| Definition | Pseudomonas aeruginosa PA7, complete genome. |
|---|---|
| Accession | NC_009656 |
| Length | 6,588,339 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 44 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 678065..678076 | attL GCGTGGGCGCAG | N/A | Click |
| 2 | complement(686460..687581) | PHAGE_Brocho_BL3: gp26; PSPA7_0677; phage(gi327409418) | 2e-06 | Click |
| 3 | 687694..687706 | attL GAACATGCCTGTT | N/A | Click |
| 4 | complement(687843..687992) | phage integrase family site specific recombinase; PSPA7_0678 | N/A | Click |
| 5 | 688548..688560 | attR GAACATGCCTGTT | N/A | Click |
| 6 | 688720..689319 | hypothetical protein; PSPA7_0679 | N/A | Click |
| 7 | complement(689348..690319) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_46; PSPA7_0680; phage(gi148727175) | 4e-61 | Click |
| 8 | complement(690304..691002) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_46; PSPA7_0681; phage(gi148727175) | 8e-34 | Click |
| 9 | complement(691002..691541) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_45; PSPA7_0682; phage(gi148727174) | 3e-25 | Click |
| 10 | complement(691538..692458) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_44; PSPA7_0683; phage(gi148727173) | 1e-22 | Click |
| 11 | complement(692455..693165) | PHAGE_Ralsto_phiRSA1: tail fiber assembly-like protein; PSPA7_0684; phage(gi145708099) | 2e-11 | Click |
| 12 | complement(693179..695143) | PHAGE_Aeromo_phiO18P: putative tail fiber protein; PSPA7_0685; phage(gi158518662) | 2e-35 | Click |
| 13 | complement(695155..695679) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_41; PSPA7_0686; phage(gi148727169) | 7e-44 | Click |
| 14 | complement(695672..696844) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_40; PSPA7_0687; phage(gi148727168) | 6e-97 | Click |
| 15 | complement(696841..697161) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_39; PSPA7_0688; phage(gi148727167) | 2e-24 | Click |
| 16 | complement(697158..699212) | PHAGE_Aeromo_phiO18P: putative tail tape measure protein; PSPA7_0689; phage(gi148727166) | 4e-106 | Click |
| 17 | complement(699227..699367) | hypothetical protein; PSPA7_0690 | N/A | Click |
| 18 | complement(699391..699678) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_36; PSPA7_0691; phage(gi148727164) | 5e-09 | Click |
| 19 | complement(699675..700160) | PHAGE_Burkho_BcepMigl: Rz-like lysis protein; PSPA7_0692; phage(gi431809931) | 4e-19 | Click |
| 20 | complement(700157..700618) | PHAGE_Entero_cdtI: lysin; PSPA7_0693; phage(gi148609440) | 2e-31 | Click |
| 21 | complement(700615..700869) | hypothetical protein; PSPA7_0694 | N/A | Click |
| 22 | complement(700920..701129) | PHAGE_Entero_PsP3: gp34; PSPA7_0695; phage(gi41057386) | 6e-07 | Click |
| 23 | complement(701129..701578) | PHAGE_Aeromo_phiO18P: putative tail tube protein; PSPA7_0696; phage(gi148727159) | 2e-49 | Click |
| 24 | complement(701582..702697) | PHAGE_Aeromo_phiO18P: putative tail sheath protein; PSPA7_0697; phage(gi148727158) | 3e-87 | Click |
| 25 | complement(702709..703374) | PHAGE_Aeromo_phiO18P: putative tail completion protein; PSPA7_0698; phage(gi148727157) | 1e-30 | Click |
| 26 | complement(703367..703804) | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_27; PSPA7_0699; phage(gi148727156) | 2e-16 | Click |
| 27 | complement(703806..704267) | PHAGE_Aeromo_phiO18P: putative head completion protein; PSPA7_0700; phage(gi148727155) | 9e-17 | Click |
| 28 | complement(704365..705102) | PHAGE_Aeromo_phiO18P: putative terminase small subunit; PSPA7_0701; phage(gi148727154) | 7e-28 | Click |
| 29 | complement(705099..706121) | PHAGE_Burkho_phiE202: gp2, phage major capsid protein, P2 family; PSPA7_0702; phage(gi134288740) | 1e-67 | Click |
| 30 | complement(706121..707266) | PHAGE_Haemop_HP1: hypothetical protein HP1p22; PSPA7_0703; phage(gi9628621) | 2e-28 | Click |
| 31 | 707232..709280 | PHAGE_Aeromo_phiO18P: putative terminase large subunit; PSPA7_0704; phage(gi148727151) | 5e-164 | Click |
| 32 | 709339..710046 | PHAGE_Aeromo_phiO18P: putative portal protein; PSPA7_0705; phage(gi148727149) | 8e-56 | Click |
| 33 | complement(710328..710537) | hypothetical protein; PSPA7_0706 | N/A | Click |
| 34 | complement(710896..711177) | hypothetical protein; PSPA7_0707 | N/A | Click |
| 35 | complement(711174..711404) | hypothetical protein; PSPA7_0708 | N/A | Click |
| 36 | complement(711401..711616) | hypothetical protein; PSPA7_0709 | N/A | Click |
| 37 | complement(712084..712440) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp41; PSPA7_0710; phage(gi17313258) | 1e-12 | Click |
| 38 | complement(712456..712857) | hypothetical protein; PSPA7_0711 | N/A | Click |
| 39 | complement(712829..713029) | hypothetical protein; PSPA7_0712 | N/A | Click |
