| Definition | Pseudomonas putida GB-1 chromosome, complete genome. |
|---|---|
| Accession | NC_010322 |
| Length | 6,078,430 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 31 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1336655..1336667 | attL GCAAACCGCGGCG | N/A | Click |
| 2 | 1349044..1351806 | PHAGE_Pseudo_MP1412: integrase; PputGB1_1191; phage(gi399528988) | 3e-13 | Click |
| 3 | 1352131..1352682 | hypothetical protein; PputGB1_1192 | N/A | Click |
| 4 | 1352887..1353234 | pyocin R2_PP, holin; PputGB1_1193 | N/A | Click |
| 5 | 1353395..1353976 | PHAGE_Stenot_S1: putative terminase small subunit; PputGB1_1194; phage(gi213163901) | 1e-06 | Click |
| 6 | 1353981..1356023 | PHAGE_Synech_S_CBS3: large terminase subunit; PputGB1_1195; phage(gi331028008) | 7e-121 | Click |
| 7 | 1356025..1356231 | PHAGE_Stenot_S1: putative peptidase b; PputGB1_1196; phage(gi213163904) | 6e-06 | Click |
| 8 | 1356243..1357709 | PHAGE_Vibrio_vB_VpaM_MAR: portal protein; PputGB1_1197; phage(gi428782728) | 8e-89 | Click |
| 9 | 1357706..1358857 | PHAGE_Entero_mEp213: head maturation protease; PputGB1_1198; phage(gi428782594) | 8e-38 | Click |
| 10 | 1358854..1359201 | hypothetical protein; PputGB1_1199 | N/A | Click |
| 11 | 1359263..1360258 | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; PputGB1_1200; phage(gi428782731) | 9e-43 | Click |
| 12 | 1360261..1360575 | hypothetical protein; PputGB1_1201 | N/A | Click |
| 13 | 1360572..1361234 | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; PputGB1_1202; phage(gi428782733) | 2e-10 | Click |
| 14 | 1361227..1361757 | hypothetical protein; PputGB1_1203 | N/A | Click |
| 15 | 1361754..1362335 | PHAGE_Burkho_phi52237: phage baseplate assembly protein; PputGB1_1204; phage(gi72537705) | 2e-16 | Click |
| 16 | 1362378..1362659 | hypothetical protein; PputGB1_1205 | N/A | Click |
| 17 | 1362662..1362988 | PHAGE_Vibrio_vB_VpaM_MAR: baseplate assembly protein; PputGB1_1206; phage(gi428782737) | 7e-19 | Click |
| 18 | 1362985..1363965 | PHAGE_Salmon_RE_2010: baseplate assembly protein J; PputGB1_1207; phage(gi418489711) | 4e-56 | Click |
| 19 | 1363962..1364684 | PHAGE_Vibrio_vB_VpaM_MAR: tail protein; PputGB1_1208; phage(gi428782739) | 1e-19 | Click |
| 20 | 1364681..1365367 | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; PputGB1_1209; phage(gi428782740) | 2e-23 | Click |
| 21 | 1365370..1366101 | PHAGE_Halomo_1: hypothetical protein HAPgp17; PputGB1_1210; phage(gi167832362) | 1e-05 | Click |
| 22 | 1366109..1366564 | PHAGE_Ralsto_phiRSA1: tail fiber assembly-like protein; PputGB1_1211; phage(gi145708099) | 6e-21 | Click |
| 23 | 1366657..1367823 | PHAGE_Vibrio_vB_VpaM_MAR: tail sheath protein; PputGB1_1212; phage(gi428782746) | 2e-88 | Click |
| 24 | 1367836..1368345 | PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; PputGB1_1213; phage(gi428782747) | 2e-35 | Click |
| 25 | 1368396..1368692 | hypothetical protein; PputGB1_1214 | N/A | Click |
| 26 | 1368824..1372768 | PHAGE_Vibrio_VP882: phage-related tail protein; PputGB1_1215; phage(gi126010872) | 2e-31 | Click |
| 27 | 1372778..1373623 | PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PputGB1_1216; phage(gi428782751) | 6e-19 | Click |
| 28 | 1373598..1373804 | PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PputGB1_1217; phage(gi428782752) | 3e-06 | Click |
