| Definition | Pseudomonas putida W619 chromosome, complete genome. |
|---|---|
| Accession | NC_010501 |
| Length | 5,774,330 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 58 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1438797..1440584) | PHAGE_Acanth_mimivirus: glutamine-dependent asparagine synthetase; PputW619_1300; phage(gi311977862) | 1e-24 | Click |
| 2 | 1440566..1440584 | attL CTCCTGCTAATCCGCACAT | N/A | Click |
| 3 | complement(1440621..1441811) | PHAGE_Bordet_1: integrase; PputW619_1301; phage(gi45569541) | 1e-41 | Click |
| 4 | complement(1442023..1442775) | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1302; phage(gi374531713) | 6e-14 | Click |
| 5 | complement(1442772..1443461) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp030; PputW619_1303; phage(gi148912795) | 2e-31 | Click |
| 6 | complement(1443452..1443601) | hypothetical protein; PputW619_1304 | N/A | Click |
| 7 | complement(1443598..1444269) | hypothetical protein; PputW619_1305 | N/A | Click |
| 8 | complement(1444256..1444630) | PHAGE_Pseudo_F116: regulatory protein; PputW619_1306; phage(gi56692917) | 7e-10 | Click |
| 9 | complement(1444721..1445116) | PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PputW619_1307; phage(gi148912803) | 7e-26 | Click |
| 10 | complement(1445251..1445940) | PHAGE_Entero_mEp235: prophage repressor; PputW619_1308; phage(gi428781850) | 3e-32 | Click |
| 11 | 1446015..1446326 | PHAGE_Pseudo_vB_PaeS_PMG1: Cro repressor protein; PputW619_1309; phage(gi374531716) | 5e-12 | Click |
| 12 | complement(1446489..1446974) | hypothetical protein; PputW619_1310 | N/A | Click |
| 13 | 1447152..1447430 | hypothetical protein; PputW619_1311 | N/A | Click |
| 14 | 1447427..1447732 | hypothetical protein; PputW619_1312 | N/A | Click |
| 15 | 1447729..1447965 | hypothetical protein; PputW619_1313 | N/A | Click |
| 16 | 1447962..1448252 | hypothetical protein; PputW619_1314 | N/A | Click |
| 17 | 1448249..1449019 | PHAGE_Lactob_A2: putative antirepressor; PputW619_1315; phage(gi22296547) | 2e-21 | Click |
| 18 | 1449016..1449390 | hypothetical protein; PputW619_1316 | N/A | Click |
| 19 | 1449387..1449614 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp050; PputW619_1317; phage(gi148912815) | 9e-08 | Click |
| 20 | 1449626..1450393 | PHAGE_Aggreg_S1249: replication protein; PputW619_1318; phage(gi273809588) | 8e-11 | Click |
| 21 | 1450390..1451163 | PHAGE_Pseudo_F10: DNA replication protein DnaC; PputW619_1319; phage(gi148912818) | 3e-68 | Click |
| 22 | 1451160..1452572 | PHAGE_Pseudo_vB_PaeS_PMG1: replicative DNA helicase; PputW619_1320; phage(gi374531720) | 3e-63 | Click |
| 23 | 1452559..1453065 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp055; PputW619_1321; phage(gi148912820) | 3e-06 | Click |
| 24 | 1453062..1453349 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp057; PputW619_1322; phage(gi148912822) | 1e-14 | Click |
| 25 | 1453346..1453735 | PHAGE_Pseudo_PAJU2: putative antitermination protein Q; PputW619_1323; phage(gi209552491) | 7e-18 | Click |
| 26 | 1453961..1454470 | hypothetical protein; PputW619_1324 | N/A | Click |
| 27 | complement(1454790..1454978) | hypothetical protein; PputW619_1325 | N/A | Click |
| 28 | complement(1455170..1455397) | hypothetical protein; PputW619_1326 | N/A | Click |