| 40 | complement(713460..716153) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp40; PSPA7_0713; phage(gi17313257) | 7e-121 | Click |
| 41 | complement(716164..716406) | PHAGE_Pasteu_F108: Cox; PSPA7_0714; phage(gi109302900) | 4e-06 | Click |
| 42 | 716500..716736 | PHAGE_Yersin_413C: gpC; PSPA7_0715; phage(gi30065734) | 1e-17 | Click |
| 43 | 716741..717925 | PHAGE_Aeromo_phiO18P: putative integrase; PSPA7_0716; phage(gi148727179) | 6e-69 | Click |
| 44 | complement(717868..717944) | tRNA | N/A | Click |
| 45 | complement(717961..721698) | PHAGE_Pseudo_YuA: hypothetical protein; PSPA7_0717; phage(gi162135126) | 4e-09 | Click |
| 46 | complement(721805..723658) | PHAGE_Synech_S_CBS1: group2 RNA polymerase sigma factor; PSPA7_0718; phage(gi356870821) | 6e-37 | Click |
| 47 | 723641..723784 | hypothetical protein; PSPA7_0720 | N/A | Click |
| 48 | complement(723738..725729) | PHAGE_Helico_phiHP33: DNA primase; PSPA7_0719; phage(gi371671350) | 3e-45 | Click |
| 49 | 725751..725762 | attR GCGTGGGCGCAG | N/A | Click |
Region 2, total : 35 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(760146..760460) | PHAGE_Burkho_AH2: excisionase; PSPA7_0754; phage(gi399529070) | 6e-07 | Click |
| 2 | complement(760561..761331) | PHAGE_Pseudo_F116: transcriptional regulator; PSPA7_0755; phage(gi56692918) | 7e-56 | Click |
| 3 | 761789..761989 | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp42; PSPA7_0756; phage(gi17313259) | 3e-10 | Click |
| 4 | 762035..762394 | hypothetical protein; PSPA7_0757 | N/A | Click |
| 5 | 762849..763202 | hypothetical protein; PSPA7_0758 | N/A | Click |
| 6 | 763224..763739 | hypothetical protein; PSPA7_0759 | N/A | Click |
| 7 | 763736..764293 | PHAGE_Pseudo_phiCTX: predicted baseplate; PSPA7_0760; phage(gi17313235) | 6e-20 | Click |
| 8 | 764445..764771 | PHAGE_Salmon_RE_2010: baseplate wedge subunit; PSPA7_0761; phage(gi418489710) | 2e-15 | Click |
| 9 | 764768..765655 | PHAGE_Salmon_RE_2010: baseplate assembly protein J; PSPA7_0762; phage(gi418489711) | 3e-89 | Click |
| 10 | 765648..766262 | PHAGE_Salmon_RE_2010: tail protein I; PSPA7_0763; phage(gi418489712) | 2e-56 | Click |
| 11 | 766253..767452 | PHAGE_Salmon_RE_2010: tail fiber protein; PSPA7_0764; phage(gi418489713) | 4e-61 | Click |
| 12 | 767939..769099 | PHAGE_Vibrio_vB_VpaM_MAR: tail sheath protein; PSPA7_0765; phage(gi428782746) | 2e-89 | Click |
| 13 | 769112..769615 | PHAGE_Vibrio_vB_VpaM_MAR: tail tube protein; PSPA7_0766; phage(gi428782747) | 2e-32 | Click |
| 14 | 769630..769974 | hypothetical protein; PSPA7_0767 | N/A | Click |
| 15 | 769928..770053 | hypothetical protein; PSPA7_0768 | N/A | Click |
| 16 | 770147..772411 | PHAGE_Vibrio_VP882: phage-related tail protein; PSPA7_0769; phage(gi126010872) | 6e-17 | Click |
| 17 | 772421..773290 | PHAGE_Vibrio_vB_VpaM_MAR: putative tail protein; PSPA7_0770; phage(gi428782751) | 3e-15 | Click |
| 18 | 773265..773471 | PHAGE_Salmon_RE_2010: tail component protein; PSPA7_0771; phage(gi418489702) | 6e-07 | Click |
| 19 | 773529..774524 | PHAGE_Salmon_RE_2010: gene D protein; PSPA7_0772; phage(gi418489726) | 6e-47 | Click |
| 20 | 774549..775178 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PSPA7_0773; phage(gi148912826) | 6e-49 | Click |
| 21 | 775175..775537 | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp28; PSPA7_0774; phage(gi209552447) | 7e-23 | Click |
| 22 | 775534..775791 | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_0775; phage(gi374531310) | 4e-23 | Click |
| 23 | 775833..776123 | hypothetical protein; PSPA7_0776 | N/A | Click |
| 24 | 776111..776605 | PHAGE_Pseudo_vB_PaeS_PMG1: putative major tail protein; PSPA7_0777; phage(gi374531661) | 7e-55 | Click |
| 25 | 776617..776964 | hypothetical protein; PSPA7_0778 | N/A | Click |
| 26 | 776994..777248 | PHAGE_Pseudo_vB_PaeS_PMG1: hypothetical protein; PSPA7_0779; phage(gi374531663) | 2e-12 | Click |
| 27 | 777295..779133 | PHAGE_Entero_HK542: tail length tape measure protein; PSPA7_0780; phage(gi428783358) | 1e-24 | Click |
| 28 | 779126..779467 | PHAGE_Entero_mEp390: minor tail protein; PSPA7_0781; phage(gi428782678) | 1e-16 | Click |
| 29 | 779475..780170 | PHAGE_Burkho_2: gp18, phage minor tail protein L; PSPA7_0782; phage(gi134288683) | 5e-66 | Click |
| 30 | 780173..780943 | PHAGE_Burkho_KS9: tail component protein gp17; PSPA7_0783; phage(gi255033748) | 4e-56 | Click |
| 31 | 780998..781600 | PHAGE_Escher_HK639: tail assembly protein; PSPA7_0784; phage(gi356870622) | 3e-53 | Click |
| 32 | 781659..785324 | PHAGE_Entero_HK106: central tail fiber J; PSPA7_0785; phage(gi428783299) | 0.0 | Click |
| 33 | 786308..786442 | hypothetical protein; PSPA7_0786 | N/A | Click |
| 34 | 786573..787622 | PHAGE_Pseudo_LUZ7: hypothetical protein PP-LUZ7_gp056; PSPA7_0787; phage(gi282599448) | 3e-57 | Click |
| 35 | 787921..788145 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp027; PSPA7_0788; phage(gi148912792) | 2e-28 | Click |
