| Definition | Shewanella baltica OS185 chromosome, complete genome. |
|---|---|
| Accession | NC_009665 |
| Length | 5,229,686 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 28 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 866056..866085 | attL ACCTTTTCCATTGCGCCCATGCTGGATTGG | N/A | Click |
| 2 | complement(872722..872982) | PHAGE_Entero_mEp460: hypothetical protein; Shew185_0734; phage(gi428782341) | 7e-15 | Click |
| 3 | complement(872979..873332) | hypothetical protein; Shew185_0735 | N/A | Click |
| 4 | 873943..874230 | hypothetical protein; Shew185_0736 | N/A | Click |
| 5 | 874352..874777 | GCN5-like N-acetyltransferase; Shew185_0737 | N/A | Click |
| 6 | 875505..876422 | PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; Shew185_0738; phage(gi9631364) | 5e-06 | Click |
| 7 | 877133..877423 | PHAGE_Emilia_86: hypothetical protein EhV367; Shew185_0739; phage(gi73852841) | 1e-06 | Click |
| 8 | complement(877506..878228) | PHAGE_Haemop_Aaphi23: putative CI protein; Shew185_0740; phage(gi31544010) | 1e-47 | Click |
| 9 | 878288..878491 | PHAGE_Salico_CGphi29: hypothetical protein; Shew185_0741; phage(gi472340163) | 6e-09 | Click |
| 10 | 878523..879131 | PHAGE_Pseudo_phi297: hypothetical protein; Shew185_0742; phage(gi374531276) | 3e-11 | Click |
| 11 | 879296..880045 | PHAGE_Entero_mEp460: replication protein; Shew185_0743; phage(gi428782359) | 4e-38 | Click |
| 12 | 880042..880728 | PHAGE_Pseudo_PAJU2: putative replication protein P; Shew185_0744; phage(gi209552483) | 1e-21 | Click |
| 13 | 880718..881974 | PHAGE_Entero_mEp237: integrase; Shew185_0745; phage(gi435439292) | 5e-07 | Click |
| 14 | 882030..882248 | XRE family transcriptional regulator; Shew185_0746 | N/A | Click |
| 15 | 882235..882588 | hypothetical protein; Shew185_0747 | N/A | Click |
| 16 | 882597..883211 | PHAGE_Ectoca_1: EsV-1-139; Shew185_0748; phage(gi13242610) | 1e-07 | Click |
| 17 | 884132..884656 | PHAGE_Xantho_OP1: putative lysozyme; Shew185_0749; phage(gi84662620) | 8e-21 | Click |
| 18 | 884646..885149 | PHAGE_Burkho_phiE202: gp42, protein LysB; Shew185_0750; phage(gi134288770) | 3e-05 | Click |
| 19 | 885260..885595 | hypothetical protein; Shew185_0751 | N/A | Click |
| 20 | 885549..886082 | PHAGE_Entero_N15: gp1; Shew185_0752; phage(gi9630465) | 2e-37 | Click |
| 21 | 886057..888054 | PHAGE_Pseudo_F10: Putative large subunit (GpA homolog) of DNA packaging dimer; Shew185_0753; phage(gi148912767) | 0.0 | Click |
| 22 | 888084..888290 | PHAGE_Entero_mEp460: hypothetical protein; Shew185_0754; phage(gi428782319) | 2e-10 | Click |
| 23 | 888340..889914 | PHAGE_Entero_mEp460: portal protein; Shew185_0755; phage(gi428782320) | 2e-127 | Click |
| 24 | 889886..891901 | PHAGE_Entero_mEp460: putative protease/scaffold protein; Shew185_0756; phage(gi428782321) | 0.0 | Click |
| 25 | 891995..892318 | PHAGE_Entero_mEp460: hypothetical protein; putative; phage RecA/RadA recombinase; Shew185_0757(gi428782322) | 1e-13 | Click |
| 26 | 892311..892676 | hypothetical protein; Shew185_0758 | N/A | Click |
| 27 | 892679..893236 | hypothetical protein; Shew185_0759 | N/A | Click |
| 28 | 893270..893695 | hypothetical protein; Shew185_0760 | N/A | Click |
| 29 | 893692..894411 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; Shew185_0761; phage(gi148912775) | 7e-15 | Click |
| 30 | 908359..908388 | attR ACCTTTTCCATTGCGCCCATGCTGGATTGG | N/A | Click |
Region 2, total : 24 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2200141..2200152 | attL ACACTGATTTTA | N/A | Click |