| 29 | complement(1455394..1455627) | hypothetical protein; PputW619_1327 | N/A | Click |
| 30 | 1455749..1456120 | PHAGE_Erwini_PEp14: holin; PputW619_1328; phage(gi374531877) | 1e-06 | Click |
| 31 | 1456120..1456437 | PHAGE_Erwini_PEp14: hypothetical protein; PputW619_1329; phage(gi374531878) | 9e-05 | Click |
| 32 | 1456488..1456643 | hypothetical protein; PputW619_1330 | N/A | Click |
| 33 | 1456776..1457060 | hypothetical protein; PputW619_1331 | N/A | Click |
| 34 | 1457125..1457481 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1332; phage(gi374531738) | 5e-09 | Click |
| 35 | 1457472..1457840 | PHAGE_Pseudo_vB_PaeS_PMG1: putative HNH endonuclease; PputW619_1333; phage(gi374531741) | 2e-22 | Click |
| 36 | 1457968..1458351 | PHAGE_Pseudo_vB_PaeS_PMG1: terminase small subunit; PputW619_1334; phage(gi374531646) | 2e-20 | Click |
| 37 | 1458351..1460060 | PHAGE_Pseudo_vB_PaeS_PMG1: terminase large subunit; PputW619_1335; phage(gi374531647) | 4e-151 | Click |
| 38 | 1460072..1460236 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1336; phage(gi374531648) | 1e-05 | Click |
| 39 | 1460229..1461563 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1337; phage(gi374531649) | 1e-99 | Click |
| 40 | 1461560..1462306 | PHAGE_Entero_phiP27: putative prohead protease; PputW619_1338; phage(gi18249903) | 9e-39 | Click |
| 41 | 1462316..1463572 | PHAGE_Pseudo_vB_PaeS_PMG1: major capsid protein; PputW619_1339; phage(gi374531651) | 4e-81 | Click |
| 42 | 1463614..1463838 | hypothetical protein; PputW619_1340 | N/A | Click |
| 43 | 1463842..1464318 | PHAGE_Entero_mEp235: head-tail connector II; PputW619_1341; phage(gi428781817) | 1e-06 | Click |
| 44 | 1464318..1464659 | PHAGE_Pseudo_PAJU2: putative head-tail adaptor; PputW619_1342; phage(gi209552428) | 5e-21 | Click |
| 45 | 1464652..1465137 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1343; phage(gi374531659) | 2e-64 | Click |
| 46 | 1465134..1465502 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1344; phage(gi374531660) | 5e-40 | Click |
| 47 | 1465565..1466062 | PHAGE_Pseudo_vB_PaeS_PMG1: putative major tail protein; PputW619_1345; phage(gi374531661) | 2e-53 | Click |
| 48 | 1466059..1466397 | hypothetical protein; PputW619_1346 | N/A | Click |
| 49 | 1466427..1466684 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PputW619_1347; phage(gi374531663) | 5e-13 | Click |
| 50 | 1466759..1467097 | PHAGE_Salmon_SE2: hypothetical protein; PputW619_1348; phage(gi375267274) | 4e-09 | Click |
| 51 | 1467151..1469712 | PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; PputW619_1349; phage(gi374531664) | 0.0 | Click |
| 52 | 1469722..1470306 | PHAGE_Yersin_PY54: hypothetical protein PY54p16; PputW619_1350; phage(gi33770525) | 3e-16 | Click |
| 53 | 1470306..1470902 | PHAGE_Yersin_PY54: hypothetical protein PY54p17; PputW619_1351; phage(gi33770526) | 7e-30 | Click |
| 54 | 1470908..1471306 | PHAGE_Yersin_PY54: hypothetical protein PY54p19; PputW619_1352; phage(gi33770528) | 8e-36 | Click |
| 55 | 1471306..1476798 | PHAGE_Yersin_PY54: tail protein; PputW619_1353; phage(gi33770530) | 2e-105 | Click |
| 56 | 1477118..1477972 | hypothetical protein; PputW619_1354 | N/A | Click |
| 57 | 1477978..1478220 | hypothetical protein; PputW619_1355 | N/A | Click |
| 58 | 1478283..1478720 | PHAGE_Pseudo_D3112: putative structural protein; PputW619_1356; phage(gi38229133) | 2e-31 | Click |