Region 3, total : 165 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2408132..2409316 | PHAGE_Feldma_virus: putative sensor histidine kinase; PSPA7_2359; phage(gi197322366) | 4e-07 | Click |
| 2 | 2409313..2409795 | hypothetical protein; PSPA7_2360 | N/A | Click |
| 3 | complement(2409879..2410802) | PHAGE_Prochl_P_SSP3: transaldolase; PSPA7_2361; phage(gi472343185) | 3e-13 | Click |
| 4 | complement(2410881..2411885) | tRNA-dihydrouridine synthase A; PSPA7_2362 | N/A | Click |
| 5 | 2411703..2411715 | attL GCGCTGGCGGTCG | N/A | Click |
| 6 | 2411989..2413095 | PHAGE_Burkho_DC1: integrase; PSPA7_2363; phage(gi401723020) | 3e-102 | Click |
| 7 | complement(2413105..2413389) | PHAGE_Burkho_AH2: excisionase; PSPA7_2364; phage(gi399529070) | 2e-23 | Click |
| 8 | complement(2413464..2413655) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2365; phage(gi374531245) | 3e-13 | Click |
| 9 | 2413677..2413814 | hypothetical protein; PSPA7_2366 | N/A | Click |
| 10 | complement(2413847..2413969) | hypothetical protein; PSPA7_2367 | N/A | Click |
| 11 | complement(2413954..2415183) | PHAGE_Pseudo_KPP10: hypothetical protein; PSPA7_2368; phage(gi327198139) | 1e-42 | Click |
| 12 | complement(2415233..2415739) | hypothetical protein; PSPA7_2369 | N/A | Click |
| 13 | complement(2415736..2416101) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2370; phage(gi374531249) | 4e-62 | Click |
| 14 | complement(2416098..2416670) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2371; phage(gi374531250) | 6e-102 | Click |
| 15 | complement(2416667..2417338) | PHAGE_Pseudo_F116: hypothetical protein F116p07; PSPA7_2372; phage(gi56692934) | 1e-86 | Click |
| 16 | complement(2417651..2418100) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2373; phage(gi374531253) | 9e-46 | Click |
| 17 | complement(2418097..2420007) | PHAGE_Pseudo_phiCTX: hypothetical protein phiCTXp44; PSPA7_2374; phage(gi17313261) | 0.0 | Click |
| 18 | 2420133..2421044 | hypothetical protein; PSPA7_2375 | N/A | Click |
| 19 | complement(2421085..2421942) | PHAGE_Pseudo_F116: DNA adenine methyltransferase; PSPA7_2376; phage(gi56692911) | 2e-162 | Click |
| 20 | complement(2422083..2423828) | PHAGE_Pseudo_phi297: putative recombinase; PSPA7_2377; phage(gi374531255) | 0.0 | Click |
| 21 | complement(2423832..2424596) | PHAGE_Pseudo_phi297: putative DNA segregation ATPase; PSPA7_2378; phage(gi374531256) | 4e-11 | Click |
| 22 | complement(2424608..2424808) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2379; phage(gi374531257) | 5e-32 | Click |
| 23 | complement(2424815..2425609) | PHAGE_Pseudo_phi297: putative RecT protein; PSPA7_2380; phage(gi374531258) | 3e-79 | Click |
| 24 | complement(2425606..2426157) | PHAGE_Burkho_BcepMigl: hypothetical protein; PSPA7_2381; phage(gi431809871) | 2e-34 | Click |
| 25 | complement(2426106..2426909) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2382; phage(gi374531259) | 8e-151 | Click |
| 26 | complement(2426917..2427054) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2383; phage(gi374531260) | 3e-18 | Click |
| 27 | complement(2427371..2427550) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2384; phage(gi374531261) | 1e-26 | Click |
| 28 | complement(2427547..2427768) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2385; phage(gi374531262) | 6e-36 | Click |
| 29 | complement(2427752..2427904) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2386; phage(gi374531263) | 4e-19 | Click |
| 30 | complement(2428399..2428770) | PHAGE_Pseudo_phi297: global regulatory protein; PSPA7_2387; phage(gi374531265) | 2e-63 | Click |
| 31 | complement(2428805..2429017) | PHAGE_Pseudo_F116: hypothetical protein F116p25; PSPA7_2388; phage(gi56692943) | 2e-35 | Click |
| 32 | 2429246..2429554 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; PSPA7_2389; phage(gi24373865) | 4e-11 | Click |
| 33 | 2429581..2430408 | PHAGE_Entero_Sf6: putative transposase OrfB; PSPA7_2390; phage(gi41057343) | 3e-82 | Click |
| 34 | 2431450..2431623 | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2391; phage(gi374531269) | 2e-23 | Click |
| 35 | 2432606..2432719 | hypothetical protein; PSPA7_2392 | N/A | Click |
| 36 | complement(2433250..2433900) | PHAGE_Vibrio_kappa: putative NAD-dependent DNA ligase; PSPA7_2393; phage(gi165970237) | 5e-17 | Click |
| 37 | complement(2434034..2434885) | PHAGE_Pseudo_phi297: putative phage repressor; PSPA7_2394; phage(gi374531272) | 7e-89 | Click |
| 38 | 2435234..2435806 | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2395; phage(gi374531276) | 3e-103 | Click |
| 39 | 2435809..2436771 | hypothetical protein; PSPA7_2396 | N/A | Click |
| 40 | 2436899..2437312 | hypothetical protein; PSPA7_2397 | N/A | Click |