| 2 | 2204585..2205532 | PHAGE_Ostreo_2: DNA ligase, putative; Shew185_1838; phage(gi314055264) | 3e-12 | Click |
| 3 | complement(2205577..2206647) | hypothetical protein; Shew185_1839 | N/A | Click |
| 4 | 2206838..2207997 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; Shew185_1840; phage(gi24373866) | 1e-151 | Click |
| 5 | complement(2208569..2209753) | PHAGE_Entero_mEp235: integrase; Shew185_1841; phage(gi428781836) | 7e-41 | Click |
| 6 | complement(2209743..2209973) | excisionase; Shew185_1842 | N/A | Click |
| 7 | complement(2209970..2210326) | PHAGE_Vibrio_ICP1: hypothetical protein; Shew185_1843; phage(gi325171152) | 8e-25 | Click |
| 8 | complement(2210505..2210819) | hypothetical protein; Shew185_1844 | N/A | Click |
| 9 | complement(2210816..2211136) | PHAGE_Entero_mEp213: hypothetical protein; Shew185_1845; phage(gi428782634) | 4e-13 | Click |
| 10 | complement(2211133..2211363) | hypothetical protein; Shew185_1846 | N/A | Click |
| 11 | complement(2211360..2211638) | hypothetical protein; Shew185_1847 | N/A | Click |
| 12 | complement(2211639..2211917) | hypothetical protein; Shew185_1848 | N/A | Click |
| 13 | complement(2211914..2212978) | PHAGE_Salmon_SPN1S: putative bacteriophage protein; Shew185_1849; phage(gi374531224) | 3e-27 | Click |
| 14 | complement(2212975..2213604) | PHAGE_Mycoba_Myrna: gp63; Shew185_1850; phage(gi203454665) | 5e-23 | Click |
| 15 | complement(2213635..2213982) | hypothetical protein; Shew185_1851 | N/A | Click |
| 16 | complement(2214109..2214471) | hypothetical protein; Shew185_1852 | N/A | Click |
| 17 | complement(2215127..2215792) | PHAGE_Entero_IME10: repressor protein; Shew185_1853; phage(gi422934295) | 5e-48 | Click |
| 18 | 2215905..2216195 | PHAGE_Entero_ST64T: Cro; Shew185_1854; phage(gi24371558) | 1e-09 | Click |
| 19 | 2216227..2216850 | PHAGE_Pseudo_phi297: hypothetical protein; Shew185_1855; phage(gi374531276) | 1e-10 | Click |
| 20 | 2216856..2217182 | PHAGE_Vibrio_SIO_2: hypothetical protein; Shew185_1856; phage(gi371496373) | 5e-08 | Click |
| 21 | 2217346..2218083 | hypothetical protein; Shew185_1857 | N/A | Click |
| 22 | 2218228..2219085 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp46; Shew185_1858; phage(gi148609428) | 4e-47 | Click |
| 23 | 2219082..2219768 | PHAGE_Pseudo_PAJU2: putative replication protein P; Shew185_1859; phage(gi209552483) | 9e-22 | Click |
| 24 | 2219758..2219982 | hypothetical protein; Shew185_1860 | N/A | Click |
| 25 | 2219983..2221251 | PHAGE_Sulfit_pCB2047_C: integrase; Shew185_1861; phage(gi472341771) | 8e-08 | Click |
| 26 | 2228191..2228202 | attR ACACTGATTTTA | N/A | Click |
Region 3, total : 40 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2481178..2481189 | attL GATTTAATCGAG | N/A | Click |
| 2 | complement(2481181..2481924) | PHAGE_Pseudo_MP22: c repressor; Shew185_2067; phage(gi157834973) | 2e-39 | Click |
| 3 | 2482434..2484650 | PHAGE_Rhodov_RS1: integrase; Shew185_2068; phage(gi472342882) | 1e-56 | Click |
| 4 | 2484711..2485433 | PHAGE_Rhodov_RS1: transposase; Shew185_2069; phage(gi472342883) | 4e-34 | Click |
| 5 | 2485490..2485975 | hypothetical protein; Shew185_2070 | N/A | Click |
| 6 | 2485972..2486487 | PHAGE_Rhodov_RS1: hypothetical protein; Shew185_2071; phage(gi472342885) | 4e-15 | Click |
| 7 | 2486489..2486701 | hypothetical protein; Shew185_2072 | N/A | Click |
| 8 | 2486703..2487338 | PHAGE_Pseudo_B3: hypothetical protein B3ORF6; Shew185_2073; phage(gi56692574) | 1e-48 | Click |