| 29 | 1373868..1374911 | PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PputGB1_1218; phage(gi428782753) | 6e-51 | Click |
| 30 | 1374949..1375518 | PHAGE_Cronob_vB_CsaM_GAP31: lysozyme; PputGB1_1219; phage(gi414086784) | 8e-46 | Click |
| 31 | 1375518..1376072 | PHAGE_Burkho_DC1: Rz; PputGB1_1220; phage(gi401723083) | 4e-07 | Click |
| 32 | 1376224..1377021 | PHAGE_Pseudo_B3: Dam modification methylase; PputGB1_1221; phage(gi56692617) | 2e-100 | Click |
| 33 | 1378929..1378941 | attR GCAAACCGCGGCG | N/A | Click |
Region 2, total : 55 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1929732..1929743 | attL TTGTTACCGCAC | N/A | Click |
| 2 | complement(1934889..1935815) | PHAGE_Prochl_Syn1: transaldolase-like protein; PputGB1_1709; phage(gi326784174) | 1e-13 | Click |
| 3 | complement(1935985..1936995) | tRNA-dihydrouridine synthase A; PputGB1_1710 | N/A | Click |
| 4 | 1937095..1938237 | PHAGE_Burkho_DC1: integrase; PputGB1_1711; phage(gi401723020) | 3e-103 | Click |
| 5 | complement(1938206..1938484) | PHAGE_Burkho_AH2: excisionase; PputGB1_1712; phage(gi399529070) | 4e-19 | Click |
| 6 | complement(1938494..1938706) | hypothetical protein; PputGB1_1713 | N/A | Click |
| 7 | complement(1938717..1940027) | PHAGE_Pseudo_phi297: hypothetical protein; PputGB1_1714; phage(gi374531251) | 4e-28 | Click |
| 8 | complement(1940024..1940347) | hypothetical protein; PputGB1_1715 | N/A | Click |
| 9 | 1940392..1941090 | hypothetical protein; PputGB1_1716 | N/A | Click |
| 10 | complement(1941116..1941523) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp44; PputGB1_1717; phage(gi17313261) | 1e-57 | Click |
| 11 | 1941585..1941944 | PROPHAGE_Pseudo_KT2440: ISPpu13, transposase Orf1; PputGB1_1718; phage(gi26989832) | 1e-63 | Click |
| 12 | 1941972..1943492 | PROPHAGE_Pseudo_KT2440: ISPpu15, transposase Orf2; PputGB1_1719; phage(gi26990787) | 0.0 | Click |
| 13 | complement(1943534..1944838) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp44; PputGB1_1720; phage(gi17313261) | 0.0 | Click |
| 14 | complement(1944892..1945503) | PHAGE_Pseudo_F116: exonuclease; PputGB1_1721; phage(gi56692916) | 4e-51 | Click |
| 15 | complement(1945568..1947310) | PHAGE_Pseudo_phi297: putative recombinase; PputGB1_1722; phage(gi374531255) | 3e-103 | Click |
| 16 | complement(1947315..1948313) | PHAGE_Pseudo_phi297: putative DNA segregation ATPase; PputGB1_1723; phage(gi374531256) | 7e-72 | Click |
| 17 | complement(1948323..1948523) | PHAGE_Pseudo_phi297: hypothetical protein; PputGB1_1724; phage(gi374531257) | 1e-09 | Click |
| 18 | complement(1948530..1949399) | PHAGE_Entero_phiV10: putative recET; PputGB1_1725; phage(gi89152454) | 9e-12 | Click |
| 19 | complement(1949408..1950211) | PHAGE_Pseudo_phi297: hypothetical protein; PputGB1_1726; phage(gi374531259) | 5e-108 | Click |
| 20 | complement(1950330..1950479) | hypothetical protein; PputGB1_1727 | N/A | Click |
| 21 | complement(1950469..1950624) | hypothetical protein; PputGB1_1728 | N/A | Click |
| 22 | complement(1950621..1950902) | hypothetical protein; PputGB1_1729 | N/A | Click |
| 23 | complement(1951008..1951310) | hypothetical protein; PputGB1_1730 | N/A | Click |
| 24 | complement(1951331..1951663) | hypothetical protein; PputGB1_1731 | N/A | Click |
| 25 | complement(1952034..1952381) | hypothetical protein; PputGB1_1732 | N/A | Click |
| 26 | complement(1952392..1953060) | PHAGE_Entero_phiP27: putative lambda repressor; PputGB1_1733; phage(gi18249875) | 4e-33 | Click |