| 41 | 2437305..2437754 | PHAGE_Pseudo_phi297: holliday junction resolvase; PSPA7_2398; phage(gi374531280) | 2e-79 | Click |
| 42 | 2437783..2438652 | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2399; phage(gi374531281) | 1e-34 | Click |
| 43 | complement(2438754..2439449) | PHAGE_Yersin_PY54: hypothetical protein PY54p57; PSPA7_2400; phage(gi33770566) | 5e-30 | Click |
| 44 | 2439640..2439948 | PHAGE_Burkho_BcepC6B: putative holin protein; PSPA7_2401; phage(gi48697210) | 2e-05 | Click |
| 45 | 2439951..2440247 | hypothetical protein; PSPA7_2402 | N/A | Click |
| 46 | 2441018..2441617 | PHAGE_Pseudo_phi297: terminase small subunit; PSPA7_2403; phage(gi374531284) | 2e-51 | Click |
| 47 | 2441586..2442896 | PHAGE_Pseudo_H105/1: phage terminase large subunit; PSPA7_2404; phage(gi327198525) | 9e-106 | Click |
| 48 | 2442941..2444254 | PHAGE_Escher_HK639: hypothetical protein; PSPA7_2405; phage(gi356870603) | 1e-74 | Click |
| 49 | 2444251..2445330 | PHAGE_Pseudo_MP1412: head morphogenesis/minor structural protein; PSPA7_2406; phage(gi399529016) | 4e-25 | Click |
| 50 | 2445432..2446202 | PHAGE_Acinet_Bphi_B1251: hypothetical protein; PSPA7_2407; phage(gi423262006) | 1e-70 | Click |
| 51 | 2446212..2447183 | PHAGE_Pseudo_vB_Pae_Kakheti25: major capsid protein; PSPA7_2408; phage(gi388542670) | 9e-75 | Click |
| 52 | 2447224..2447709 | hypothetical protein; PSPA7_2409 | N/A | Click |
| 53 | 2447693..2448157 | PHAGE_Vibrio_vB_VpaS_MAR10: hypothetical protein; PSPA7_2410; phage(gi428782121) | 2e-13 | Click |
| 54 | 2448199..2448546 | hypothetical protein; PSPA7_2411 | N/A | Click |
| 55 | 2448550..2449224 | PHAGE_Shigel_EP23: putative tail protein; PSPA7_2412; phage(gi371496282) | 3e-22 | Click |
| 56 | 2449221..2449631 | PHAGE_Escher_HK639: hypothetical protein; PSPA7_2413; phage(gi356870611) | 4e-15 | Click |
| 57 | 2449699..2450352 | PHAGE_Cronob_phiES15: putative major tail protein; PSPA7_2414; phage(gi401817602) | 2e-34 | Click |
| 58 | 2450362..2450742 | PHAGE_Escher_HK639: hypothetical protein; PSPA7_2415; phage(gi356870614) | 6e-07 | Click |
| 59 | 2450805..2451068 | PHAGE_Cronob_phiES15: hypothetical protein; PSPA7_2416; phage(gi401817604) | 2e-14 | Click |
| 60 | 2451065..2454256 | PHAGE_Pseudo_MP29: putative tail component protein; PSPA7_2417; phage(gi215480016) | 8e-154 | Click |
| 61 | 2454262..2454600 | PHAGE_Entero_mEp390: minor tail protein; PSPA7_2418; phage(gi428782678) | 5e-30 | Click |
| 62 | 2454597..2455346 | PHAGE_Entero_mEp237: minor tail protein L; PSPA7_2419; phage(gi435439282) | 1e-72 | Click |
| 63 | 2455349..2456143 | PHAGE_Entero_HK633: minor tail protein; PSPA7_2421; phage(gi428782537) | 3e-57 | Click |
| 64 | complement(2456122..2456250) | hypothetical protein; PSPA7_2420 | N/A | Click |
| 65 | complement(2456229..2456351) | hypothetical protein; PSPA7_2422 | N/A | Click |
| 66 | 2456958..2457104 | hypothetical protein; PSPA7_2423 | N/A | Click |
| 67 | 2457097..2458044 | PHAGE_Escher_TL_2011b: hypothetical protein; PSPA7_2424; phage(gi418487673) | 2e-36 | Click |
| 68 | 2458593..2459258 | PHAGE_Cronob_ENT39118: tail assembly protein; PSPA7_2425; phage(gi431811064) | 5e-52 | Click |
| 69 | 2459904..2463470 | PHAGE_Entero_HK106: central tail fiber J; PSPA7_2426; phage(gi428783299) | 0.0 | Click |
| 70 | 2463467..2463751 | hypothetical protein; PSPA7_2427 | N/A | Click |
| 71 | 2465223..2465525 | PHAGE_Pseudo_MP42: hypothetical protein; PSPA7_2428; phage(gi399528628) | 3e-45 | Click |
| 72 | 2465522..2465749 | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp027; PSPA7_2429; phage(gi148912792) | 3e-33 | Click |
| 73 | 2465816..2466445 | PHAGE_Pseudo_F10: Predicted chitinase; lytic protein; PSPA7_2430; phage(gi148912826) | 6e-52 | Click |
| 74 | 2466442..2466810 | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp28; PSPA7_2431; phage(gi209552447) | 2e-58 | Click |
| 75 | 2466918..2467070 | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2432; phage(gi374531310) | 3e-20 | Click |
| 76 | 2467106..2467369 | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp30; PSPA7_2434; phage(gi209552449) | 5e-43 | Click |
| 77 | complement(2467351..2468043) | PHAGE_Pseudo_F116: hypothetical protein F116p67; PSPA7_2433; phage(gi56692976) | 2e-120 | Click |
| 78 | complement(2468084..2468596) | PHAGE_Pseudo_F116: hypothetical protein F116p69; PSPA7_2435; phage(gi56692978) | 3e-84 | Click |
| 79 | complement(2469579..2469971) | pirin; PSPA7_2436 | N/A | Click |
| 80 | 2470332..2471372 | putative lipoprotein; PSPA7_2437 | N/A | Click |
| 81 | 2471447..2472043 | hypothetical protein; PSPA7_2438 | N/A | Click |
| 82 | 2472097..2472318 | hypothetical protein; PSPA7_2439 | N/A | Click |
| 83 | complement(2472455..2472838) | hypothetical protein; PSPA7_2440 | N/A | Click |
| 84 | complement(2472960..2473091) | hypothetical protein; PSPA7_2441 | N/A | Click |
