| Definition | Stenotrophomonas maltophilia K279a chromosome, complete genome. |
|---|---|
| Accession | NC_010943 |
| Length | 4,851,126 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 11 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 55179..55204 | attL CTGCCGGCCAGCGGCCGGCACTACCG | N/A | Click |
| 2 | 60466..61656 | PHAGE_Stenot_S1: putative integrase; Smlt0056; phage(gi213163927) | 5e-116 | Click |
| 3 | 62251..62523 | PHAGE_Entero_P4: transcriptional regulator; Smlt0057; phage(gi9627517) | 6e-10 | Click |
| 4 | 62520..62723 | hypothetical protein; Smlt0058 | N/A | Click |
| 5 | 62733..63020 | PHAGE_Burkho_KL3: gp9; Smlt0059; phage(gi327198054) | 4e-09 | Click |
| 6 | 63050..63526 | hypothetical protein; Smlt0060 | N/A | Click |
| 7 | 63523..63738 | hypothetical protein; Smlt0061 | N/A | Click |
| 8 | 63735..64385 | hypothetical protein; Smlt0062 | N/A | Click |
| 9 | 64372..65223 | PHAGE_Entero_P4: DNA primase; Smlt0063; phage(gi9627512) | 2e-18 | Click |
| 10 | 65282..67132 | PHAGE_Thermo_THSA_485A: protein of unknown function DUF927; Smlt0064; phage(gi397912648) | 2e-15 | Click |
| 11 | 67166..67954 | hypothetical protein; Smlt0065 | N/A | Click |
| 12 | 67990..68991 | PHAGE_Pseudo_phiCTX: predicted capsid packaging protein; Smlt0066; phage(gi17313219) | 3e-121 | Click |
| 13 | 78328..78353 | attR CTGCCGGCCAGCGGCCGGCACTACCG | N/A | Click |
Region 2, total : 44 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 299939..299950 | attL ACCGGGAAAATT | N/A | Click |
| 2 | complement(299949..301127) | PROPHAGE_Xantho_306: phage-related integrase; Smlt0285; phage(gi21243357) | 2e-123 | Click |
| 3 | complement(301127..301351) | hypothetical protein; Smlt0286 | N/A | Click |
| 4 | complement(301699..302004) | hypothetical protein; Smlt0287 | N/A | Click |
| 5 | complement(302179..302604) | hypothetical protein; Smlt0288 | N/A | Click |
| 6 | complement(302681..302959) | hypothetical protein; Smlt0289 | N/A | Click |
| 7 | complement(302956..305652) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp40; Smlt0290; phage(gi17313257) | 0.0 | Click |
| 8 | complement(306023..306484) | hypothetical protein; Smlt0291 | N/A | Click |
| 9 | complement(306894..307100) | hypothetical protein; Smlt0293 | N/A | Click |
| 10 | complement(307169..307486) | PHAGE_Burkho_phiE202: gp19, conserved hypothetical protein; Smlt0294; phage(gi134288771) | 3e-05 | Click |
| 11 | complement(307510..307842) | PHAGE_Burkho_BcepMu: gp16; Smlt0295; phage(gi48696926) | 2e-05 | Click |
| 12 | 307912..308343 | PHAGE_Burkho_phiE202: gp21; Smlt0296; phage(gi134288765) | 2e-16 | Click |
| 13 | 308630..309400 | hypothetical protein; Smlt0297 | N/A | Click |
| 14 | 309586..310977 | hypothetical protein; Smlt0298 | N/A | Click |
| 15 | complement(310974..311966) | PHAGE_Burkho_phiE202: gp24, fels-2 prophage protein; Smlt0299; phage(gi134288767) | 1e-92 | Click |
| 16 | complement(311963..312361) | PHAGE_Burkho_phiE202: gp25, fels-2 prophage protein; Smlt0300; phage(gi134288777) | 2e-30 | Click |
| 17 | complement(312373..315237) | PHAGE_Salmon_ST64B: tail protein; Smlt0301; phage(gi23505460) | 6e-108 | Click |
| 18 | complement(315263..315379) | PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; Smlt0302; phage(gi134288776) | 2e-07 | Click |
| 19 | complement(315388..315714) | PHAGE_Entero_2: P2 gpE-like tail protein; Smlt0303; phage(gi169936023) | 9e-19 | Click |
| 20 | complement(315770..316279) | PHAGE_Burkho_phiE202: gp29, phage major tail tube protein; Smlt0304; phage(gi134288759) | 3e-50 | Click |