| 27 | 1953177..1953416 | PHAGE_Salmon_1: putative transcriptional regulator (cro analog); PputGB1_1734; phage(gi169257172) | 5e-12 | Click |
| 28 | 1953419..1953727 | PHAGE_Pseudo_vB_PaeS_PMG1: cII regulatory protein; PputGB1_1735; phage(gi374531717) | 1e-31 | Click |
| 29 | 1953731..1954642 | PHAGE_Azospi_Cd: hypothetical protein APCd_gp15; PputGB1_1736; phage(gi168495118) | 1e-08 | Click |
| 30 | 1954599..1955171 | PHAGE_Pseudo_PAJU2: putative replication protein P; PputGB1_1737; phage(gi209552483) | 5e-06 | Click |
| 31 | 1955168..1955335 | PHAGE_Pseudo_AF: hypothetical protein; PputGB1_1738; phage(gi431810351) | 8e-09 | Click |
| 32 | 1955507..1955947 | PHAGE_Pseudo_phi297: holliday junction resolvase; PputGB1_1739; phage(gi374531280) | 8e-49 | Click |
| 33 | 1955991..1956620 | PHAGE_Pseudo_phi297: hypothetical protein; PputGB1_1740; phage(gi374531281) | 2e-17 | Click |
| 34 | 1956693..1957604 | PHAGE_Pseudo_F116: hypothetical protein F116p41; PputGB1_1741; phage(gi56692954) | 7e-23 | Click |
| 35 | 1957904..1958149 | PHAGE_Pseudo_F116: holin; PputGB1_1742; phage(gi56692925) | 1e-21 | Click |
| 36 | 1958146..1958658 | PHAGE_Burkho_Bcep22: Bcep22gp79; PputGB1_1743; phage(gi158997736) | 2e-58 | Click |
| 37 | 1958655..1959104 | PHAGE_Burkho_Bcep22: Bcep22gp80; PputGB1_1744; phage(gi38640385) | 6e-15 | Click |
| 38 | 1959114..1959647 | PHAGE_Entero_phiV10: putative terminase small subunit; PputGB1_1745; phage(gi155370097) | 4e-44 | Click |
| 39 | 1959622..1961121 | PHAGE_Entero_phiV10: putative terminase large subunit; PputGB1_1746; phage(gi89152423) | 2e-129 | Click |
| 40 | 1961132..1961395 | hypothetical protein; PputGB1_1747 | N/A | Click |
| 41 | 1961398..1963092 | PHAGE_Entero_phiV10: putative head-to-tail-joining protein; PputGB1_1748; phage(gi89152428) | 5e-122 | Click |
| 42 | 1963093..1963398 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p08; PputGB1_1749; phage(gi89152429) | 9e-11 | Click |
| 43 | 1963395..1964096 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p09; PputGB1_1750; phage(gi89152430) | 1e-27 | Click |
| 44 | 1964107..1965105 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p10; PputGB1_1751; phage(gi89152431) | 5e-103 | Click |
| 45 | 1965143..1965589 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p11; PputGB1_1752; phage(gi89152432) | 5e-36 | Click |
| 46 | 1965599..1966039 | hypothetical protein; PputGB1_1753 | N/A | Click |
| 47 | 1966099..1966734 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p14; PputGB1_1754; phage(gi89152435) | 1e-26 | Click |
| 48 | 1966731..1969055 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p15; PputGB1_1755; phage(gi89152436) | 1e-152 | Click |
| 49 | 1969057..1969500 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p16; PputGB1_1756; phage(gi89152437) | 9e-16 | Click |
| 50 | 1969500..1969961 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p17; PputGB1_1757; phage(gi89152438) | 3e-09 | Click |
| 51 | 1969964..1972390 | PHAGE_Pseudo_AF: putative structural lysozyme; PputGB1_1758; phage(gi431810307) | 3e-37 | Click |
| 52 | 1972387..1974141 | PHAGE_Singap_iridovirus: hypothetical protein ORF012L; PputGB1_1759; phage(gi56692649) | 4e-06 | Click |
| 53 | 1974141..1976708 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; PputGB1_1760; phage(gi89152441) | 4e-68 | Click |