| 85 | complement(2473518..2474597) | hypothetical protein; PSPA7_2442 | N/A | Click |
| 86 | 2474845..2476440 | PHAGE_Singap_iridovirus: hypothetical protein ORF141R; PSPA7_2443; phage(gi56692778) | 1e-07 | Click |
| 87 | complement(2476469..2477698) | glutamate carboxypeptidase; PSPA7_2444 | N/A | Click |
| 88 | complement(2477840..2477980) | hypothetical protein; PSPA7_2445 | N/A | Click |
| 89 | complement(2478080..2479879) | hypothetical protein; PSPA7_2446 | N/A | Click |
| 90 | complement(2479956..2480615) | hypothetical protein; PSPA7_2447 | N/A | Click |
| 91 | complement(2480793..2481692) | AraC family transcription regulator; PSPA7_2448 | N/A | Click |
| 92 | 2481745..2482401 | tryptophan repressor binding protein; PSPA7_2449 | N/A | Click |
| 93 | 2482454..2483227 | PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; PSPA7_2450; phage(gi116326757) | 1e-07 | Click |
| 94 | complement(2483238..2483579) | hypothetical protein; PSPA7_2451 | N/A | Click |
| 95 | complement(2483576..2483956) | hypothetical protein; PSPA7_2452 | N/A | Click |
| 96 | 2484328..2484726 | hypothetical protein; PSPA7_2453 | N/A | Click |
| 97 | 2484711..2485691 | TPR repeat-containing protein; PSPA7_2454 | N/A | Click |
| 98 | 2485770..2486723 | formate/nitrate transporter; PSPA7_2455 | N/A | Click |
| 99 | complement(2486775..2488058) | hypothetical protein; PSPA7_2456 | N/A | Click |
| 100 | 2488242..2488318 | tRNA | N/A | Click |
| 101 | complement(2488426..2489112) | alginate lyase; PSPA7_2458 | N/A | Click |
| 102 | 2489235..2489756 | hypothetical protein; PSPA7_2459 | N/A | Click |
| 103 | complement(2489863..2490033) | hypothetical protein; PSPA7_2460 | N/A | Click |
| 104 | 2490140..2490601 | GCN5-related N-acetyltransferase; PSPA7_2461 | N/A | Click |
| 105 | 2490666..2490875 | hypothetical protein; PSPA7_2462 | N/A | Click |
| 106 | complement(2490883..2491908) | PHAGE_Pseudo_YuA: hypothetical protein; PSPA7_2463; phage(gi162135126) | 6e-05 | Click |
| 107 | 2492231..2492497 | hypothetical protein; PSPA7_2464 | N/A | Click |
| 108 | 2492576..2493355 | hypothetical protein; PSPA7_2465 | N/A | Click |
| 109 | 2493372..2493782 | PHAGE_Burkho_Bcep1: gp18; PSPA7_2466; phage(gi38638625) | 2e-10 | Click |
| 110 | 2494004..2494156 | hypothetical protein; PSPA7_2467 | N/A | Click |
| 111 | 2494347..2495228 | hypothetical protein; PSPA7_2468 | N/A | Click |
| 112 | complement(2495278..2495970) | esterase/lipase/thioesterase domain-containing protein; PSPA7_2469 | N/A | Click |
| 113 | 2495995..2496123 | hypothetical protein; PSPA7_2470 | N/A | Click |
| 114 | 2496217..2496516 | hypothetical protein; PSPA7_2471 | N/A | Click |
| 115 | complement(2496527..2496715) | putative lipoprotein; PSPA7_2472 | N/A | Click |
| 116 | 2496987..2497196 | hypothetical protein; PSPA7_2473 | N/A | Click |
| 117 | 2497308..2497652 | hypothetical protein; PSPA7_2474 | N/A | Click |
| 118 | complement(2497677..2498039) | hypothetical protein; PSPA7_2475 | N/A | Click |
| 119 | complement(2498199..2499476) | outer membrane protein; PSPA7_2476 | N/A | Click |
| 120 | 2499841..2500161 | hypothetical protein; PSPA7_2477 | N/A | Click |
| 121 | 2500206..2500355 | hypothetical protein; PSPA7_2478 | N/A | Click |
| 122 | complement(2500373..2501260) | putative transcriptional regulator; PSPA7_2479 | N/A | Click |
| 123 | 2501365..2501808 | hypothetical protein; PSPA7_2480 | N/A | Click |
| 124 | 2501994..2502380 | PHAGE_Salmon_SSU5: putative lipoprotein; PSPA7_2481; phage(gi410491532) | 4e-10 | Click |
| 125 | complement(2502435..2503082) | PROPHAGE_Escher_MG1655: ecotin, a serine protease inhibitor; PSPA7_2482; phage(gi16130146) | 7e-42 | Click |
| 126 | complement(2503231..2503461) | hypothetical protein; PSPA7_2483 | N/A | Click |
| 127 | 2503642..2503839 | hypothetical protein; PSPA7_2484 | N/A | Click |
| 128 | complement(2503904..2504233) | hypothetical protein; PSPA7_2485 | N/A | Click |
| 129 | complement(2504330..2504704) | hypothetical protein; PSPA7_2486 | N/A | Click |
| 130 | 2504837..2505280 | hypothetical protein; PSPA7_2487 | N/A | Click |
| 131 | 2505429..2505746 | hypothetical protein; PSPA7_2489 | N/A | Click |
| 132 | complement(2505736..2506635) | hypothetical protein; PSPA7_2488 | N/A | Click |
| 133 | 2506858..2507091 | hypothetical protein; PSPA7_2490 | N/A | Click |
| 134 | 2507158..2507388 | hypothetical protein; PSPA7_2492 | N/A | Click |
| 135 | complement(2507363..2507884) | hypothetical protein; PSPA7_2491 | N/A | Click |
| 136 | complement(2507902..2508615) | DNA-specific endonuclease I; PSPA7_2493 | N/A | Click |
| 137 | 2508772..2508993 | hypothetical protein; PSPA7_2494 | N/A | Click |
| 138 | 2508990..2509772 | type I methionine aminopeptidase; PSPA7_2495 | N/A | Click |
| 139 | 2509826..2510059 | hypothetical protein; PSPA7_2496 | N/A | Click |