| 21 | complement(316300..317469) | PHAGE_Erwini_ENT90: tail sheath protein; Smlt0305; phage(gi431810939) | 6e-140 | Click |
| 22 | complement(317485..317835) | PHAGE_Pseudo_phiCTX: predicted baseplate; Smlt0306; phage(gi17313236) | 7e-29 | Click |
| 23 | complement(317832..318380) | PHAGE_Burkho_phiE202: gp36, gpV; Smlt0307; phage(gi134288750) | 2e-30 | Click |
| 24 | complement(318467..318748) | PHAGE_Synech_S_CRM01: tail fiber assembly-like protein; Smlt0308; phage(gi333798178) | 5e-11 | Click |
| 25 | complement(318758..319990) | PHAGE_Burkho_KS5: gp23; Smlt0309; phage(gi327198021) | 1e-54 | Click |
| 26 | complement(319995..320546) | PHAGE_Burkho_phiE202: gp33, phage tail protein I; Smlt0310; phage(gi134288744) | 1e-45 | Click |
| 27 | complement(320539..321429) | PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; Smlt0311; phage(gi28198989) | 6e-81 | Click |
| 28 | complement(321516..321977) | PHAGE_Burkho_phiE202: gp39, phage virion morphogenesis protein; Smlt0312; phage(gi134288746) | 2e-35 | Click |
| 29 | complement(321974..322459) | PHAGE_Pseudo_phiCTX: predicted tail completion; Smlt0313; phage(gi17313232) | 3e-30 | Click |
| 30 | complement(322456..322980) | PHAGE_Burkho_KS5: gp32; Smlt0314; phage(gi327198030) | 8e-31 | Click |
| 31 | complement(322980..323615) | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; Smlt0315; phage(gi148912826) | 2e-39 | Click |
| 32 | complement(323617..323892) | PHAGE_Burkho_phiE202: gp44, putative bacteriophage membrane protein; Smlt0316; phage(gi134288752) | 6e-09 | Click |
| 33 | complement(323885..324238) | PHAGE_Burkho_phiE202: gp45, putative bacteriophage membrane protein; Smlt0317; phage(gi134288749) | 8e-23 | Click |
| 34 | complement(324241..324456) | PHAGE_Burkho_phiE202: gp46, phage Tail Protein X; Smlt0318; phage(gi134288782) | 1e-13 | Click |
| 35 | complement(324456..324923) | PHAGE_Burkho_phiE202: gp48, phage head completion protein (GPL); Smlt0319; phage(gi134288751) | 6e-32 | Click |
| 36 | complement(325028..325735) | PHAGE_Burkho_phiE202: gp1, phage terminase, endonuclease subunit; Smlt0320; phage(gi134288748) | 8e-42 | Click |
| 37 | complement(325739..326755) | PHAGE_Burkho_phiE202: gp2, phage major capsid protein, P2 family; Smlt0321; phage(gi134288740) | 6e-114 | Click |
| 38 | complement(326789..327652) | PHAGE_Pseudo_phiCTX: presumed capsid scaffold; Smlt0322; phage(gi17313221) | 6e-54 | Click |
| 39 | 327771..329564 | PHAGE_Burkho_phiE202: gp4, phage terminase, ATPase subunit; Smlt0323; phage(gi134288784) | 0.0 | Click |
| 40 | 329564..330574 | PHAGE_Burkho_phiE202: gp5, phage portal protein, pbsx family; Smlt0324; phage(gi134288763) | 3e-106 | Click |
| 41 | 330746..331456 | PHAGE_Burkho_phiE202: gp37, DNA methylase; Smlt0325; phage(gi134288786) | 2e-53 | Click |
| 42 | 332227..332523 | hypothetical protein; Smlt0327 | N/A | Click |
| 43 | 332777..333241 | hypothetical protein; Smlt0328 | N/A | Click |
| 44 | complement(333316..334077) | PHAGE_Burkho_phiE202: gp9, Cpp15; Smlt0329; phage(gi134288743) | 5e-81 | Click |
| 45 | complement(334344..334940) | PHAGE_Burkho_DC1: integrase; Smlt0330; phage(gi401723020) | 2e-12 | Click |
| 46 | 335333..335344 | attR ACCGGGAAAATT | N/A | Click |
Region 3, total : 9 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 846502..846521 | attL ATCCACGCCATGCGTGGATG | N/A | Click |
| 2 | 848847..850007 | PHAGE_Lactob_KC5a: putative minor tail protein; Smlt0806; phage(gi90592623) | 7e-06 | Click |