| 59 | 1478717..1479223 | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; PputW619_1357; phage(gi16765210) | 2e-10 | Click |
| 60 | 1479934..1479952 | attR CTCCTGCTAATCCGCACAT | N/A | Click |
Region 2, total : 9 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3034880..3034893 | attL CACGGTGATCGGGT | N/A | Click |
| 2 | complement(3036446..3037720) | PHAGE_Cronob_ENT39118: DNA polymerase; PputW619_2745; phage(gi431811050) | 2e-97 | Click |
| 3 | complement(3037710..3038168) | PHAGE_Cronob_ENT39118: protein umuD; PputW619_2746; phage(gi431811072) | 3e-19 | Click |
| 4 | 3038241..3038960 | PHAGE_Pseudo_F116: hypothetical protein F116p67; PputW619_2747; phage(gi56692976) | 4e-57 | Click |
| 5 | 3038962..3039309 | hypothetical protein; PputW619_2748 | N/A | Click |
| 6 | 3039470..3039691 | PHAGE_Bordet_1: integrase; PputW619_2749; phage(gi45569541) | 3e-07 | Click |
| 7 | 3039712..3041298 | PHAGE_Parame_1: hypothetical protein; PputW619_2750; phage(gi9632181) | 1e-30 | Click |
| 8 | 3041485..3042678 | PHAGE_Lactob_Lj771: minor tail protein gp26-like protein; PputW619_2751; phage(gi163932195) | 7e-06 | Click |
| 9 | complement(3042738..3043349) | azoreductase; PputW619_2752 | N/A | Click |
| 10 | 3043484..3044386 | PHAGE_Burkho_phi1026b: gp58; PputW619_2753; phage(gi38707948) | 9e-10 | Click |
| 11 | 3045683..3045696 | attR CACGGTGATCGGGT | N/A | Click |
Region 3, total : 55 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4352627..4352689 | attL TGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT | N/A | Click |
| 2 | complement(4353908..4354168) | PHAGE_Pseudo_phi297: hypothetical protein; PputW619_3919; phage(gi374531310) | 9e-27 | Click |
| 3 | complement(4354165..4354527) | PHAGE_Pseudo_phi297: hypothetical protein; PputW619_3920; phage(gi374531309) | 2e-18 | Click |
| 4 | complement(4354524..4354961) | PHAGE_Entero_phiV10: hypothetical structural protein; PputW619_3921; phage(gi89152439) | 3e-32 | Click |
| 5 | 4355050..4355412 | hypothetical protein; PputW619_3922 | N/A | Click |
| 6 | 4355480..4355803 | hypothetical protein; PputW619_3923 | N/A | Click |
| 7 | complement(4355813..4356043) | hypothetical protein; PputW619_3924 | N/A | Click |
| 8 | complement(4356066..4356758) | PHAGE_Xantho_Xp10: conserved phage protein; PputW619_3925; phage(gi32128436) | 3e-07 | Click |
| 9 | complement(4356758..4357051) | PHAGE_Xantho_CP1: hypothetical protein; PputW619_3926; phage(gi431811020) | 4e-08 | Click |
| 10 | complement(4357067..4363090) | PHAGE_Cronob_ENT39118: phage tail protein; PputW619_3927; phage(gi431811044) | 0.0 | Click |
| 11 | complement(4363149..4363778) | PHAGE_Entero_mEp234: tail assembly protein I; PputW619_3928; phage(gi428782273) | 1e-47 | Click |
| 12 | complement(4363821..4364171) | PHAGE_Entero_mEpX2: hypothetical protein; PputW619_3929; phage(gi428765632) | 1e-14 | Click |
| 13 | complement(4364204..4364959) | PHAGE_Entero_HK633: minor tail protein; PputW619_3930; phage(gi428782537) | 1e-63 | Click |
| 14 | complement(4364962..4365711) | PHAGE_Entero_mEp237: minor tail protein L; PputW619_3931; phage(gi435439282) | 2e-73 | Click |
| 15 | complement(4365708..4366046) | PHAGE_Entero_mEp390: minor tail protein; PputW619_3932; phage(gi428782678) | 1e-25 | Click |