| 140 | complement(2510133..2510261) | hypothetical protein; PSPA7_2497 | N/A | Click |
| 141 | 2510260..2510547 | hypothetical protein; PSPA7_2498 | N/A | Click |
| 142 | 2510726..2510839 | hypothetical protein; PSPA7_2499 | N/A | Click |
| 143 | complement(2510853..2511029) | hypothetical protein; PSPA7_2500 | N/A | Click |
| 144 | complement(2511114..2511440) | hypothetical protein; PSPA7_2501 | N/A | Click |
| 145 | 2511632..2512483 | putative hydrolase; PSPA7_2502 | N/A | Click |
| 146 | complement(2512511..2512780) | hypothetical protein; PSPA7_2503 | N/A | Click |
| 147 | 2512733..2514655 | threonyl-tRNA synthetase; PSPA7_2504 | N/A | Click |
| 148 | 2514673..2515206 | PHAGE_Cronob_vB_CsaM_GAP32: translation initiation factor IF-3; PSPA7_2505; phage(gi414087231) | 2e-13 | Click |
| 149 | 2515268..2515462 | 50S ribosomal protein L35; PSPA7_2506 | N/A | Click |
| 150 | 2515486..2515842 | 50S ribosomal protein L20; PSPA7_2507 | N/A | Click |
| 151 | 2515940..2516956 | phenylalanyl-tRNA synthetase subunit alpha; PSPA7_2508 | N/A | Click |
| 152 | 2516991..2519369 | phenylalanyl-tRNA synthetase subunit beta; PSPA7_2509 | N/A | Click |
| 153 | 2519373..2519675 | PHAGE_Bacill_SPBc2: histone-like prokaryotic DNA-binding protein family; PSPA7_2510; phage(gi9630187) | 2e-15 | Click |
| 154 | 2519656..2520012 | hypothetical protein; PSPA7_2511 | N/A | Click |
| 155 | 2520101..2520179 | tRNA | N/A | Click |
| 156 | 2520342..2520605 | PROPHAGE_Xantho_33913: IS1477 transposase; PSPA7_2513; phage(gi21230912) | 1e-28 | Click |
| 157 | complement(2521604..2522122) | hypothetical protein; PSPA7_2515 | N/A | Click |
| 158 | complement(2522554..2524878) | putative prophage encoded two-component system histidine kinase; PSPA7_2516 | N/A | Click |
| 159 | complement(2525039..2525488) | PHAGE_Burkho_KL3: gp46; PSPA7_2517; phage(gi327198091) | 2e-32 | Click |
| 160 | complement(2525541..2531033) | hypothetical protein; PSPA7_2518 | N/A | Click |
| 161 | complement(2531026..2532570) | hypothetical protein; PSPA7_2519 | N/A | Click |
| 162 | complement(2532567..2534714) | hypothetical protein; PSPA7_2520 | N/A | Click |
| 163 | complement(2534735..2536291) | PHAGE_Natria_PhiCh1: M.PhiCh1-II; PSPA7_2521; phage(gi22091184) | 3e-22 | Click |
| 164 | 2536657..2536869 | hypothetical protein; PSPA7_2522 | N/A | Click |
| 165 | complement(2537588..2537746) | hypothetical protein; PSPA7_2523 | N/A | Click |
| 166 | 2537819..2538088 | hypothetical protein; PSPA7_2524 | N/A | Click |
| 167 | complement(2538388..2539215) | PHAGE_Entero_Sf6: putative transposase OrfB; PSPA7_2525; phage(gi41057343) | 3e-82 | Click |
| 168 | complement(2539242..2539550) | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; PSPA7_2526; phage(gi24373865) | 4e-11 | Click |
| 169 | complement(2539655..2541004) | PHAGE_Helico_2: hypothetical protein; PSPA7_2527; phage(gi370703038) | 3e-05 | Click |
| 170 | complement(2541001..2547297) | PHAGE_Y73_sa_virus: protein-tyrosine kinase; PSPA7_2528; phage(gi108737104) | 5e-06 | Click |
| 171 | complement(2547312..2547950) | PHAGE_Vibrio_KVP40: anaerobic NTP reductase small subunit; PSPA7_2529; phage(gi34419250) | 2e-13 | Click |
| 172 | complement(2547952..2549781) | PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; PSPA7_2530; phage(gi15800640) | 1e-37 | Click |
| 173 | 2548909..2548921 | attR GCGCTGGCGGTCG | N/A | Click |
Region 4, total : 11 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2656402..2656413 | attL GGCCGCCCCGGC | N/A | Click |
| 2 | 2664151..2664993 | PHAGE_Strept_2972: tail protein; PSPA7_2644; phage(gi66391777) | 2e-05 | Click |
| 3 | complement(2665000..2666343) | response regulator; PSPA7_2645 | N/A | Click |
| 4 | 2666458..2667795 | PHAGE_Ectoca_1: EsV-1-186; PSPA7_2646; phage(gi13242656) | 2e-08 | Click |
| 5 | 2667907..2667995 | tRNA | N/A | Click |
| 6 | complement(2668079..2668627) | PHAGE_Xylell_Xfas53: integrase; PSPA7_2648; phage(gi273810420) | 1e-52 | Click |
| 7 | complement(2668624..2669106) | PHAGE_Xylell_Xfas53: integrase; PSPA7_2649; phage(gi273810420) | 7e-37 | Click |
| 8 | complement(2669107..2669319) | PHAGE_Xylell_Xfas53: gp02; PSPA7_2650; phage(gi273810421) | 1e-06 | Click |
| 9 | complement(2669394..2669726) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2651; phage(gi374531245) | 9e-40 | Click |
| 10 | complement(2669892..2670020) | hypothetical protein; PSPA7_2652 | N/A | Click |
| 11 | complement(2670307..2670492) | PHAGE_Pseudo_F116: hypothetical protein F116p03; PSPA7_2653; phage(gi56692930) | 4e-16 | Click |
| 12 | 2671360..2672364 | hypothetical protein; PSPA7_2654 | N/A | Click |
| 13 | complement(2673082..2673432) | PHAGE_Pseudo_phi297: hypothetical protein; PSPA7_2655; phage(gi374531252) | 3e-55 | Click |
| 14 | 2677875..2677886 | attR GGCCGCCCCGGC | N/A | Click |
