| Definition | Clostridium thermocellum ATCC 27405, complete genome. |
|---|---|
| Accession | NC_009012 |
| Length | 3,843,301 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 24 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1937673..1937685 | attL ACAATACCATTAT | N/A | Click |
| 2 | complement(1938476..1938931) | PHAGE_Entero_phiFL3A: integrase; Cthe_1608; phage(gi281416214) | 1e-05 | Click |
| 3 | complement(1938931..1940499) | PHAGE_Bacill_Fah: site-specific serine recombinase; Cthe_1609; phage(gi89152504) | 8e-38 | Click |
| 4 | complement(1940561..1940779) | hypothetical protein; Cthe_1610 | N/A | Click |
| 5 | complement(1940837..1941841) | PHAGE_Entero_phiFL4A: endolysin; Cthe_1611; phage(gi281416489) | 9e-10 | Click |
| 6 | complement(1941838..1942257) | PHAGE_Bacill_Fah: holin; Cthe_1612; phage(gi89152494) | 7e-29 | Click |
| 7 | complement(1942344..1944767) | glycosyl hydrolase-like protein; Cthe_1613 | N/A | Click |
| 8 | complement(1944809..1945384) | hypothetical protein; Cthe_1614 | N/A | Click |
| 9 | complement(1945394..1945588) | hypothetical protein; Cthe_1615 | N/A | Click |
| 10 | complement(1945599..1948121) | PHAGE_Lister_LP_030_2: phage capsid and scaffold; Cthe_1616; phage(gi514051949) | 1e-10 | Click |
| 11 | complement(1948126..1948899) | PHAGE_Clostr_phiCD38_2: tail component protein; Cthe_1617; phage(gi333798124) | 7e-09 | Click |
| 12 | complement(1948913..1951201) | PHAGE_Strept_Dp_1: TMP; Cthe_1618; phage(gi327198366) | 7e-44 | Click |
| 13 | 1951335..1951607 | AbrB family transcriptional regulator; Cthe_1619 | N/A | Click |
| 14 | 1951604..1952008 | hypothetical protein; Cthe_1620 | N/A | Click |
| 15 | complement(1952057..1952248) | hypothetical protein; Cthe_1621 | N/A | Click |
| 16 | complement(1952245..1952628) | hypothetical protein; Cthe_1622 | N/A | Click |
| 17 | complement(1952631..1953227) | PHAGE_Bacill_Fah: major tail protein; Cthe_1623; phage(gi89152489) | 2e-15 | Click |
| 18 | complement(1953233..1953577) | hypothetical protein; Cthe_1624 | N/A | Click |
| 19 | complement(1953574..1953984) | PHAGE_Bacill_BtCS33: head-tail joining protein; Cthe_1625; phage(gi392972717) | 8e-06 | Click |
| 20 | complement(1954022..1954357) | phage head-tail adaptor, putative; Cthe_1626 | N/A | Click |
| 21 | complement(1954360..1954668) | uncharacterized phage protein; Cthe_1627 | N/A | Click |
| 22 | complement(1954690..1955892) | PHAGE_Entero_phiP27: putative major capsid protein; Cthe_1628; phage(gi18249904) | 2e-47 | Click |
| 23 | complement(1955943..1956671) | PHAGE_Geobac_virus_E2: putative Clp peptidase; Cthe_1629; phage(gi148747731) | 5e-48 | Click |
| 24 | complement(1956610..1957932) | PHAGE_Burkho_phi644_2: gp4, phage portal protein, HK97 family; Cthe_1630; phage(gi134288632) | 2e-73 | Click |
| 25 | complement(1958009..1959793) | PHAGE_Entero_Fels_2: hypothetical protein STM2723.1.Fels2; Cthe_1631; phage(gi169936050) | 1e-62 | Click |
| 26 | 1968224..1968236 | attR ACAATACCATTAT | N/A | Click |
Region 2, total : 49 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1959816..1959827 | attL TTTAATTAAGGA | N/A | Click |