| 16 | complement(4366046..4369360) | PHAGE_Pseudo_DMS3: putative tail length tape measure protein; PputW619_3933; phage(gi119953666) | 2e-126 | Click |
| 17 | complement(4369405..4369638) | hypothetical protein; PputW619_3934 | N/A | Click |
| 18 | complement(4369635..4369979) | hypothetical protein; PputW619_3935 | N/A | Click |
| 19 | complement(4370020..4370520) | PHAGE_Salico_CGphi29: hypothetical protein; PputW619_3936; phage(gi472340186) | 1e-13 | Click |
| 20 | complement(4370576..4370962) | PHAGE_Marino_P12026: hypothetical protein; PputW619_3937; phage(gi399528327) | 6e-09 | Click |
| 21 | complement(4370955..4371455) | HK97 family phage protein; PputW619_3938 | N/A | Click |
| 22 | complement(4371459..4371638) | hypothetical protein; PputW619_3939 | N/A | Click |
| 23 | complement(4371647..4371973) | PHAGE_Entero_mEp235: hypothetical protein; PputW619_3940; phage(gi428781819) | 5e-07 | Click |
| 24 | complement(4371973..4372272) | PHAGE_Entero_mEp235: head-tail connector II; PputW619_3941; phage(gi428781817) | 4e-14 | Click |
| 25 | complement(4372273..4372644) | PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.072; PputW619_3942; phage(gi126011006) | 9e-08 | Click |
| 26 | complement(4372700..4373902) | PHAGE_Cronob_ENT39118: major capsid protein; PputW619_3943; phage(gi431811052) | 6e-60 | Click |
| 27 | complement(4373899..4374540) | PHAGE_Marino_P12026: phage prohead protease; PputW619_3944; phage(gi399528321) | 1e-22 | Click |
| 28 | complement(4374527..4375741) | PHAGE_Entero_mEp235: portal protein; PputW619_3945; phage(gi428781813) | 2e-49 | Click |
| 29 | complement(4375744..4377432) | PHAGE_Entero_4795: putative large subunit terminase; PputW619_3946; phage(gi157166040) | 0.0 | Click |
| 30 | complement(4377429..4377962) | PHAGE_Burkho_Bcep176: gp80; PputW619_3947; phage(gi77864706) | 2e-28 | Click |
| 31 | complement(4378121..4378459) | PHAGE_Pseudo_PAJU2: putative endonuclease; PputW619_3948; phage(gi209552497) | 3e-28 | Click |
| 32 | complement(4378459..4378653) | hypothetical protein; PputW619_3949 | N/A | Click |
| 33 | complement(4378703..4379035) | PHAGE_Pseudo_F10: Putative Holin; PputW619_3950; phage(gi148912825) | 9e-29 | Click |
| 34 | complement(4379920..4380279) | hypothetical protein; PputW619_3951 | N/A | Click |
| 35 | complement(4380430..4380819) | PHAGE_Pseudo_PAJU2: putative antitermination protein Q; PputW619_3952; phage(gi209552491) | 7e-18 | Click |
| 36 | complement(4380816..4381103) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp057; PputW619_3953; phage(gi148912822) | 3e-15 | Click |
| 37 | complement(4381100..4381630) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp055; PputW619_3954; phage(gi148912820) | 4e-06 | Click |
| 38 | complement(4381617..4382999) | PHAGE_Pseudo_F10: Putative DnaB-like replicative helicase; PputW619_3955; phage(gi148912819) | 7e-104 | Click |
| 39 | complement(4382996..4383778) | PHAGE_Pseudo_F10: DNA replication protein DnaC; PputW619_3956; phage(gi148912818) | 1e-90 | Click |
| 40 | complement(4383775..4384569) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp052; PputW619_3957; phage(gi148912817) | 3e-07 | Click |
| 41 | complement(4384566..4384796) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp050; PputW619_3958; phage(gi148912815) | 4e-16 | Click |
| 42 | complement(4384793..4385434) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp030; PputW619_3959; phage(gi148912795) | 9e-10 | Click |