| 54 | 1976799..1979216 | PHAGE_Pseudo_AF: putative tail spike protein; PputGB1_1761; phage(gi431810311) | 4e-66 | Click |
| 55 | complement(1979189..1981177) | PHAGE_Salmon_c341: O-polysaccharide acetyltransferase protein; PputGB1_1762; phage(gi255252697) | 8e-69 | Click |
| 56 | 1981302..1981574 | hypothetical protein; PputGB1_1763 | N/A | Click |
| 57 | 1981866..1982090 | PHAGE_Burkho_DC1: integrase; PputGB1_1764; phage(gi401723020) | 8e-07 | Click |
| 58 | 1996699..1996710 | attR TTGTTACCGCAC | N/A | Click |
Region 3, total : 56 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3820676..3821107) | PHAGE_Pseudo_PAJU2: putative endolysin; PputGB1_3388; phage(gi209552446) | 2e-56 | Click |
| 2 | complement(3821510..3821737) | hypothetical protein; PputGB1_3389 | N/A | Click |
| 3 | complement(3821811..3822776) | PHAGE_Escher_HK639: phage tail protein; PputGB1_3390; phage(gi356870627) | 6e-47 | Click |
| 4 | complement(3822786..3823841) | hypothetical protein; PputGB1_3391 | N/A | Click |
| 5 | complement(3823841..3831043) | PHAGE_Yersin_PY54: tail protein; PputGB1_3392; phage(gi33770530) | 5e-113 | Click |
| 6 | complement(3831043..3831441) | PHAGE_Yersin_PY54: hypothetical protein PY54p19; PputGB1_3393; phage(gi33770528) | 4e-33 | Click |
| 7 | complement(3831444..3832046) | PHAGE_Yersin_PY54: hypothetical protein PY54p17; PputGB1_3394; phage(gi33770526) | 3e-33 | Click |
| 8 | complement(3832046..3832630) | PHAGE_Yersin_PY54: hypothetical protein PY54p16; PputGB1_3395; phage(gi33770525) | 1e-19 | Click |
| 9 | complement(3832647..3835373) | PHAGE_Pseudo_MP29: putative tail component protein; PputGB1_3396; phage(gi215480016) | 2e-99 | Click |
| 10 | complement(3835430..3835744) | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp26; PputGB1_3397; phage(gi209552445) | 2e-05 | Click |
| 11 | complement(3836111..3836569) | PHAGE_Entero_WV8: hypothetical protein WV8_gp095; PputGB1_3398; phage(gi238801827) | 2e-06 | Click |
| 12 | complement(3836562..3837137) | PHAGE_Entero_WV8: hypothetical protein WV8_gp096; PputGB1_3399; phage(gi238801828) | 2e-36 | Click |
| 13 | complement(3837134..3837988) | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp25; PputGB1_3400; phage(gi209552444) | 2e-35 | Click |
| 14 | complement(3838063..3838221) | PHAGE_Salmon_SPN9CC: regulatory protein; PputGB1_3401; phage(gi389060549) | 6e-07 | Click |
| 15 | 3838336..3838743 | Arc domain-containing protein; PputGB1_3402 | N/A | Click |
| 16 | 3838925..3839500 | hypothetical protein; PputGB1_3403 | N/A | Click |
| 17 | complement(3839642..3840247) | hypothetical protein; PputGB1_3404 | N/A | Click |
| 18 | 3840443..3840736 | hypothetical protein; PputGB1_3405 | N/A | Click |
| 19 | complement(3840938..3841234) | PHAGE_Cronob_phiES15: hypothetical protein; PputGB1_3406; phage(gi401817604) | 2e-11 | Click |
| 20 | complement(3841252..3841635) | PHAGE_Cronob_phiES15: hypothetical protein; PputGB1_3407; phage(gi401817603) | 2e-05 | Click |
| 21 | complement(3841645..3842304) | PHAGE_Cronob_phiES15: putative major tail protein; PputGB1_3408; phage(gi401817602) | 1e-25 | Click |
| 22 | complement(3842371..3842961) | PHAGE_Klebsi_phiKO2: Gp21; PputGB1_3409; phage(gi46402107) | 4e-05 | Click |
| 23 | complement(3843022..3843444) | PHAGE_Cronob_phiES15: hypothetical protein; PputGB1_3410; phage(gi401817601) | 5e-07 | Click |
| 24 | complement(3843441..3844115) | PHAGE_Shigel_EP23: putative tail protein; PputGB1_3411; phage(gi371496282) | 3e-22 | Click |