| 2 | 1959969..1959980 | attL ATCTATTCTCTC | N/A | Click |
| 3 | complement(1964406..1965659) | PHAGE_Strept_EJ_1: transferase; Cthe_1638; phage(gi39653711) | 2e-55 | Click |
| 4 | complement(1965665..1966963) | PHAGE_Lister_B054: gp77; Cthe_1639; phage(gi157325361) | 1e-39 | Click |
| 5 | complement(1967120..1967671) | hypothetical protein; Cthe_1640 | N/A | Click |
| 6 | complement(1967792..1968151) | PHAGE_Burkho_phiE125: putative class I holin; Cthe_1641; phage(gi17975232) | 3e-17 | Click |
| 7 | 1968236..1968247 | attL TATTTGGATTTA | N/A | Click |
| 8 | complement(1968273..1968515) | hypothetical protein; Cthe_1642 | N/A | Click |
| 9 | 1968590..1968601 | attL TATCATTATATA | N/A | Click |
| 10 | complement(1968659..1969657) | PHAGE_Lactoc_bIL311: Orf21; Cthe_1643; phage(gi13095679) | 3e-24 | Click |
| 11 | complement(1969697..1970131) | hypothetical protein; Cthe_1644 | N/A | Click |
| 12 | complement(1970346..1970801) | phage-associated protein; Cthe_1645 | N/A | Click |
| 13 | complement(1970893..1971195) | PHAGE_Thermo_THSA_485A: VRR-NUC domain-containing protein; Cthe_1646; phage(gi397912645) | 1e-27 | Click |
| 14 | complement(1971496..1974051) | PHAGE_Bacill_phi105: hypothetical protein phi105_42; Cthe_1647; phage(gi22855035) | 5e-51 | Click |
| 15 | complement(1974048..1974473) | PHAGE_Yersin_phiR1_RT: FIG00694808: hypothetical protein; Cthe_1648; phage(gi431808968) | 1e-06 | Click |
| 16 | complement(1974489..1975286) | PHAGE_Staphy_37: ORF016; Cthe_1649; phage(gi66395745) | 3e-57 | Click |
| 17 | complement(1975291..1977213) | PHAGE_Bacill_phBC6A51: DNA polymerase I; Cthe_1650; phage(gi31415758) | 3e-67 | Click |
| 18 | complement(1977271..1978023) | PHAGE_Thermo_THSA_485A: hypothetical protein; Cthe_1651; phage(gi397912650) | 1e-51 | Click |
| 19 | complement(1978145..1978561) | PHAGE_Thermo_THSA_485A: hypothetical protein; Cthe_1652; phage(gi397912653) | 2e-36 | Click |
| 20 | complement(1978551..1979909) | PHAGE_Thermo_THSA_485A: SNF2-related protein; Cthe_1653; phage(gi397912655) | 2e-116 | Click |
| 21 | complement(1980282..1982201) | hypothetical protein; Cthe_1654 | N/A | Click |
| 22 | 1982360..1982566 | hypothetical protein; Cthe_1655 | N/A | Click |
| 23 | complement(1983046..1983882) | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1656; phage(gi16131429) | 1e-26 | Click |
| 24 | complement(1983905..1984198) | transposase IS3/IS911; Cthe_1657 | N/A | Click |
| 25 | 1984200..1984223 | attL GTTCCATTCTAACTTATTTGGGCT | N/A | Click |
| 26 | 1984293..1985645 | TrkH family potassium uptake protein; Cthe_1658 | N/A | Click |
| 27 | 1985656..1986309 | TrkA-N; Cthe_1659 | N/A | Click |
| 28 | complement(1987731..1988678) | transposase, IS4; Cthe_1660 | N/A | Click |
| 29 | complement(1988983..1989819) | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1661; phage(gi16131429) | 1e-26 | Click |
| 30 | complement(1989842..1990135) | transposase IS3/IS911; Cthe_1662 | N/A | Click |
| 31 | 1990137..1990160 | attR GTTCCATTCTAACTTATTTGGGCT | N/A | Click |
| 32 | 1990184..1990195 | attR TATCATTATATA | N/A | Click |
