Definition Pseudomonas mendocina ymp chromosome, complete genome.
Accession NC_009439
Length 5,072,807
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 10 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2338278..2338311  attL    GTTCGAATCTCTTCTTCACCGCCACTTTCGCAAT  N/A  Click
2 complement(2338357..2339364)  PROPHAGE_Pseudo_PAO1: bacteriophage integrase; Pmen_2110; phage(gi15595925)  5e-115  Click
3 complement(2339364..2340641)  PHAGE_Pseudo_Pf1: hypothetical protein Pf1p08; Pmen_2111; phage(gi9625374)  1e-131  Click
4 complement(2340795..2341985)  PHAGE_Ralsto_PE226: putative phage assembly protein; Pmen_2112; phage(gi327198635)  6e-39  Click
5 complement(2341985..2342302)  PHAGE_Ralsto_PE226: putative minor coat protein; Pmen_2113; phage(gi327198634)  1e-06  Click
6 complement(2342304..2343620)  PROPHAGE_Pseudo_PAO1: coat protein A of bacteriophage Pf1; Pmen_2114; phage(gi15595921)  1e-36  Click
7 complement(2343974..2344177)  hypothetical protein; Pmen_2115  N/A  Click
8 complement(2344187..2344366)  hypothetical protein; Pmen_2116  N/A  Click
9 complement(2344382..2344750)  hypothetical protein; Pmen_2117  N/A  Click
10 complement(2344999..2345286)  hypothetical protein; Pmen_2119  N/A  Click
11 complement(2345291..2345581)  PHAGE_Pseudo_Pf1: hypothetical protein Pf1p13; Pmen_2120; phage(gi9625379)  7e-26  Click
12 2350535..2350568  attR    GTTCGAATCTCTTCTTCACCGCCACTTTCGCAAT  N/A  Click
Region 2, total : 32 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 4337564..4337576  attL    CAGGGCGAAAACG  N/A  Click
2 complement(4346731..4347516)  PHAGE_Pseudo_F10: hypothetical protein PPF10_gp010; Pmen_3965; phage(gi148912775)  1e-18  Click
3 complement(4347540..4347986)  hypothetical protein; Pmen_3966  N/A  Click
4 complement(4347990..4348577)  hypothetical protein; Pmen_3967  N/A  Click
5 complement(4348574..4349125)  hypothetical protein; Pmen_3968  N/A  Click
6 complement(4349128..4349658)  PHAGE_Burkho_KS9: hypothetical protein gp6; Pmen_3969; phage(gi255033738)  6e-10  Click
7 complement(4349925..4351166)  PHAGE_Burkho_KS9: major capsid protein gp5; Pmen_3970; phage(gi255033737)  3e-88  Click
8 complement(4351237..4351887)  PHAGE_Burkho_KS9: protease/scaffold protein gp4; Pmen_3971; phage(gi255033736)  4e-54  Click
9 complement(4351907..4353142)  PHAGE_Burkho_KS9: portal protein gp3; Pmen_3972; phage(gi255033735)  4e-58  Click
10 complement(4353210..4354916)  PHAGE_Burkho_KS9: terminase gp2; Pmen_3973; phage(gi255033734)  5e-86  Click
11 complement(4354900..4355421)  PHAGE_Burkho_KS9: hypothetical protein gp1; Pmen_3974; phage(gi255033733)  2e-22  Click
12 complement(4355556..4355939)  PHAGE_Bacill_WBeta: putative phage endonuclease; Pmen_3975; phage(gi85701432)  6e-13  Click
13 complement(4355942..4356376)  PHAGE_Aeromo_phiO18P: putative holin; Pmen_3976; phage(gi148727161)  2e-12  Click
14 complement(4356877..4357245)  hypothetical protein; Pmen_3977  N/A  Click
15 complement(4357242..4359476)  PHAGE_Staphy_phi7401PVL: virulence-associated protein E; Pmen_3978; phage(gi448244658)  2e-60  Click
16 complement(4359469..4359861)  hypothetical protein; Pmen_3979  N/A  Click
17 complement(4359858..4360076)  PHAGE_Mannhe_phiMHaA1: hypothetical protein MhaA1p11; Pmen_3980; phage(gi109289947)  8e-07  Click
18 complement(4360069..4360581)  PHAGE_Burkho_phiE125: hypothetical protein phiE125p56; Pmen_3981; phage(gi17975217)  2e-10  Click
19 complement(4360989..4361216)  PHAGE_Entero_mEpX1: prophage antirepressor; Pmen_3982; phage(gi428781916)  1e-14  Click
20 4361321..4362043  PHAGE_Stx2_c_I: CI protein; Pmen_3983; phage(gi20065916)  2e-33  Click
21 4362278..4362547  PHAGE_Pseudo_phi297: hypothetical protein; Pmen_3984; phage(gi374531266)  2e-24  Click
22 4362544..4363140  hypothetical protein; Pmen_3985  N/A  Click
23 4363151..4363441  hypothetical protein; Pmen_3986  N/A  Click
24 4363598..4364071  hypothetical protein; Pmen_3987  N/A  Click
25 4364068..4364397  hypothetical protein; Pmen_3988  N/A  Click
26 4364394..4364657  hypothetical protein; Pmen_3989  N/A  Click
27 4364732..4365418  hypothetical protein; Pmen_3990  N/A  Click
28 4365415..4365960  PHAGE_Salmon_ST64B: hypothetical protein sb35; Pmen_3991; phage(gi23505479)  8e-30  Click
29 4365957..4366865  PHAGE_Salmon_SPN19: hypothetical protein; Pmen_3992; phage(gi414090156)  3e-86  Click
30 complement(4367147..4367809)  hypothetical protein; Pmen_3993  N/A  Click
31 4367884..4368120  PHAGE_Stenot_S1: putative repressor protein; Pmen_3994; phage(gi213163928)  4e-07  Click
32 complement(4368134..4368490)  hypothetical protein; Pmen_3995  N/A  Click
33 4368344..4368356  attR    CAGGGCGAAAACG  N/A  Click
34 complement(4368492..4369661)  PROPHAGE_Escher_CFT073: putative prophage integrase; Pmen_3996; phage(gi26250313)  2e-82  Click
Region 3, total : 9 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 4923506..4925740  PHAGE_Bacill_B103: morphogenesis protein; Pmen_4490; phage(gi22855163)  7e-05  Click
2 4925830..4927131  PHAGE_Ralsto_phiRSA1: transposase IRSO15-like; Pmen_4491; phage(gi145708108)  6e-09  Click
3 4927132..4927488  hypothetical protein; Pmen_4492  N/A  Click
4 complement(4927523..4928515)  PHAGE_Microc_LMM01: hypothetical protein MaLMM01_gp062; Pmen_4493; phage(gi117530233)  4e-16  Click
5 complement(4928694..4929944)  PHAGE_Bacill_Andromeda: tape measure protein; Pmen_4494; phage(gi460042037)  8e-05  Click
6 complement(4930091..4931143)  PHAGE_Acanth_mimivirus: hypothetical protein; Pmen_4495; phage(gi311977781)  5e-10  Click
7 4931210..4931695  ferric uptake regulator family protein; Pmen_4496  N/A  Click
8 4931692..4932480  PHAGE_Plankt_PaV_LD: ABC transporter; Pmen_4497; phage(gi371496158)  2e-16  Click
9 4932480..4933268  PHAGE_Lactob_KC5a: putative minor tail protein; Pmen_4498; phage(gi90592623)  4e-08  Click