| 9 | 2487358..2487666 | hypothetical protein; Shew185_2074 | N/A | Click |
| 10 | 2487757..2487978 | hypothetical protein; Shew185_2075 | N/A | Click |
| 11 | 2487972..2488592 | PHAGE_Entero_Mu: hypothetical protein Mup16; Shew185_2076; phage(gi9633506) | 1e-20 | Click |
| 12 | 2488585..2489040 | PHAGE_Entero_Mu: putative transcription regulator; Shew185_2077; phage(gi9633511) | 5e-17 | Click |
| 13 | 2489087..2489617 | hypothetical protein; Shew185_2078 | N/A | Click |
| 14 | 2489656..2490102 | hypothetical protein; Shew185_2079 | N/A | Click |
| 15 | complement(2490149..2490877) | hypothetical protein; Shew185_2080 | N/A | Click |
| 16 | 2491016..2491339 | hypothetical protein; Shew185_2081 | N/A | Click |
| 17 | 2491329..2491895 | PHAGE_Salmon_vB_SemP_Emek: lysin; Shew185_2082; phage(gi399498856) | 7e-19 | Click |
| 18 | 2491892..2492476 | hypothetical protein; Shew185_2083 | N/A | Click |
| 19 | 2492573..2492797 | zinc finger-like protein; Shew185_2084 | N/A | Click |
| 20 | 2492794..2493129 | hypothetical protein; Shew185_2085 | N/A | Click |
| 21 | 2493129..2493425 | PHAGE_Entero_Mu: hypothetical protein Mup26; Shew185_2086; phage(gi9633517) | 5e-17 | Click |
| 22 | 2493428..2493997 | PHAGE_Entero_Mu: hypothetical protein Mup27; Shew185_2087; phage(gi9633518) | 2e-52 | Click |
| 23 | 2494142..2495782 | PHAGE_Entero_Mu: putative portal protein; Shew185_2088; phage(gi9633519) | 2e-127 | Click |
| 24 | 2495782..2497368 | PHAGE_Entero_Mu: hypothetical protein Mup29; Shew185_2089; phage(gi9633520) | 3e-123 | Click |
| 25 | 2497361..2498674 | PHAGE_Entero_Mu: virion morphogenesis late F orf; Shew185_2090; phage(gi9633521) | 3e-96 | Click |
| 26 | 2498679..2499131 | PHAGE_Entero_Mu: putative virion morphogenesis protein; Shew185_2091; phage(gi9633522) | 5e-22 | Click |
| 27 | complement(2499173..2500054) | hypothetical protein; Shew185_2092 | N/A | Click |
| 28 | 2500354..2501445 | hypothetical protein; Shew185_2093 | N/A | Click |
| 29 | 2501446..2501874 | hypothetical protein; Shew185_2094 | N/A | Click |
| 30 | 2501876..2502583 | hypothetical protein; Shew185_2095 | N/A | Click |
| 31 | 2502679..2503806 | PHAGE_Entero_Mu: putative protease protein; Shew185_2096; phage(gi9633523) | 2e-59 | Click |
| 32 | 2503861..2505020 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; Shew185_2097; phage(gi24373866) | 1e-151 | Click |
| 33 | 2505074..2505994 | PHAGE_Entero_Mu: major head subunit; Shew185_2098; phage(gi9633525) | 4e-83 | Click |
| 34 | 2506077..2506616 | Rho termination factor domain-containing protein; Shew185_2099 | N/A | Click |
| 35 | 2506619..2507074 | PHAGE_Entero_Mu: hypothetical protein Mup36; Shew185_2100; phage(gi9633527) | 1e-19 | Click |
| 36 | 2507074..2507514 | hypothetical protein; Shew185_2101 | N/A | Click |
| 37 | 2507535..2508281 | PHAGE_Stenot_S1: putative tail protein a; Shew185_2102; phage(gi213163914) | 7e-10 | Click |
| 38 | 2508393..2512316 | PHAGE_Mannhe_phiMHaA1: tail protein T; Shew185_2103; phage(gi109289951) | 3e-29 | Click |
| 39 | 2512313..2512678 | hypothetical protein; Shew185_2104 | N/A | Click |
| 40 | 2512706..2515180 | PHAGE_Stenot_S1: putative tail protein b; Shew185_2105; phage(gi213163918) | 9e-38 | Click |
| 41 | 2515192..2516196 | PHAGE_Stenot_S1: hypothetical protein StPS1_gp20; Shew185_2106; phage(gi213163919) | 1e-10 | Click |
| 42 | 2525864..2525875 | attR GATTTAATCGAG | N/A | Click |
Region 4, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2725465..2728215) | PHAGE_Lactoc_949: putative DNA gyrase subunit A-topoisomerase; Shew185_2287; phage(gi327197938) | 1e-66 | Click |