| 33 | complement(1990391..1990819) | endoribonuclease L-PSP; Cthe_1663 | N/A | Click |
| 34 | complement(1990973..1991650) | MerR family transcriptional regulator; Cthe_1664 | N/A | Click |
| 35 | complement(1991679..1992521) | Hsp33 protein; Cthe_1665 | N/A | Click |
| 36 | 1992713..1993660 | transposase, IS4; Cthe_1666 | N/A | Click |
| 37 | complement(1993828..1994544) | ABC-2 type transporter; Cthe_1667 | N/A | Click |
| 38 | complement(1994546..1995250) | PHAGE_Amsact_moorei_entomopoxvirus__L_: putative ATP-binding cassette transporter; Cthe_1668; phage(gi9964444) | 1e-17 | Click |
| 39 | 1995624..1996121 | DNA recombinase, putative; Cthe_1669 | N/A | Click |
| 40 | 1996122..1996553 | PHAGE_Clostr_phiCD27: putative phage site-specific recombinase; Cthe_1670; phage(gi209901279) | 7e-05 | Click |
| 41 | 1996540..1998108 | PHAGE_Clostr_phiCD27: putative phage site-specific recombinase; Cthe_1671; phage(gi209901279) | 2e-29 | Click |
| 42 | 1998162..1998173 | attR TATTTGGATTTA | N/A | Click |
| 43 | complement(1998190..1998786) | hypothetical protein; Cthe_1672 | N/A | Click |
| 44 | 1999178..1999471 | transposase IS3/IS911; Cthe_1673 | N/A | Click |
| 45 | 1999494..2000330 | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1674; phage(gi16131429) | 1e-26 | Click |
| 46 | 2000569..2000580 | attL TTATCTGAACGT | N/A | Click |
| 47 | 2000720..2001013 | transposase IS3/IS911; Cthe_1675 | N/A | Click |
| 48 | 2001036..2001872 | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1676; phage(gi16131429) | 1e-26 | Click |
| 49 | complement(2002397..2003083) | PHAGE_Elepha_1: envelope glycoprotein M; Cthe_1677; phage(gi496991173) | 5e-05 | Click |
| 50 | complement(2003458..2004093) | hypothetical protein; Cthe_1678 | N/A | Click |
| 51 | complement(2004152..2004883) | PHAGE_Microm_12T: hypothetical protein; Cthe_1679; phage(gi472342811) | 8e-06 | Click |
| 52 | complement(2004915..2005760) | DNA polymerase, beta-like region; Cthe_1680 | N/A | Click |
| 53 | 2006634..2006645 | attR TTATCTGAACGT | N/A | Click |
| 54 | 2006797..2006808 | attR ATCTATTCTCTC | N/A | Click |
| 55 | 2007001..2007294 | transposase IS3/IS911; Cthe_1682 | N/A | Click |
| 56 | 2007317..2008153 | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1683; phage(gi16131429) | 1e-26 | Click |
| 57 | 2008342..2008389 | attL CTAACTTAGAAAAGCTAAAAAACTGTCTTGACAATGGGGAGCATTATA | N/A | Click |
| 58 | complement(2008356..2008961) | PHAGE_Lactob_phiAT3: putative transposase A; Cthe_1684; phage(gi48697273) | 1e-05 | Click |
| 59 | complement(2009036..2010760) | PHAGE_Bacill_SPBc2: ABC transporter; Cthe_1685; phage(gi9630145) | 1e-45 | Click |
| 60 | 2010946..2011239 | transposase IS3/IS911; Cthe_1686 | N/A | Click |
| 61 | 2011262..2012098 | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1687; phage(gi16131429) | 1e-26 | Click |
| 62 | 2012287..2012334 | attR CTAACTTAGAAAAGCTAAAAAACTGTCTTGACAATGGGGAGCATTATA | N/A | Click |
| 63 | 2019951..2019962 | attR TTTAATTAAGGA | N/A | Click |
Region 3, total : 32 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2005790..2005801 | attL TAAAATAGCTTG | N/A | Click |