| 43 | complement(4385431..4386195) | PHAGE_Salmon_SPN3UB: putative antirepressor family protein; PputW619_3960; phage(gi423262399) | 1e-35 | Click |
| 44 | complement(4386192..4386485) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp046; PputW619_3961; phage(gi148912811) | 4e-05 | Click |
| 45 | complement(4386482..4386772) | hypothetical protein; PputW619_3962 | N/A | Click |
| 46 | complement(4386769..4387098) | hypothetical protein; PputW619_3963 | N/A | Click |
| 47 | 4387936..4388715 | PHAGE_Erwini_phiEt88: phage repressor protein; PputW619_3964; phage(gi327198606) | 1e-43 | Click |
| 48 | 4388872..4389261 | PHAGE_Pseudo_F10: Conserved hypothetical protein; putative transcriptional regulator, LuxR family; PputW619_3965; phage(gi148912803) | 4e-16 | Click |
| 49 | 4389352..4389765 | PHAGE_Pseudo_F116: regulatory protein; PputW619_3966; phage(gi56692917) | 1e-07 | Click |
| 50 | 4390257..4390814 | PHAGE_Bacill_phBC6A51: hypothetical protein BC1875; PputW619_3967; phage(gi31415769) | 1e-08 | Click |
| 51 | 4390804..4391046 | PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; PputW619_3968; phage(gi31415768) | 4e-05 | Click |
| 52 | 4391101..4391349 | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp32; PputW619_3969; phage(gi209552451) | 1e-18 | Click |
| 53 | complement(4391365..4391949) | hypothetical protein; PputW619_3970 | N/A | Click |
| 54 | complement(4392912..4393934) | PHAGE_Pseudo_PAJU2: putative integrase; PputW619_3971; phage(gi209552450) | 2e-103 | Click |
| 55 | complement(4393999..4394088) | tRNA | N/A | Click |
| 56 | 4393999..4394061 | attR TGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT | N/A | Click |
| 57 | complement(4394181..4394891) | PHAGE_Prochl_Syn1: phosphoribosylaminoimidazole-succinocarboxamide synthase; PputW619_3972; phage(gi326784002) | 2e-40 | Click |
| 58 | complement(4394922..4395680) | PHAGE_Lister_B054: gp51; PputW619_3973; phage(gi157325335) | 6e-20 | Click |
Region 4, total : 26 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4452059..4453177 | PHAGE_Synech_S_CBS2: DprA superfamily protein; PputW619_4028; phage(gi331027974) | 2e-17 | Click |
| 2 | complement(4453203..4453673) | recombination regulator RecX; PputW619_4029 | N/A | Click |
| 3 | complement(4453691..4454758) | PROPHAGE_Escher_MG1655: DNA strand exchange and recombination protein with protease and nuclease activity; PputW619_4030; phage(gi16130606) | 3e-138 | Click |
| 4 | complement(4454862..4455344) | CinA domain-containing protein; PputW619_4031 | N/A | Click |
| 5 | complement(4455428..4455904) | PHAGE_Burkho_Bcep22: Bcep22gp80; PputW619_4032; phage(gi38640385) | 6e-09 | Click |
| 6 | complement(4455901..4456449) | PHAGE_Cronob_vB_CsaM_GAP31: lysozyme; PputW619_4033; phage(gi414086784) | 8e-43 | Click |
| 7 | complement(4456477..4457511) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp30; PputW619_4034; phage(gi17313247) | 5e-36 | Click |
| 8 | complement(4457516..4457722) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp09; PputW619_4035; phage(gi17313226) | 8e-07 | Click |
| 9 | complement(4457697..4458542) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp29; PputW619_4036; phage(gi17313246) | 7e-12 | Click |