| 3 | 850181..850702 | PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; Smlt0807; phage(gi17546156) | 7e-27 | Click |
| 4 | 850699..851532 | PROPHAGE_Escher_MG1655: IS150 transposase B; Smlt0808; phage(gi16131429) | 8e-87 | Click |
| 5 | 851995..852615 | LemA family protein; Smlt0809 | N/A | Click |
| 6 | 852619..853512 | PHAGE_Human__2: EBNA-1; Smlt0810; phage(gi139424506) | 7e-13 | Click |
| 7 | 853512..854006 | hypothetical protein; Smlt0811 | N/A | Click |
| 8 | 854058..854945 | prolipoprotein diacylglyceryl transferase; Smlt0812 | N/A | Click |
| 9 | 854942..855736 | PHAGE_Bacter_8: putatitve thymidylate synthase; Smlt0813; phage(gi200003972) | 9e-93 | Click |
| 10 | 855742..856233 | PHAGE_Bacill_phiAGATE: putative dihydrofolate reductase; Smlt0814; phage(gi448260875) | 6e-27 | Click |
| 11 | 868954..868973 | attR ATCCACGCCATGCGTGGATG | N/A | Click |
Region 4, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1091933..1092598 | PHAGE_Pseudo_EL: putative thymidylate kinase; Smlt1035; phage(gi82701134) | 1e-27 | Click |
| 2 | 1092595..1093551 | PHAGE_Strept_Dp_1: DnaX DNA polymerase III clamp loader complex gamma-tau-delta subunit; Smlt1036; phage(gi327198331) | 1e-10 | Click |
| 3 | 1093548..1093901 | putative pilus biogenesis protein PilZ; Smlt1037 | N/A | Click |
| 4 | 1094014..1094088 | tRNA | N/A | Click |
| 5 | 1094321..1094701 | putative tautomerase; Smlt1038 | N/A | Click |
| 6 | complement(1094732..1095799) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp30; Smlt1039; phage(gi17313247) | 6e-45 | Click |
| 7 | complement(1095796..1096011) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp09; Smlt1040; phage(gi17313226) | 2e-09 | Click |
| 8 | 1095883..1095898 | attL GCCGCGTGCGGCCAGG | N/A | Click |
| 9 | complement(1095995..1096462) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp29; Smlt1041; phage(gi17313246) | 1e-18 | Click |
| 10 | complement(1096465..1098912) | PHAGE_Erwini_ENT90: phage tail measure protein; Smlt1042; phage(gi431810935) | 8e-31 | Click |
| 11 | complement(1099033..1099323) | hypothetical protein; Smlt1043 | N/A | Click |
| 12 | complement(1099404..1099907) | PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; Smlt1044; phage(gi428782747) | 3e-26 | Click |
| 13 | complement(1099910..1101112) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp24; Smlt1045; phage(gi17313241) | 2e-67 | Click |
| 14 | complement(1101219..1101878) | PHAGE_Mycoba_Tweety: gp54; Smlt1046; phage(gi157311243) | 7e-05 | Click |
| 15 | complement(1101880..1103847) | PHAGE_Burkho_KS14: gp18; Smlt1047; phage(gi327198287) | 4e-47 | Click |
| 16 | complement(1103855..1104634) | PROPHAGE_Xylell_Temecula1: phage-related tail protein; Smlt1048; phage(gi28198988) | 2e-49 | Click |
| 17 | complement(1104627..1105523) | PROPHAGE_Xylell_Temecula1: phage-related baseplate assembly protein; Smlt1049; phage(gi28198989) | 2e-86 | Click |
| 18 | complement(1105526..1105864) | PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; Smlt1050; phage(gi428782737) | 5e-28 | Click |
| 19 | complement(1105917..1106507) | PHAGE_Pseudo_phiCTX: predicted baseplate; Smlt1051; phage(gi17313235) | 5e-20 | Click |
| 20 | complement(1106504..1107058) | putative phage-like protein; Smlt1052 | N/A | Click |
| 21 | complement(1107412..1107789) | hypothetical protein; Smlt1053 | N/A | Click |
| 22 | complement(1107786..1108271) | PHAGE_Salmon_E1: lysozyme; Smlt1054; phage(gi170676283) | 2e-41 | Click |
| 23 | complement(1108268..1108618) | hypothetical protein; Smlt1055 | N/A | Click |