| 2 | complement(2015423..2016259) | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1691; phage(gi16131429) | 1e-26 | Click |
| 3 | complement(2016282..2016575) | transposase IS3/IS911; Cthe_1692 | N/A | Click |
| 4 | complement(2016683..2017234) | hypothetical protein; Cthe_1693 | N/A | Click |
| 5 | complement(2017702..2018322) | hypothetical protein; Cthe_1694 | N/A | Click |
| 6 | complement(2018315..2019790) | PHAGE_Campyl_CP21: radical SAM domain-containing protein; Cthe_1695; phage(gi422935302) | 5e-09 | Click |
| 7 | 2019835..2019846 | attL TTAATGTAAAAT | N/A | Click |
| 8 | complement(2020110..2020709) | hypothetical protein; Cthe_1696 | N/A | Click |
| 9 | complement(2020719..2020979) | ArsR family transcriptional regulator; Cthe_1697 | N/A | Click |
| 10 | complement(2021290..2021601) | hypothetical protein; Cthe_1698 | N/A | Click |
| 11 | complement(2022140..2023468) | PHAGE_Bacill_WBeta: putative site-specific recombinase; Cthe_1700; phage(gi85701406) | 2e-31 | Click |
| 12 | complement(2023413..2024702) | PHAGE_Bacill_WBeta: putative site-specific recombinase; Cthe_1701; phage(gi85701406) | 4e-35 | Click |
| 13 | 2024741..2024753 | attL ATCACTCTAAAGG | N/A | Click |
| 14 | complement(2024803..2025474) | PHAGE_Deep_s_D6E: lysin; Cthe_1702; phage(gi423262347) | 1e-25 | Click |
| 15 | complement(2025494..2025988) | PHAGE_Halovi_HCTV_5: HNH protein; Cthe_1703; phage(gi509140261) | 3e-08 | Click |
| 16 | complement(2025972..2026382) | PHAGE_Bacill_PBC1: holin; Cthe_1704; phage(gi389060343) | 7e-25 | Click |
| 17 | complement(2026399..2028087) | PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp33; Cthe_1705; phage(gi115334643) | 3e-15 | Click |
| 18 | complement(2028099..2029256) | hypothetical protein; Cthe_1706 | N/A | Click |
| 19 | complement(2029269..2031173) | PHAGE_Lister_LP_030_2: phage capsid and scaffold; Cthe_1707; phage(gi514051949) | 8e-30 | Click |
| 20 | complement(2031173..2031877) | PHAGE_Clostr_phiCD38_2: tail component protein; Cthe_1708; phage(gi333798124) | 1e-23 | Click |
| 21 | complement(2031877..2034156) | PHAGE_Geobac_virus_E2: putative tail tape measure protein; Cthe_1709; phage(gi148747742) | 5e-55 | Click |
| 22 | complement(2034366..2034689) | hypothetical protein; Cthe_1710 | N/A | Click |
| 23 | complement(2034818..2035270) | hypothetical protein; Cthe_1711 | N/A | Click |
| 24 | complement(2035656..2036768) | PHAGE_Spirop_1_R8A2B: putative transposase; Cthe_1712; phage(gi9626114) | 1e-18 | Click |
| 25 | complement(2037023..2037595) | PHAGE_Clostr_phi3626: major tail protein; Cthe_1713; phage(gi20065974) | 6e-35 | Click |
| 26 | complement(2037598..2037927) | PHAGE_Clostr_phiCD6356: hypothetical protein; Cthe_1714; phage(gi326536857) | 3e-18 | Click |
| 27 | complement(2037924..2038316) | PHAGE_Bacill_BtCS33: head-tail joining protein; Cthe_1715; phage(gi392972717) | 1e-16 | Click |
| 28 | complement(2038309..2038635) | PHAGE_Geobac_virus_E2: putative head-tail adaptor; Cthe_1716; phage(gi148747735) | 6e-16 | Click |