| 2 | 2726324..2726336 | attL GTAATGCGCTCGC | N/A | Click |
| 3 | 2728601..2729311 | PHAGE_Microm_12T: hypothetical protein; Shew185_2288; phage(gi472342811) | 1e-05 | Click |
| 4 | 2729313..2729984 | HAD family hydrolase; Shew185_2289 | N/A | Click |
| 5 | 2730511..2732799 | PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, alpha subunit; Shew185_2290; phage(gi410491488) | 0.0 | Click |
| 6 | 2732853..2734013 | PHAGE_Salmon_SSU5: putative ribonucleotide-diphosphate reductase, beta subunit; Shew185_2291; phage(gi410491489) | 1e-121 | Click |
| 7 | 2734051..2734473 | PHAGE_Pseudo_OBP: putative 2Fe-2S ferredoxin; Shew185_2292; phage(gi371671579) | 2e-13 | Click |
| 8 | complement(2734774..2736792) | PHAGE_Acanth_mimivirus: putative amine oxidase; Shew185_2293; phage(gi311978057) | 1e-05 | Click |
| 9 | 2736958..2738805 | PHAGE_Erwini_4: putative prohead protease; Shew185_2294; phage(gi219681309) | 2e-16 | Click |
| 10 | 2738943..2739956 | cytoplasmic asparaginase I; Shew185_2295 | N/A | Click |
| 11 | 2739799..2739811 | attR GTAATGCGCTCGC | N/A | Click |
| 12 | complement(2740026..2740829) | PROPHAGE_Escher_CFT073: transposase insF; Shew185_2296; phage(gi26249410) | 9e-24 | Click |
Region 5, total : 23 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3038596..3038607 | attL TCAACATCAGCC | N/A | Click |
| 2 | 3050957..3050968 | attL AATAATAATTTG | N/A | Click |
| 3 | complement(3053431..3054699) | PHAGE_Sulfit_pCB2047_C: integrase; Shew185_2555; phage(gi472341771) | 4e-08 | Click |
| 4 | complement(3054700..3054924) | hypothetical protein; Shew185_2556 | N/A | Click |
| 5 | complement(3054914..3055600) | PHAGE_Pseudo_PAJU2: putative replication protein P; Shew185_2557; phage(gi209552483) | 3e-21 | Click |
| 6 | complement(3055597..3056388) | PHAGE_Salmon_ST64B: putative replication protein; Shew185_2558; phage(gi23505486) | 5e-43 | Click |
| 7 | complement(3056533..3057300) | hypothetical protein; Shew185_2559 | N/A | Click |
| 8 | complement(3057438..3057764) | PHAGE_Vibrio_SIO_2: hypothetical protein; Shew185_2560; phage(gi371496373) | 2e-08 | Click |
| 9 | complement(3057770..3058393) | PHAGE_Pseudo_phi297: hypothetical protein; Shew185_2561; phage(gi374531276) | 1e-10 | Click |
| 10 | complement(3058437..3058631) | PHAGE_Entero_HK629: prophage antirepressor; Shew185_2562; phage(gi428782058) | 2e-08 | Click |
| 11 | 3058770..3059447 | PHAGE_Erwini_phiEt88: phage repressor protein; Shew185_2563; phage(gi327198606) | 6e-47 | Click |
| 12 | complement(3059786..3060517) | hypothetical protein; Shew185_2564 | N/A | Click |
| 13 | complement(3060649..3061641) | PHAGE_Salmon_ST160: regulatory protein; Shew185_2565; phage(gi318065923) | 1e-20 | Click |
| 14 | complement(3062134..3062982) | PHAGE_Lactob_LF1: chromosome partitioning ATPase; Shew185_2566; phage(gi418489414) | 2e-21 | Click |
| 15 | complement(3063108..3064031) | hypothetical protein; Shew185_2567 | N/A | Click |
| 16 | 3064615..3064626 | attR AATAATAATTTG | N/A | Click |
| 17 | 3064889..3065251 | hypothetical protein; Shew185_2568 | N/A | Click |
| 18 | 3065378..3065725 | hypothetical protein; Shew185_2569 | N/A | Click |
| 19 | 3065756..3066385 | PHAGE_Mycoba_Myrna: gp63; Shew185_2570; phage(gi203454665) | 4e-24 | Click |
| 20 | 3066382..3067446 | PHAGE_Salmon_SPN1S: putative bacteriophage protein; Shew185_2571; phage(gi374531224) | 5e-27 | Click |
| 21 | 3067443..3067736 | hypothetical protein; Shew185_2572 | N/A | Click |