| 24 | complement(1108615..1108974) | hypothetical protein; Smlt1056 | N/A | Click |
| 25 | complement(1109399..1109782) | hypothetical protein; Smlt1057 | N/A | Click |
| 26 | complement(1109935..1110573) | PHAGE_Acanth_mimivirus: putative deoxynucleotide monophosphate kinase; Smlt1058; phage(gi311977904) | 5e-15 | Click |
| 27 | complement(1110615..1110842) | hypothetiacl protein; Smlt1059 | N/A | Click |
| 28 | complement(1110917..1111192) | putative regulatory protein; Smlt1060 | N/A | Click |
| 29 | 1111007..1111022 | attR GCCGCGTGCGGCCAGG | N/A | Click |
| 30 | complement(1111193..1113529) | PHAGE_Salico_CGphi29: hypothetical protein; Smlt1061; phage(gi472340164) | 9e-32 | Click |
Region 5, total : 35 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1896567..1896578 | attL GCTGGAAGCGGC | N/A | Click |
| 2 | 1896736..1897587 | PROPHAGE_Xantho_33913: ISxac3 transposase; Smlt1846; phage(gi21231086) | 5e-108 | Click |
| 3 | 1897693..1898142 | hypothetical protein; Smlt1846A | N/A | Click |
| 4 | 1898135..1899376 | hypothetical protein; Smlt1846B | N/A | Click |
| 5 | complement(1900286..1900516) | putative transmembrane protein; Smlt1849 | N/A | Click |
| 6 | complement(1900667..1901125) | hypothetical protein; Smlt1849A | N/A | Click |
| 7 | complement(1901439..1901939) | PHAGE_Burkho_KS5: gp32; Smlt1850; phage(gi327198030) | 2e-32 | Click |
| 8 | complement(1901936..1902439) | PHAGE_Burkho_BcepMigl: SAR endolysin; Smlt1851; phage(gi431809930) | 2e-21 | Click |
| 9 | complement(1902660..1902962) | putative transmembrane protein; Smlt1852 | N/A | Click |
| 10 | complement(1903026..1903376) | PHAGE_Burkho_BcepNazgul: tail fiber protein; Smlt1853; phage(gi34610150) | 2e-20 | Click |
| 11 | complement(1903376..1905649) | PHAGE_Pseudo_MP1412: tail assembly structural protein; Smlt1854; phage(gi399529038) | 8e-119 | Click |
| 12 | complement(1905649..1905861) | PHAGE_Pseudo_B3: hypothetical protein B3ORF55; Smlt1855; phage(gi56692624) | 3e-11 | Click |
| 13 | complement(1905858..1906085) | PHAGE_Pseudo_MP1412: tail assembly structural protein; Smlt1856; phage(gi399529036) | 8e-22 | Click |
| 14 | complement(1906105..1906893) | PHAGE_Pseudo_MP1412: tail assembly structural protein; Smlt1857; phage(gi399529035) | 7e-27 | Click |
| 15 | complement(1906896..1908371) | PHAGE_Burkho_AH2: tail assembly protein; Smlt1858; phage(gi399529093) | 1e-07 | Click |
| 16 | complement(1908455..1909513) | PHAGE_Tetras_SI1: hypothetical protein; Smlt1859; phage(gi472342236) | 3e-17 | Click |
| 17 | complement(1909519..1912215) | PHAGE_Synech_S_CBS1: tail tape measure protein; Smlt1860; phage(gi356870809) | 6e-36 | Click |
| 18 | complement(1912215..1912856) | hypothetical protein; Smlt1861 | N/A | Click |
| 19 | complement(1913046..1913450) | PHAGE_Pseudo_JBD24: hypothetical protein; Smlt1862; phage(gi448245092) | 4e-05 | Click |
| 20 | complement(1913447..1914199) | PHAGE_Pseudo_MP38: hypothetical protein PPMP38_gp39; Smlt1863; phage(gi215479963) | 1e-36 | Click |
| 21 | complement(1914202..1914390) | hypothetical protein; Smlt1864 | N/A | Click |
| 22 | complement(1914398..1914889) | PHAGE_Synech_S_CBS1: hypothetical protein; Smlt1865; phage(gi356870805) | 3e-07 | Click |
| 23 | complement(1915118..1916122) | PHAGE_Entero_01: major capsid protein; Smlt1866; phage(gi38707831) | 4e-35 | Click |
| 24 | complement(1916125..1916502) | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; Smlt1867; phage(gi428782730) | 5e-09 | Click |