Region 5, total : 28 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(5199093..5199800) | PHAGE_Haemop_HP1: hypothetical protein HP1p20; PSPA7_5051; phage(gi9628619) | 1e-51 | Click |
| 2 | complement(5199859..5201907) | PHAGE_Haemop_HP1: hypothetical protein HP1p21; PSPA7_5052; phage(gi9628620) | 4e-137 | Click |
| 3 | 5201873..5203018 | PHAGE_Haemop_HP1: hypothetical protein HP1p22; PSPA7_5053; phage(gi9628621) | 2e-28 | Click |
| 4 | 5203018..5204040 | PHAGE_Burkho_phiE202: gp2, phage major capsid protein, P2 family; PSPA7_5054; phage(gi134288740) | 1e-67 | Click |
| 5 | 5204037..5204774 | PHAGE_Haemop_HP1: hypothetical protein HP1p24; PSPA7_5055; phage(gi9628623) | 1e-21 | Click |
| 6 | 5204872..5205333 | PHAGE_Vibrio_kappa: putative head completion protein; PSPA7_5056; phage(gi165970260) | 7e-19 | Click |
| 7 | 5205335..5205772 | PHAGE_Haemop_HP1: hypothetical protein HP1p26; PSPA7_5057; phage(gi9628625) | 1e-06 | Click |
| 8 | 5205765..5206430 | PHAGE_Haemop_HP1: hypothetical protein HP1p27; PSPA7_5058; phage(gi9628626) | 9e-13 | Click |
| 9 | 5206442..5207557 | PHAGE_Haemop_HP1: hypothetical protein HP1p28; PSPA7_5059; phage(gi9628627) | 5e-77 | Click |
| 10 | 5207561..5208010 | PHAGE_Haemop_HP1: hypothetical protein HP1p29; PSPA7_5060; phage(gi9628628) | 4e-40 | Click |
| 11 | 5208010..5208219 | PHAGE_Entero_PsP3: gp34; PSPA7_5061; phage(gi41057386) | 6e-07 | Click |
| 12 | 5208270..5208524 | hypothetical protein; PSPA7_5062 | N/A | Click |
| 13 | 5208521..5208982 | PHAGE_Entero_cdtI: lysin; PSPA7_5063; phage(gi148609440) | 2e-31 | Click |
| 14 | 5208979..5209464 | PHAGE_Burkho_BcepMigl: Rz-like lysis protein; PSPA7_5064; phage(gi431809931) | 4e-19 | Click |
| 15 | 5209461..5209748 | PHAGE_Haemop_HP1: hypothetical protein HP1p33; PSPA7_5065; phage(gi9628632) | 9e-06 | Click |
| 16 | 5209772..5209912 | hypothetical protein; PSPA7_5066 | N/A | Click |
| 17 | 5209927..5211981 | PHAGE_Haemop_HP1: hypothetical protein HP1p34; PSPA7_5067; phage(gi9628633) | 2e-97 | Click |
| 18 | 5211978..5212298 | PHAGE_Haemop_HP1: hypothetical protein HP1p35; PSPA7_5068; phage(gi9628634) | 9e-26 | Click |
| 19 | 5212295..5213467 | PHAGE_Haemop_HP1: hypothetical protein HP1p36; PSPA7_5069; phage(gi9628635) | 3e-80 | Click |
| 20 | 5213460..5213984 | PHAGE_Haemop_HP1: hypothetical protein HP1p37; PSPA7_5070; phage(gi9628636) | 9e-44 | Click |
| 21 | 5213996..5215960 | PHAGE_Haemop_HP1: hypothetical protein HP1p38; PSPA7_5071; phage(gi9628637) | 6e-53 | Click |
| 22 | 5215974..5216684 | PHAGE_Ralsto_phiRSA1: tail fiber assembly-like protein; PSPA7_5072; phage(gi145708099) | 2e-11 | Click |
| 23 | 5216681..5217601 | PHAGE_Aeromo_phiO18P: hypothetical protein phiO18_44; PSPA7_5073; phage(gi148727173) | 1e-22 | Click |
| 24 | 5217598..5218137 | PHAGE_Haemop_HP1: hypothetical protein HP1p41; PSPA7_5074; phage(gi9628640) | 5e-21 | Click |
| 25 | 5218137..5218829 | PHAGE_Haemop_HP1: hypothetical protein HP1p42; PSPA7_5075; phage(gi9628641) | 1e-23 | Click |
| 26 | 5218814..5219785 | PHAGE_Haemop_HP1: hypothetical protein HP1p42; PSPA7_5076; phage(gi9628641) | 7e-56 | Click |
| 27 | complement(5219828..5220232) | PHAGE_Haemop_HP1: hypothetical protein HP1p19; PSPA7_5077; phage(gi9628618) | 7e-27 | Click |
| 28 | complement(5220260..5220481) | PHAGE_Haemop_HP1: hypothetical protein HP1p18; PSPA7_5078; phage(gi19263453) | 4e-09 | Click |
Region 6, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 5295061..5295107 | attL ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA | N/A | Click |
| 2 | 5295232..5296446 | PHAGE_Escher_HK75: phage integrase family protein; PSPA7_5143; phage(gi356870702) | 1e-27 | Click |
| 3 | 5297128..5297328 | excisionase; PSPA7_5144 | N/A | Click |
| 4 | 5297450..5297698 | hypothetical protein; PSPA7_5145 | N/A | Click |
| 5 | 5297755..5297970 | hypothetical protein; PSPA7_5146 | N/A | Click |
| 6 | 5298058..5298294 | hypothetical protein; PSPA7_5147 | N/A | Click |
| 7 | 5298348..5298749 | hypothetical protein; PSPA7_5148 | N/A | Click |
| 8 | 5299107..5299229 | hypothetical protein; PSPA7_5149 | N/A | Click |
| 9 | 5299767..5300996 | PHAGE_Synech_S_CBS3: major capsid protein; PSPA7_5150; phage(gi331028011) | 1e-46 | Click |
| 10 | 5300999..5301508 | PHAGE_Entero_EFRM31: prohead protease; PSPA7_5151; phage(gi327198114) | 2e-25 | Click |
| 11 | 5301505..5302743 | PHAGE_Entero_mEp235: portal protein; PSPA7_5152; phage(gi428781813) | 3e-65 | Click |
| 12 | 5302740..5303138 | PHAGE_Xantho_Xp10: endonuclease of the HNH family; PSPA7_5153; phage(gi32128472) | 6e-12 | Click |
| 13 | 5303288..5303608 | TerS protein; PSPA7_5154 | N/A | Click |
| 14 | 5303605..5305101 | PHAGE_Cronob_ENT39118: terminase large subunit; PSPA7_5155; phage(gi431811047) | 0.0 | Click |
| 15 | 5305098..5305373 | hypothetical protein; PSPA7_5156 | N/A | Click |