| 25 | complement(3844117..3844509) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; PputGB1_3412; phage(gi423262010) | 5e-16 | Click |
| 26 | complement(3844512..3844904) | hypothetical protein; PputGB1_3413 | N/A | Click |
| 27 | complement(3844945..3845529) | hypothetical protein; PputGB1_3414 | N/A | Click |
| 28 | complement(3845578..3846522) | PHAGE_Cronob_phiES15: putative major capsid protein; PputGB1_3415; phage(gi401817596) | 2e-29 | Click |
| 29 | complement(3846533..3847252) | PHAGE_Cronob_phiES15: hypothetical protein; PputGB1_3416; phage(gi401817595) | 7e-41 | Click |
| 30 | complement(3847681..3848724) | PHAGE_Salmon_SETP3: head morphogenesis protein; PputGB1_3417; phage(gi134288594) | 6e-35 | Click |
| 31 | complement(3848714..3850138) | PHAGE_Salmon_vB_SenS_Ent1: putative portal protein; PputGB1_3418; phage(gi423261849) | 6e-65 | Click |
| 32 | complement(3850147..3851448) | PHAGE_Pseudo_H105/1: phage terminase large subunit; PputGB1_3419; phage(gi327198525) | 1e-107 | Click |
| 33 | complement(3851435..3851896) | PHAGE_Salmon_vB_SosS_Oslo: hypothetical protein; PputGB1_3420; phage(gi399528759) | 8e-45 | Click |
| 34 | complement(3851928..3852536) | PHAGE_Cronob_ENT47670: putative transposase; PputGB1_3421; phage(gi431810514) | 4e-74 | Click |
| 35 | 3852611..3852940 | hypothetical protein; PputGB1_3422 | N/A | Click |
| 36 | complement(3852958..3853389) | PHAGE_Pseudo_KPP10: hypothetical protein; PputGB1_3423; phage(gi327198153) | 1e-26 | Click |
| 37 | complement(3853386..3853550) | hypothetical protein; PputGB1_3424 | N/A | Click |
| 38 | complement(3853601..3853864) | hypothetical protein; PputGB1_3425 | N/A | Click |
| 39 | complement(3853866..3854189) | peptidase M48, Ste24p; PputGB1_3426 | N/A | Click |
| 40 | complement(3854270..3854346) | tRNA | N/A | Click |
| 41 | complement(3854709..3855254) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp058; PputGB1_3427; phage(gi148912823) | 2e-36 | Click |
| 42 | complement(3855251..3855397) | hypothetical protein; PputGB1_3428 | N/A | Click |
| 43 | complement(3855394..3855999) | PHAGE_Pseudo_PAJU2: putative NinG; PputGB1_3429; phage(gi209552490) | 2e-52 | Click |
| 44 | complement(3855996..3856199) | hypothetical protein; PputGB1_3430 | N/A | Click |
| 45 | complement(3856196..3856357) | hypothetical protein; PputGB1_3431 | N/A | Click |
| 46 | complement(3856354..3856824) | hypothetical protein; PputGB1_3432 | N/A | Click |
| 47 | complement(3856817..3857071) | hypothetical protein; PputGB1_3433 | N/A | Click |
| 48 | complement(3857068..3857337) | PHAGE_Pseudo_AF: hypothetical protein; PputGB1_3434; phage(gi431810346) | 1e-06 | Click |
| 49 | complement(3857337..3857627) | hypothetical protein; PputGB1_3435 | N/A | Click |
| 50 | complement(3857627..3857818) | hypothetical protein; PputGB1_3436 | N/A | Click |
| 51 | complement(3857815..3858186) | PHAGE_Vibrio_KVP40: conserved hypothetical protein; PputGB1_3437; phage(gi34419388) | 8e-14 | Click |
| 52 | complement(3858186..3858992) | PHAGE_Entero_mEpX1: putative replication protein DnaC; PputGB1_3438; phage(gi428781919) | 2e-36 | Click |
| 53 | complement(3858982..3859731) | PHAGE_Entero_mEp460: replication protein; PputGB1_3439; phage(gi428782359) | 9e-37 | Click |
| 54 | complement(3859901..3860758) | PHAGE_Entero_phiP27: hypothetical protein P27p15; PputGB1_3440; phage(gi18249879) | 2e-51 | Click |