| 25 | complement(1916504..1917712) | PHAGE_Burkho_phiE125: putative capsid assembly protein/protease; Smlt1868; phage(gi17975166) | 1e-54 | Click |
| 26 | complement(1917723..1919210) | PHAGE_Synech_S_CBS1: lambda-like phage portal protein; Smlt1869; phage(gi356870797) | 2e-64 | Click |
| 27 | complement(1919212..1919433) | hypothetical protein; Smlt1870 | N/A | Click |
| 28 | complement(1919433..1919825) | PHAGE_Synech_Syn5: tail fiber; Smlt1871; phage(gi148724489) | 7e-05 | Click |
| 29 | complement(1919825..1920313) | hypothetical protein; Smlt1872 | N/A | Click |
| 30 | complement(1920325..1922280) | PHAGE_Synech_S_CBS1: large terminase subunit; Smlt1873; phage(gi356870795) | 5e-118 | Click |
| 31 | complement(1922351..1922935) | hypothetical protein; Smlt1874 | N/A | Click |
| 32 | 1923046..1923252 | hypothetical protein; Smlt1875 | N/A | Click |
| 33 | 1923171..1923182 | attR GCTGGAAGCGGC | N/A | Click |
| 34 | 1923359..1923877 | hypothetical protein; Smlt1876 | N/A | Click |
| 35 | 1923973..1924338 | PHAGE_Pseudo_MP1412: hypothetical protein; Smlt1877; phage(gi399528997) | 2e-05 | Click |
| 36 | 1924823..1925227 | putative transposition helper protein; Smlt1878 | N/A | Click |
| 37 | 1925224..1926321 | PROPHAGE_Escher_CFT073: transposase insF; Smlt1879; phage(gi26249410) | 1e-10 | Click |
Region 6, total : 22 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1966393..1966935 | PHAGE_Bacter_2: lysozyme; Smlt1944; phage(gi212499717) | 5e-19 | Click |
| 2 | 1967303..1967632 | hypothetical protein; Smlt1946 | N/A | Click |
| 3 | 1967637..1967933 | hypothetical protein; Smlt1947 | N/A | Click |
| 4 | 1967963..1968247 | hypothetical protein; Smlt1948 | N/A | Click |
| 5 | 1968244..1968648 | PHAGE_Vibrio_VP882: hypothetical protein VPVV882_gp22; Smlt1949; phage(gi126010864) | 1e-04 | Click |
| 6 | 1968648..1969196 | hypothetical protein; Smlt1950 | N/A | Click |
| 7 | 1969201..1969728 | PHAGE_Sulfit_pCB2047_B: hypothetical protein; Smlt1951; phage(gi472342318) | 3e-24 | Click |
| 8 | 1969933..1971006 | PHAGE_Xantho_OP1: deduced tail fiber protein; Smlt1952; phage(gi84662618) | 7e-39 | Click |
| 9 | 1971470..1972105 | PHAGE_Pseudo_phi297: terminase small subunit; Smlt1953; phage(gi374531284) | 6e-20 | Click |
| 10 | 1972109..1973662 | PHAGE_Burkho_DC1: terminase large subunit; Smlt1954; phage(gi401723053) | 2e-88 | Click |
| 11 | 1973659..1973937 | hypothetical protein; Smlt1955 | N/A | Click |
| 12 | 1973939..1974127 | hypothetical protein; Smlt1956 | N/A | Click |
| 13 | 1974124..1974597 | hypothetical protein; Smlt1957 | N/A | Click |
| 14 | 1974597..1976768 | PHAGE_Burkho_DC1: portal protein; Smlt1958; phage(gi401723055) | 4e-137 | Click |
| 15 | 1976755..1977750 | PHAGE_Burkho_DC1: hypothetical protein; Smlt1959; phage(gi401723056) | 3e-14 | Click |
| 16 | 1977756..1977971 | hypothetical protein; Smlt1960 | N/A | Click |
| 17 | 1978049..1979158 | PHAGE_Burkho_DC1: hypothetical protein; Smlt1961; phage(gi401723060) | 1e-106 | Click |
| 18 | 1979230..1979676 | hypothetical protein; Smlt1962 | N/A | Click |
| 19 | 1979731..1980294 | PHAGE_Burkho_DC1: hypothetical protein; Smlt1963; phage(gi401723062) | 1e-06 | Click |
| 20 | 1980296..1980976 | PHAGE_Pseudo_F116: hypothetical protein F116p46; Smlt1964; phage(gi56692957) | 5e-25 | Click |
| 21 | 1980978..1982291 | PHAGE_Pseudo_F116: hypothetical protein F116p52; Smlt1965; phage(gi56692963) | 2e-24 | Click |
| 22 | 1982497..1983120 | PHAGE_Pseudo_F116: hypothetical protein F116p53; Smlt1967; phage(gi56692964) | 5e-18 | Click |