| 22 | 3067737..3068015 | hypothetical protein; Shew185_2573 | N/A | Click |
| 23 | 3068012..3068242 | hypothetical protein; Shew185_2574 | N/A | Click |
| 24 | 3068239..3068571 | PHAGE_Entero_mEp213: hypothetical protein; Shew185_2575; phage(gi428782634) | 4e-13 | Click |
| 25 | 3068706..3068927 | hypothetical protein; Shew185_2576 | N/A | Click |
| 26 | 3068933..3070117 | PHAGE_Entero_HK629: integrase; Shew185_2577; phage(gi428782041) | 2e-09 | Click |
| 27 | 3083661..3083672 | attR TCAACATCAGCC | N/A | Click |
Region 6, total : 25 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3991119..3991131 | attL TCCTCACTCGCCA | N/A | Click |
| 2 | 4002775..4002786 | attL CCAAACCTATTA | N/A | Click |
| 3 | 4002938..4003897 | PHAGE_Staphy_2: integrase; Shew185_3360; phage(gi156603950) | 8e-12 | Click |
| 4 | complement(4004267..4004626) | hypothetical protein; Shew185_3361 | N/A | Click |
| 5 | complement(4004616..4004831) | XRE family transcriptional regulator; Shew185_3362 | N/A | Click |
| 6 | complement(4004904..4006172) | PHAGE_Sulfit_pCB2047_C: integrase; Shew185_3363; phage(gi472341771) | 8e-08 | Click |
| 7 | complement(4006173..4006397) | hypothetical protein; Shew185_3364 | N/A | Click |
| 8 | complement(4006387..4007073) | PHAGE_Pseudo_PAJU2: putative replication protein P; Shew185_3365; phage(gi209552483) | 2e-21 | Click |
| 9 | complement(4007070..4007906) | PHAGE_Pectob_ZF40: putative replication protein; Shew185_3366; phage(gi422936654) | 4e-30 | Click |
| 10 | complement(4008057..4008824) | hypothetical protein; Shew185_3367 | N/A | Click |
| 11 | complement(4008990..4009325) | PHAGE_Vibrio_SIO_2: hypothetical protein; Shew185_3368; phage(gi371496373) | 2e-08 | Click |
| 12 | complement(4009322..4009945) | PHAGE_Pseudo_phi297: hypothetical protein; Shew185_3369; phage(gi374531276) | 4e-10 | Click |
| 13 | complement(4009989..4010183) | PHAGE_Salico_CGphi29: hypothetical protein; Shew185_3370; phage(gi472340163) | 5e-09 | Click |
| 14 | 4010289..4010978 | PHAGE_Haemop_Aaphi23: putative CI protein; Shew185_3371; phage(gi31544010) | 7e-49 | Click |
| 15 | complement(4011165..4011971) | PHAGE_Salmon_SSU5: hypothetical protein; Shew185_3372; phage(gi410491447) | 2e-06 | Click |
| 16 | complement(4012086..4012571) | hypothetical protein; Shew185_3373 | N/A | Click |
| 17 | complement(4012672..4013811) | hypothetical protein; Shew185_3374 | N/A | Click |
| 18 | complement(4013931..4014719) | hypothetical protein; Shew185_3375 | N/A | Click |
| 19 | 4014889..4014900 | attR CCAAACCTATTA | N/A | Click |
| 20 | 4015276..4015638 | hypothetical protein; Shew185_3376 | N/A | Click |
| 21 | 4015770..4016117 | hypothetical protein; Shew185_3377 | N/A | Click |
| 22 | 4016148..4016441 | hypothetical protein; Shew185_3378 | N/A | Click |
| 23 | 4016442..4016720 | hypothetical protein; Shew185_3379 | N/A | Click |
| 24 | 4016717..4016947 | hypothetical protein; Shew185_3380 | N/A | Click |
| 25 | 4016944..4017552 | PHAGE_Vibrio_vB_VpaM_MAR: hypothetical protein; Shew185_3381; phage(gi428782758) | 6e-46 | Click |
| 26 | 4017549..4017869 | PHAGE_Entero_mEp213: hypothetical protein; Shew185_3382; phage(gi428782634) | 2e-13 | Click |
| 27 | 4017928..4018143 | PHAGE_Pectob_ZF40: hypothetical protein; Shew185_3383; phage(gi422936643) | 3e-06 | Click |
| 28 | 4018136..4019152 | PHAGE_Pectob_ZF40: putative integrase; Shew185_3384; phage(gi422936642) | 4e-83 | Click |
| 29 | 4022294..4022306 | attR TCCTCACTCGCCA | N/A | Click |