| 29 | complement(2038632..2039204) | PHAGE_Rhizob_16_3: p008; Cthe_1717; phage(gi195546539) | 8e-16 | Click |
| 30 | complement(2039246..2039686) | hypothetical protein; Cthe_1718 | N/A | Click |
| 31 | complement(2039699..2040988) | PHAGE_Bacill_virus_1: Phage capsid protein; Cthe_1719; phage(gi155042936) | 4e-07 | Click |
| 32 | complement(2041016..2041759) | PHAGE_Geobac_virus_E2: putative Clp peptidase; Cthe_1720; phage(gi148747731) | 1e-67 | Click |
| 33 | complement(2041764..2043023) | PHAGE_Shigel_SfII: portal protein; Cthe_1721; phage(gi526244639) | 9e-71 | Click |
| 34 | complement(2043035..2045584) | PHAGE_Mycoba_Cjw1: gp8; Cthe_1722; phage(gi29565887) | 9e-117 | Click |
| 35 | complement(2045577..2046059) | PHAGE_Burkho_phi1026b: gp1; Cthe_1723; phage(gi38707891) | 6e-20 | Click |
| 36 | 2049165..2049177 | attR ATCACTCTAAAGG | N/A | Click |
| 37 | 2052373..2052384 | attR TTAATGTAAAAT | N/A | Click |
| 38 | 2052540..2052551 | attR TAAAATAGCTTG | N/A | Click |
Region 4, total : 18 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2361881..2361900 | attL AAACCCAGCTTACCGTTTTA | N/A | Click |
| 2 | 2361920..2361931 | attL CATAATTCTATA | N/A | Click |
| 3 | 2372443..2373429 | PROPHAGE_Shewan_MR-1: ISSod4, transposase; Cthe_1991; phage(gi24373869) | 4e-85 | Click |
| 4 | 2373483..2373776 | transposase IS3/IS911; Cthe_1992 | N/A | Click |
| 5 | 2373799..2374635 | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1993; phage(gi16131429) | 1e-26 | Click |
| 6 | 2374762..2374774 | attL CCCTTGACATCCT | N/A | Click |
| 7 | 2374762..2374774 | attL CCCTTGACATCCT | N/A | Click |
| 8 | complement(2374867..2375205) | hypothetical protein; Cthe_1994 | N/A | Click |
| 9 | 2375284..2376798 | PROPHAGE_Escher_CFT073: transposase; Cthe_1995; phage(gi26248360) | 6e-06 | Click |
| 10 | 2376792..2377517 | PROPHAGE_Escher_CFT073: transposase/IS protein; Cthe_1996; phage(gi26248359) | 1e-31 | Click |
| 11 | complement(2377543..2377857) | hypothetical protein; Cthe_1997 | N/A | Click |
| 12 | complement(2377870..2378625) | PHAGE_Mycoba_Gizmo: portal protein; Cthe_1998; phage(gi509142024) | 4e-07 | Click |
| 13 | complement(2378816..2379886) | PHAGE_Spirop_1_R8A2B: putative transposase; Cthe_1999; phage(gi9626114) | 2e-13 | Click |
| 14 | 2380761..2380773 | attR CCCTTGACATCCT | N/A | Click |
| 15 | complement(2380863..2381699) | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_2000; phage(gi16131429) | 1e-26 | Click |
| 16 | complement(2381722..2382015) | transposase IS3/IS911; Cthe_2001 | N/A | Click |
| 17 | complement(2382106..2382582) | hypothetical protein; Cthe_2002 | N/A | Click |
| 18 | 2383682..2385166 | PROPHAGE_Escher_CFT073: transposase; Cthe_2004; phage(gi26248360) | 1e-15 | Click |
| 19 | 2385166..2385924 | PROPHAGE_Escher_CFT073: transposase/IS protein; Cthe_2005; phage(gi26248359) | 4e-46 | Click |
| 20 | complement(2387414..2387932) | hypothetical protein; Cthe_2008 | N/A | Click |
| 21 | complement(2388072..2388701) | hypothetical protein; Cthe_2009 | N/A | Click |
| 22 | complement(2388911..2390149) | hypothetical protein; Cthe_2010 | N/A | Click |