| 55 | complement(3861092..3861283) | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp61; PputGB1_3441; phage(gi209552480) | 2e-08 | Click |
| 56 | complement(3861311..3861535) | hypothetical protein; PputGB1_3442 | N/A | Click |
| 57 | 3861635..3862321 | PHAGE_Salmon_vB_SemP_Emek: C2 protein; PputGB1_3443; phage(gi399498836) | 3e-33 | Click |
Region 4, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3864211..3864224 | attL TGCAAGAAGTGGAG | N/A | Click |
| 2 | 3872932..3874791 | PHAGE_Pseudo_F116: DNA cytosine methyltransferase; PputGB1_3461; phage(gi56692910) | 0.0 | Click |
| 3 | 3875133..3875585 | hypothetical protein; PputGB1_3462 | N/A | Click |
| 4 | 3875582..3875878 | PHAGE_Deftia_14: hypothetical protein; PputGB1_3463; phage(gi282599099) | 6e-06 | Click |
| 5 | complement(3875919..3876218) | hypothetical protein; PputGB1_3464 | N/A | Click |
| 6 | 3876400..3876894 | PHAGE_Entero_mEp460: hypothetical protein; PputGB1_3465; phage(gi428782345) | 6e-22 | Click |
| 7 | 3876891..3877142 | hypothetical protein; PputGB1_3466 | N/A | Click |
| 8 | 3877139..3877684 | PHAGE_Pseudo_D3: Orf65; PputGB1_3467; phage(gi9635656) | 1e-17 | Click |
| 9 | 3877672..3878004 | hypothetical protein; PputGB1_3468 | N/A | Click |
| 10 | 3878048..3878239 | hypothetical protein; PputGB1_3469 | N/A | Click |
| 11 | 3878290..3878706 | hypothetical protein; PputGB1_3470 | N/A | Click |
| 12 | 3878744..3879478 | PHAGE_Pseudo_F10: Putative metallophosphoesterase; PputGB1_3471; phage(gi148912821) | 1e-53 | Click |
| 13 | 3879494..3879670 | hypothetical protein; PputGB1_3472 | N/A | Click |
| 14 | 3879960..3881138 | PHAGE_Burkho_phi52237: prophage integrase; PputGB1_3473; phage(gi72537678) | 9e-27 | Click |
| 15 | complement(3881208..3881284) | tRNA | N/A | Click |
| 16 | complement(3881386..3881742) | MerR family transcriptional regulator; PputGB1_3474 | N/A | Click |
| 17 | complement(3881723..3882025) | PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; PputGB1_3475; phage(gi9630187) | 2e-15 | Click |
| 18 | 3890336..3890349 | attR TGCAAGAAGTGGAG | N/A | Click |
Region 5, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 5298906..5298927 | attL GGCATTCCAAATGGCATTCCAA | N/A | Click |
| 2 | 5298977..5300233 | PHAGE_Entero_P4: integrase; PputGB1_4740; phage(gi9627511) | 6e-64 | Click |
| 3 | 5300575..5300904 | PHAGE_Vibrio_VP882: phage-related tail protein; PputGB1_4741; phage(gi126010872) | 1e-09 | Click |
| 4 | 5300976..5301944 | PHAGE_Mycoba_Nigel: gp88; PputGB1_4742; phage(gi194100601) | 3e-13 | Click |
| 5 | 5302021..5303025 | PHAGE_Bacill_1: Putative endonuclease; PputGB1_4743; phage(gi155042966) | 3e-49 | Click |
| 6 | 5303103..5304017 | hypothetical protein; PputGB1_4744 | N/A | Click |
| 7 | 5304068..5304556 | DNA repair protein RadC; PputGB1_4745 | N/A | Click |
| 8 | complement(5304732..5306126) | PHAGE_Burkho_KL3: gp45; PputGB1_4746; phage(gi327198090) | 2e-17 | Click |
| 9 | complement(5306428..5306904) | PHAGE_Burkho_KL3: gp46; PputGB1_4747; phage(gi327198091) | 2e-38 | Click |
| 10 | complement(5306912..5308255) | PHAGE_Burkho_KL3: gp47; PputGB1_4748; phage(gi327198092) | 3e-109 | Click |
| 11 | complement(5308311..5308766) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; PputGB1_4749; phage(gi16131377) | 4e-32 | Click |
| 12 | 5317481..5317502 | attR GGCATTCCAAATGGCATTCCAA | N/A | Click |