20_A: hypothetical protein; AB57_3238; phage(gi472339811) | 4e-15 | Click |
| 56 | complement(3350240..3350797) | PHAGE_Acinet_AP22: hypothetical protein; AB57_3239; phage(gi388570793) | 6e-49 | Click |
| 57 | complement(3351208..3351393) | hypothetical protein; AB57_3240 | N/A | Click |
| 58 | complement(3351459..3351638) | hypothetical protein; AB57_3241 | N/A | Click |
| 59 | complement(3351631..3351996) | hypothetical protein; AB57_3242 | N/A | Click |
| 60 | complement(3351993..3352649) | PHAGE_Cyanop_9515_10a: gp12; AB57_3243; phage(gi372217724) | 5e-45 | Click |
| 61 | complement(3352646..3352822) | hypothetical protein; AB57_3244 | N/A | Click |
| 62 | complement(3352819..3352986) | hypothetical protein; AB57_3245 | N/A | Click |
| 63 | complement(3353067..3354392) | PHAGE_Acinet_AP22: putative replicative DNA helicase; AB57_3246; phage(gi388570844) | 7e-58 | Click |
| 64 | complement(3354392..3355285) | PHAGE_Bacill_PM1: hypothetical protein; AB57_3247; phage(gi472438259) | 1e-39 | Click |
| 65 | complement(3355282..3355449) | PHAGE_Acinet_AP22: hypothetical protein; AB57_3248; phage(gi388570842) | 6e-10 | Click |
| 66 | complement(3355545..3355811) | hypothetical protein; AB57_3249 | N/A | Click |
| 67 | complement(3355808..3355984) | hypothetical protein; AB57_3250 | N/A | Click |
| 68 | 3356112..3356894 | PHAGE_Acinet_Bphi_B1251: putative repressor protein; AB57_3251; phage(gi423261983) | 2e-102 | Click |
| 69 | 3356909..3357124 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; AB57_3252; phage(gi423261982) | 6e-33 | Click |
| 70 | 3364656..3364676 | attR TTCGAGTCCCGCAGGGCGCAC | N/A | Click |