| 23 | 2391217..2391229 | attR CCCTTGACATCCT | N/A | Click |
| 24 | 2391312..2391323 | attR CATAATTCTATA | N/A | Click |
| 25 | complement(2391319..2392155) | PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_2012; phage(gi16131429) | 1e-26 | Click |
| 26 | 2401548..2401567 | attR AAACCCAGCTTACCGTTTTA | N/A | Click |
Region 5, total : 48 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2921887..2925150) | PHAGE_Bathyc_BpV1: hypothetical protein; Cthe_2451; phage(gi313768125) | 2e-47 | Click |
| 2 | complement(2925365..2927173) | oligopeptidase F; Cthe_2452 | N/A | Click |
| 3 | complement(2927226..2927582) | hypothetical protein; Cthe_2453 | N/A | Click |
| 4 | complement(2927793..2930921) | PHAGE_Bacill_0305phi8_36: virion structural protein; Cthe_2454; phage(gi156564144) | 4e-08 | Click |
| 5 | 2931114..2931190 | tRNA | N/A | Click |
| 6 | 2931143..2931196 | attL GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG | N/A | Click |
| 7 | complement(2931283..2932395) | PHAGE_Phage_OH2: integrase; Cthe_2455; phage(gi526118367) | 1e-41 | Click |
| 8 | complement(2932453..2932875) | nuclease; Cthe_2456 | N/A | Click |
| 9 | 2932954..2933160 | PHAGE_Staphy_X2: ORF083; Cthe_2457; phage(gi66394730) | 2e-17 | Click |
| 10 | complement(2933136..2933600) | PHAGE_Staphy_X2: ORF031; Cthe_2458; phage(gi66394700) | 2e-21 | Click |
| 11 | complement(2933630..2934070) | PHAGE_Bacill_phi105: hypothetical protein phi105_33; Cthe_2459; phage(gi22855026) | 2e-23 | Click |
| 12 | complement(2934086..2934514) | PHAGE_Geobac_GBSV1: immunity repressor protein; Cthe_2460; phage(gi115334658) | 5e-12 | Click |
| 13 | 2934642..2934881 | PHAGE_Lister_B054: gp42; Cthe_2461; phage(gi157325326) | 2e-07 | Click |
| 14 | 2934900..2935646 | PHAGE_Bacill_PM1: hypothetical protein; Cthe_2462; phage(gi472438275) | 4e-44 | Click |
| 15 | 2935643..2935867 | DNA binding domain-containing protein; Cthe_2463 | N/A | Click |
| 16 | 2936562..2937113 | PHAGE_Bacill_phi105: hypothetical protein phi105_38; Cthe_2464; phage(gi22855031) | 4e-28 | Click |
| 17 | 2937114..2938019 | PHAGE_Geobac_virus_E2: hypothetical protein GBVE2_gp036; Cthe_2465; phage(gi148747763) | 2e-73 | Click |
| 18 | 2938591..2939673 | PHAGE_Mycoba_Butters: hypothetical protein; Cthe_2466; phage(gi479336522) | 2e-06 | Click |
| 19 | 2939670..2940506 | PHAGE_Lactob_c5: putative DnaC; Cthe_2467; phage(gi418488188) | 6e-25 | Click |
| 20 | 2940508..2940882 | hypothetical protein; Cthe_2468 | N/A | Click |
| 21 | 2940930..2941352 | PHAGE_Thermo_THSA_485A: prophage LambdaCh01, RinA family protein phage transcriptional regulator; Cthe_2469; phage(gi397912642) | 1e-14 | Click |
| 22 | 2941811..2942653 | PHAGE_Parame_bursaria_Chlorella_virus_AR158: hypothetical protein AR158_C701R; Cthe_2470; phage(gi157953891) | 5e-48 | Click |
| 23 | 2942646..2943926 | hypothetical protein; Cthe_2471 | N/A | Click |
| 24 | 2944119..2944964 | PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_27; Cthe_2472; phage(gi13487828) | 1e-45 | Click |
| 25 | 2945216..2945665 | PHAGE_Phage_OH2: terminase small subunit; Cthe_2473; phage(gi526118336) | 4e-39 | Click |