| 10 | complement(4458552..4460405) | PHAGE_Bacill_phiAGATE: putative tail lysin 2; PputW619_4037; phage(gi448260828) | 2e-08 | Click |
| 11 | complement(4460530..4460832) | hypothetical protein; PputW619_4038 | N/A | Click |
| 12 | complement(4460843..4461352) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp25; PputW619_4039; phage(gi17313242) | 2e-27 | Click |
| 13 | complement(4461366..4462532) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp24; PputW619_4040; phage(gi17313241) | 3e-61 | Click |
| 14 | complement(4462602..4463051) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp23; PputW619_4041; phage(gi17313240) | 3e-24 | Click |
| 15 | complement(4463055..4465199) | PHAGE_Ralsto_phiRSA1: tail fiber protein gpH; PputW619_4042; phage(gi145708097) | 2e-82 | Click |
| 16 | complement(4465192..4465800) | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; PputW619_4043; phage(gi169936031) | 3e-52 | Click |
| 17 | complement(4465802..4466683) | PHAGE_Pseudo_phiCTX: predicted baseplate or base of tail fiber; PputW619_4044; phage(gi17313237) | 1e-84 | Click |
| 18 | complement(4466680..4467006) | PHAGE_Pseudo_phiCTX: predicted baseplate; PputW619_4045; phage(gi17313236) | 5e-17 | Click |
| 19 | complement(4467094..4467654) | PHAGE_Pseudo_phiCTX: predicted baseplate; PputW619_4046; phage(gi17313235) | 6e-17 | Click |
| 20 | complement(4467651..4468148) | phage protein; PputW619_4047 | N/A | Click |
| 21 | complement(4468162..4468497) | pyocin R2_PP, holin; PputW619_4048 | N/A | Click |
| 22 | complement(4468972..4469718) | PHAGE_Pseudo_F116: transcriptional regulator; PputW619_4049; phage(gi56692918) | 2e-39 | Click |
| 23 | 4469858..4472431 | PHAGE_Cafete_BV_PW1: putative DNA mismatch repair protein MutS; PputW619_4050; phage(gi310831476) | 2e-30 | Click |
| 24 | 4472572..4472895 | 4Fe-4S ferredoxin iron-sulfur binding domain-containing protein; PputW619_4051 | N/A | Click |
| 25 | complement(4473399..4474406) | PHAGE_Synech_S_CBS1: group2 RNA polymerase sigma factor; PputW619_4052; phage(gi356870821) | 4e-37 | Click |
| 26 | complement(4474515..4475372) | PHAGE_Clostr_phi3626: Gp15 protein; PputW619_4053; phage(gi20065978) | 1e-15 | Click |
Region 5, total : 8 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4790697..4790709 | attL AGTCTCCCTCGGG | N/A | Click |
| 2 | 4790924..4792132 | PROPHAGE_Escher_CFT073: putative prophage integrase; PputW619_4347; phage(gi26250313) | 5e-102 | Click |
| 3 | 4792154..4793014 | hypothetical protein; PputW619_4348 | N/A | Click |
| 4 | 4793114..4793338 | PHAGE_Entero_P4: transcriptional regulator; PputW619_4349; phage(gi9627517) | 3e-07 | Click |
| 5 | 4793354..4793365 | attL CCAGTCGTGCCC | N/A | Click |
| 6 | 4794188..4794598 | PHAGE_Strept_TG1: P4 family phage/plasmid primase; PputW619_4350; phage(gi410491938) | 3e-08 | Click |
| 7 | 4794595..4795782 | PHAGE_Coryne_BFK20: gp43, RepA like protein; PputW619_4351; phage(gi157168416) | 2e-05 | Click |
| 8 | 4796191..4796415 | hypothetical protein; PputW619_4352 | N/A | Click |
| 9 | 4796418..4798280 | PHAGE_Entero_mEp213: head maturation protease; PputW619_4353; phage(gi428782594) | 2e-139 | Click |
| 10 | 4798294..4799631 | PROPHAGE_Escher_CFT073: putative prophage integrase; PputW619_4354; phage(gi26250313) | 9e-13 | Click |
| 11 | 4799713..4799724 | attR CCAGTCGTGCCC | N/A | Click |
| 12 | 4800522..4800534 | attR AGTCTCCCTCGGG | N/A | Click |