| 16 | 5305370..5305684 | PHAGE_Pseudo_PAJU2: putative head-tail adaptor; PSPA7_5157; phage(gi209552428) | 9e-13 | Click |
| 17 | 5305947..5305993 | attR ACTGGTGCCGGATAGAGGAATCGAACCCCCGACCTTCTCATTACGAA | N/A | Click |
Region 7, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 5528487..5528500 | attL TCATAATGCTGATG | N/A | Click |
| 2 | complement(5529344..5530342) | PHAGE_Erwini_ENT90: phage integrase family protein; PSPA7_5364; phage(gi431810942) | 4e-78 | Click |
| 3 | complement(5530339..5531550) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p08; PSPA7_5365; phage(gi9625374) | 0.0 | Click |
| 4 | complement(5531861..5533135) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p07; PSPA7_5366; phage(gi9625373) | 0.0 | Click |
| 5 | complement(5533139..5533495) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p06; PSPA7_5367; phage(gi9625372) | 1e-52 | Click |
| 6 | complement(5533500..5534186) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p05; PSPA7_5368; phage(gi9625371) | 4e-124 | Click |
| 7 | 5534308..5534463 | hypothetical protein; PSPA7_5369 | N/A | Click |
| 8 | complement(5535018..5535266) | PHAGE_Pseudo_Pf1: major coat protein; PSPA7_5370; phage(gi9625370) | 3e-38 | Click |
| 9 | complement(5535279..5535530) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p03; PSPA7_5371; phage(gi9625369) | 3e-43 | Click |
| 10 | complement(5535543..5535635) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p02; PSPA7_5372; phage(gi9625368) | 1e-10 | Click |
| 11 | complement(5535652..5536086) | PHAGE_Pseudo_Pf1: ssDNA binding protein; PSPA7_5373; phage(gi9625367) | 2e-78 | Click |
| 12 | complement(5536939..5537193) | PHAGE_Pseudo_Pf1: hypothetical protein Pf1p10; PSPA7_5374; phage(gi9625376) | 1e-42 | Click |
| 13 | complement(5538811..5538924) | hypothetical protein; PSPA7_5375 | N/A | Click |
| 14 | complement(5538921..5540252) | PHAGE_Salmon_ST160: regulatory protein; PSPA7_5376; phage(gi318065923) | 2e-30 | Click |
| 15 | complement(5540290..5540982) | PHAGE_Clostr_st: putative restriction endonuclase; PSPA7_5377; phage(gi80159877) | 3e-07 | Click |
| 16 | complement(5541534..5541839) | PHAGE_Azospi_Cd: Helix-turn-helix motif; PSPA7_5378; phage(gi168495160) | 1e-11 | Click |
| 17 | 5542521..5542534 | attR TCATAATGCTGATG | N/A | Click |
| 18 | 5542800..5543003 | hypothetical protein; PSPA7_5379 | N/A | Click |
| 19 | 5543246..5545105 | PHAGE_Clostr_st: putative ATP-dependent DNA helicase; PSPA7_5380; phage(gi80159869) | 3e-05 | Click |
Region 8, total : 20 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 6218565..6218576 | attL AGGGCCTGCACG | N/A | Click |
| 2 | 6218730..6219641 | PHAGE_Thermu_26: phage XerD-like integrase; PSPA7_6023; phage(gi157265417) | 2e-15 | Click |
| 3 | 6219638..6220336 | putative hydrolase; PSPA7_6024 | N/A | Click |
| 4 | complement(6220414..6221583) | MFS transporter; PSPA7_6025 | N/A | Click |
| 5 | 6221723..6223108 | GntR family transcriptional regulator; PSPA7_6026 | N/A | Click |
| 6 | complement(6223172..6223489) | PHAGE_Acanth_mimivirus: HMG box-containing protein; PSPA7_6027; phage(gi311977940) | 1e-05 | Click |
| 7 | complement(6223567..6223992) | hypothetical protein; PSPA7_6028 | N/A | Click |
| 8 | complement(6224221..6225549) | PHAGE_Lactob_KC5a: putative minor tail protein; PSPA7_6029; phage(gi90592623) | 8e-06 | Click |
| 9 | complement(6225590..6225928) | nitrogen regulatory protein P-II 2; PSPA7_6030 | N/A | Click |
| 10 | 6226368..6226628 | hypothetical protein; PSPA7_6031 | N/A | Click |
| 11 | 6226672..6227745 | PROPHAGE_Escher_Sakai: putative ATP-dependent protease; PSPA7_6032; phage(gi15833954) | 2e-99 | Click |
| 12 | complement(6228142..6228276) | hypothetical protein; PSPA7_6033 | N/A | Click |
| 13 | complement(6228705..6229571) | PROPHAGE_Escher_CFT073: transposase insF; PSPA7_6034; phage(gi26250329) | 1e-63 | Click |
| 14 | complement(6229568..6229861) | PROPHAGE_Xantho_33913: ISxac3 transposase; PSPA7_6035; phage(gi21231087) | 1e-09 | Click |
| 15 | complement(6229892..6230710) | PHAGE_Entero_Sf6: putative transposase OrfB; PSPA7_6036; phage(gi41057343) | 5e-82 | Click |
| 16 | complement(6230737..6231045) | PHAGE_Entero_Sf6: gene 56 protein; PSPA7_6037; phage(gi41057344) | 4e-24 | Click |
| 17 | 6231219..6232445 | PROPHAGE_Escher_CFT073: transposase; PSPA7_6038; phage(gi26246249) | 2e-125 | Click |
| 18 | complement(6232483..6235515) | PHAGE_Hyphan_nucleopolyhedrovirus: Global transactivator; PSPA7_6039; phage(gi86355628) | 2e-29 | Click |
| 19 | complement(6235525..6237471) | hypothetical protein; PSPA7_6040 | N/A | Click |
| 20 | complement(6237534..6238298) | flagellar motor protein; PSPA7_6041 | N/A | Click |
| 21 | complement(6238298..6240424) | PHAGE_Human__8: LANA; PSPA7_6042; phage(gi139472804) | 1e-11 | Click |
| 22 | 6254347..6254358 | attR AGGGCCTGCACG | N/A | Click |