| 26 | 2945643..2946899 | PHAGE_Phage_OH2: terminase large subunit; Cthe_2474; phage(gi526118335) | 7e-113 | Click |
| 27 | 2946915..2948348 | PHAGE_Phage_OH2: phage portal protein, SPP1; Cthe_2475; phage(gi526118334) | 7e-91 | Click |
| 28 | 2948505..2949914 | PHAGE_Phage_OH2: SPP1 family phage head morphogenesis protein; Cthe_2476; phage(gi526118333) | 5e-76 | Click |
| 29 | 2949911..2950117 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2477; phage(gi526118332) | 3e-07 | Click |
| 30 | 2950290..2950847 | PHAGE_Staphy_PH15: putative phage minor capsid protein; Cthe_2478; phage(gi119967838) | 6e-21 | Click |
| 31 | 2950866..2951789 | PHAGE_Clostr_phi_CD119: putative capsid protein; Cthe_2479; phage(gi90592716) | 2e-71 | Click |
| 32 | 2951926..2952327 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2480; phage(gi526118328) | 5e-05 | Click |
| 33 | 2952324..2952659 | PHAGE_Clostr_phi_CD119: hypothetical protein CDBPCV119_gp11; Cthe_2481; phage(gi90592647) | 3e-06 | Click |
| 34 | 2952656..2953066 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2482; phage(gi526118326) | 3e-13 | Click |
| 35 | 2953056..2953475 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2483; phage(gi526118325) | 2e-11 | Click |
| 36 | complement(2953638..2954927) | PROPHAGE_Escher_CFT073: transposase; Cthe_2484; phage(gi26248352) | 1e-18 | Click |
| 37 | 2955379..2956425 | PHAGE_Strept_EJ_1: sheath tail protein; Cthe_2485; phage(gi39653727) | 3e-45 | Click |
| 38 | 2956446..2956922 | PHAGE_Phage_OH2: core tail protein; Cthe_2486; phage(gi526118322) | 9e-21 | Click |
| 39 | 2956939..2957352 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2487; phage(gi526118321) | 3e-15 | Click |
| 40 | 2957545..2959380 | PHAGE_Phage_OH2: phage tape measure protein; Cthe_2488; phage(gi526118320) | 3e-91 | Click |
| 41 | 2959377..2960036 | PHAGE_Phage_OH2: peptidoglycan-binding lysin domain-containing; Cthe_2489; phage(gi526118319) | 6e-26 | Click |
| 42 | 2960033..2960977 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2490; phage(gi526118318) | 4e-57 | Click |
| 43 | 2961204..2961599 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2491; phage(gi526118316) | 2e-19 | Click |
| 44 | 2961599..2962657 | PHAGE_Phage_OH2: baseplate J; Cthe_2492; phage(gi526118315) | 3e-62 | Click |
| 45 | 2962647..2963249 | PHAGE_Phage_OH2: hypothetical protein; Cthe_2493; phage(gi526118314) | 1e-08 | Click |
| 46 | 2963259..2963543 | hypothetical protein; Cthe_2494 | N/A | Click |
| 47 | 2963546..2964928 | PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp29; Cthe_2495; phage(gi209901266) | 5e-07 | Click |
| 48 | 2964933..2965253 | PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp30; Cthe_2496; phage(gi209901267) | 1e-11 | Click |
| 49 | 2965495..2965785 | hypothetical protein; Cthe_2497 | N/A | Click |
| 50 | 2965801..2966457 | PHAGE_Bacill_phi105: hypothetical protein phi105_26; Cthe_2498; phage(gi22855019) | 3e-32 | Click |
| 51 | 2968318..2968371 | attR GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG | N/A | Click |