Definition Salinispora tropica CNB-440 chromosome, complete genome.
Accession NC_009380
Length 5,183,331
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 53 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 577223..577235  attL    CCTGCGACACACG  N/A  Click
2 583825..584169  PHAGE_Bordet_1: integrase; Strop_0505; phage(gi45569541)  2e-05  Click
3 complement(584162..584443)  hypothetical protein; Strop_0506  N/A  Click
4 584630..584699  attL    GATCGTGTTTTCGCTGATCTTCGAGGTGCCCCCGGCAGGAATCGAACCTGCGACACACGGTTTAGGAAAC  N/A  Click
5 585090..585476  hypothetical protein; Strop_0507  N/A  Click
6 complement(585555..586382)  hypothetical protein; Strop_0508  N/A  Click
7 complement(586463..586930)  hypothetical protein; Strop_0509  N/A  Click
8 587003..588424  helix-turn-helix domain-containing protein; Strop_0510  N/A  Click
9 complement(588475..588921)  hypothetical protein; Strop_0511  N/A  Click
10 589581..590393  helix-turn-helix domain-containing protein; Strop_0512  N/A  Click
11 590390..590578  hypothetical protein; Strop_0513  N/A  Click
12 complement(590639..591148)  hypothetical protein; Strop_0514  N/A  Click
13 complement(591145..591618)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0515; phage(gi410491014)  2e-16  Click
14 complement(591615..592094)  hypothetical protein; Strop_0516  N/A  Click
15 complement(592120..592905)  PHAGE_Pseudo_LKA1: hypothetical protein PPLKA1_gp34; Strop_0517; phage(gi158345168)  5e-51  Click
16 complement(592886..593335)  hypothetical protein; Strop_0518  N/A  Click
17 complement(593335..594006)  PHAGE_Strept_phiHau3: putative primase; Strop_0519; phage(gi410490994)  6e-47  Click
18 complement(594832..595272)  PHAGE_Mycoba_Omega: gp138; Strop_0520; phage(gi29566872)  2e-25  Click
19 complement(595272..596084)  PHAGE_Strept_phiHau3: putative primase helicase; Strop_0521; phage(gi410490990)  6e-96  Click
20 complement(596148..596612)  PHAGE_Strept_R4: hypothetical protein; Strop_0522; phage(gi414090018)  5e-05  Click
21 complement(596661..597170)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0523; phage(gi410490987)  4e-25  Click
22 complement(597218..598189)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0524; phage(gi410490986)  2e-62  Click
23 complement(598639..598983)  hypothetical protein; Strop_0525  N/A  Click
24 complement(599029..599511)  PHAGE_Strept_phiHau3: putative repressor; Strop_0526; phage(gi410490984)  2e-21  Click
25 complement(599930..600196)  PHAGE_Mycoba_Wee: gp33; Strop_0527; phage(gi318065824)  1e-08  Click
26 complement(600227..601231)  PHAGE_Bacill_SP10: L-alanoyl-D-glutamate peptidase; Strop_0528; phage(gi418489573)  4e-08  Click
27 complement(601580..602926)  PHAGE_Equid__4: envelope glycoprotein J; Strop_0529; phage(gi9629801)  8e-09  Click
28 complement(602935..603621)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0530; phage(gi410490979)  4e-51  Click
29 complement(603631..605100)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0531; phage(gi410490975)  5e-94  Click
30 complement(605100..605963)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0532; phage(gi410490974)  1e-67  Click
31 complement(605966..609199)  PHAGE_Strept_phiHau3: putative tail tape measure; Strop_0533; phage(gi410490973)  4e-148  Click
32 complement(609573..609983)  PHAGE_Strept_R4: putative tail chaperone; Strop_0535; phage(gi414090000)  3e-16  Click
33 complement(609959..610696)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0536; phage(gi410490972)  3e-89  Click
34 complement(610719..611204)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0537; phage(gi410490971)  2e-44  Click
35 complement(611185..611661)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0538; phage(gi410490970)  5e-11  Click
36 complement(611661..612029)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0539; phage(gi410490969)  5e-29  Click
37 complement(612023..612583)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0540; phage(gi410490968)  7e-24  Click
38 complement(612601..613683)  PHAGE_Strept_phiHau3: putative major capsid; Strop_0541; phage(gi410490967)  1e-74  Click
39 complement(613745..614242)  PHAGE_Strept_phiHau3: putative scaffold protein; Strop_0542; phage(gi410490966)  8e-23  Click
40 complement(614246..615343)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0543; phage(gi410490965)  2e-72  Click
41 complement(615351..616004)  hypothetical protein; Strop_0544  N/A  Click
42 complement(616082..617215)  PHAGE_Strept_TG1: putative tail fiber protein; Strop_0545; phage(gi410491926)  4e-07  Click
43 complement(617219..618766)  PHAGE_Strept_phiHau3: putative portal; Strop_0546; phage(gi410490964)  4e-154  Click
44 complement(618800..620524)  PHAGE_Strept_R4: putative terminase; Strop_0547; phage(gi414089990)  3e-173  Click
45 complement(620586..621017)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0548; phage(gi410490963)  2e-41  Click
46 complement(621048..621323)  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0549; phage(gi410490960)  8e-06  Click
47 624001..624342  hypothetical protein; Strop_0551  N/A  Click
48 624413..624658  hypothetical protein; Strop_0552  N/A  Click
49 624738..625118  hypothetical protein; Strop_0553  N/A  Click
50 625197..625757  PHAGE_Strept_phiHau3: hypothetical protein; Strop_0554; phage(gi410491024)  2e-14  Click
51 625861..626532  hypothetical protein; Strop_0555  N/A  Click
52 627903..628235  hypothetical protein; Strop_0556  N/A  Click
53 628504..629220  PHAGE_Bacill_36: Cys-rich domain protein; Strop_0557; phage(gi156563997)  1e-12  Click
54 629526..629711  hypothetical protein; Strop_0558  N/A  Click
55 629708..631102  PHAGE_Staphy_96: ORF011; Strop_0559; phage(gi66395896)  5e-06  Click
56 631274..631343  attR    GATCGTGTTTTCGCTGATCTTCGAGGTGCCCCCGGCAGGAATCGAACCTGCGACACACGGTTTAGGAAAC  N/A  Click
57 631320..631332  attR    CCTGCGACACACG  N/A  Click
Region 2, total : 26 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2199137..2200114  PHAGE_Mycoba_BPs: integrase; Strop_1924; phage(gi189043119)  6e-15  Click
2 2200134..2200145  attL    CGGTGCTGAGCG  N/A  Click
3 2200283..2201206  PHAGE_Natria_PhiCh1: putative plasmid partitioning protein Soj; Strop_1925; phage(gi22091150)  5e-20  Click
4 2201227..2202306  chromosome segregation and condensation protein ScpA; Strop_1926  N/A  Click
5 2202299..2203147  segregation and condensation protein B; Strop_1927  N/A  Click
6 2203116..2203904  pseudouridine synthase; Strop_1928  N/A  Click
7 2204076..2204759  cytidylate kinase; Strop_1929  N/A  Click
8 2204756..2206159  GTP-binding protein EngA; Strop_1930  N/A  Click
9 2206283..2206356  tRNA  N/A  Click
10 2206315..2206357  attL    CTGGGGGTCAAGGGGTCGTCGGTTCGAATCCGGCCGTCCCGAC  N/A  Click
11 complement(2206426..2207082)  PHAGE_Thermu_IN93: hypothetical protein IN93_gp29; Strop_1931; phage(gi194462977)  9e-11  Click
12 complement(2207198..2208061)  PROPHAGE_Escher_MG1655: IS3 transposase B; Strop_1932; phage(gi16128284)  1e-36  Click
13 complement(2208058..2208366)  PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; Strop_1933; phage(gi17975201)  9e-08  Click
14 2208520..2208981  hypothetical protein; Strop_1934  N/A  Click
15 2209193..2209573  hypothetical protein; Strop_1935  N/A  Click
16 2209681..2209723  attR    CTGGGGGTCAAGGGGTCGTCGGTTCGAATCCGGCCGTCCCGAC  N/A  Click
17 complement(2209812..2210396)  PHAGE_Thermu_IN93: hypothetical protein IN93_gp29; Strop_1936; phage(gi194462977)  2e-06  Click
18 2210567..2211064  PROPHAGE_Mesorh_MAFF303099: transposase; Strop_1937; phage(gi13475318)  1e-19  Click
19 2211065..2212009  hypothetical protein; Strop_1938  N/A  Click
20 2212219..2213877  PHAGE_Mycoba_Corndog: gp96; Strop_1939; phage(gi29566380)  5e-58  Click
21 2213909..2214364  hypothetical protein; Strop_1940  N/A  Click
22 2214361..2214579  hypothetical protein; Strop_1941  N/A  Click
23 2214563..2215420  PHAGE_Emilia_86: hypothetical protein EhV364; Strop_1942; phage(gi73852838)  4e-09  Click
24 2215413..2216075  PHAGE_Entero_vB_EcoM_FV3: anaerobic NTP reductase small subunit; Strop_1943; phage(gi422936430)  2e-14  Click
25 complement(2216277..2216741)  PROPHAGE_Pseudo_KT2440: transposase, putative; Strop_1944; phage(gi26991145)  8e-29  Click
26 2217144..2217356  PHAGE_Strept_VWB: hypothetical protein VWBp55; Strop_1946; phage(gi41057269)  1e-14  Click
27 complement(2217628..2218023)  PHAGE_Bacill_BCP78: hypothetical protein; Strop_1947; phage(gi410492853)  3e-20  Click
28 complement(2218055..2220064)  PHAGE_Serrat_phiMAM1: hypothetical protein; Strop_1948; phage(gi440789353)  2e-139  Click
29 complement(2220385..2220891)  hypothetical protein; Strop_1949  N/A  Click
30 complement(2221010..2221630)  PROPHAGE_Xantho_33913: IS1480 transposase; Strop_1950; phage(gi21231089)  2e-08  Click
31 2221688..2221699  attR    CGGTGCTGAGCG  N/A  Click