The gene/protein map for NC_013973 does not yet exist.

Definition Clostridium thermocellum ATCC 27405, complete genome.
Accession NC_009012
Length 3,843,301
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 24 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1937673..1937685  attL    ACAATACCATTAT  N/A  Click
2 complement(1938476..1938931)  PHAGE_Entero_phiFL3A: integrase; Cthe_1608; phage(gi281416214)  1e-05  Click
3 complement(1938931..1940499)  PHAGE_Bacill_Fah: site-specific serine recombinase; Cthe_1609; phage(gi89152504)  8e-38  Click
4 complement(1940561..1940779)  hypothetical protein; Cthe_1610  N/A  Click
5 complement(1940837..1941841)  PHAGE_Entero_phiFL4A: endolysin; Cthe_1611; phage(gi281416489)  9e-10  Click
6 complement(1941838..1942257)  PHAGE_Bacill_Fah: holin; Cthe_1612; phage(gi89152494)  7e-29  Click
7 complement(1942344..1944767)  glycosyl hydrolase-like protein; Cthe_1613  N/A  Click
8 complement(1944809..1945384)  hypothetical protein; Cthe_1614  N/A  Click
9 complement(1945394..1945588)  hypothetical protein; Cthe_1615  N/A  Click
10 complement(1945599..1948121)  PHAGE_Lister_LP_030_2: phage capsid and scaffold; Cthe_1616; phage(gi514051949)  1e-10  Click
11 complement(1948126..1948899)  PHAGE_Clostr_phiCD38_2: tail component protein; Cthe_1617; phage(gi333798124)  7e-09  Click
12 complement(1948913..1951201)  PHAGE_Strept_Dp_1: TMP; Cthe_1618; phage(gi327198366)  7e-44  Click
13 1951335..1951607  AbrB family transcriptional regulator; Cthe_1619  N/A  Click
14 1951604..1952008  hypothetical protein; Cthe_1620  N/A  Click
15 complement(1952057..1952248)  hypothetical protein; Cthe_1621  N/A  Click
16 complement(1952245..1952628)  hypothetical protein; Cthe_1622  N/A  Click
17 complement(1952631..1953227)  PHAGE_Bacill_Fah: major tail protein; Cthe_1623; phage(gi89152489)  2e-15  Click
18 complement(1953233..1953577)  hypothetical protein; Cthe_1624  N/A  Click
19 complement(1953574..1953984)  PHAGE_Bacill_BtCS33: head-tail joining protein; Cthe_1625; phage(gi392972717)  8e-06  Click
20 complement(1954022..1954357)  phage head-tail adaptor, putative; Cthe_1626  N/A  Click
21 complement(1954360..1954668)  uncharacterized phage protein; Cthe_1627  N/A  Click
22 complement(1954690..1955892)  PHAGE_Entero_phiP27: putative major capsid protein; Cthe_1628; phage(gi18249904)  2e-47  Click
23 complement(1955943..1956671)  PHAGE_Geobac_virus_E2: putative Clp peptidase; Cthe_1629; phage(gi148747731)  5e-48  Click
24 complement(1956610..1957932)  PHAGE_Burkho_phi644_2: gp4, phage portal protein, HK97 family; Cthe_1630; phage(gi134288632)  2e-73  Click
25 complement(1958009..1959793)  PHAGE_Entero_Fels_2: hypothetical protein STM2723.1.Fels2; Cthe_1631; phage(gi169936050)  1e-62  Click
26 1968224..1968236  attR    ACAATACCATTAT  N/A  Click
Region 2, total : 49 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1959816..1959827  attL    TTTAATTAAGGA  N/A  Click
2 1959969..1959980  attL    ATCTATTCTCTC  N/A  Click
3 complement(1964406..1965659)  PHAGE_Strept_EJ_1: transferase; Cthe_1638; phage(gi39653711)  2e-55  Click
4 complement(1965665..1966963)  PHAGE_Lister_B054: gp77; Cthe_1639; phage(gi157325361)  1e-39  Click
5 complement(1967120..1967671)  hypothetical protein; Cthe_1640  N/A  Click
6 complement(1967792..1968151)  PHAGE_Burkho_phiE125: putative class I holin; Cthe_1641; phage(gi17975232)  3e-17  Click
7 1968236..1968247  attL    TATTTGGATTTA  N/A  Click
8 complement(1968273..1968515)  hypothetical protein; Cthe_1642  N/A  Click
9 1968590..1968601  attL    TATCATTATATA  N/A  Click
10 complement(1968659..1969657)  PHAGE_Lactoc_bIL311: Orf21; Cthe_1643; phage(gi13095679)  3e-24  Click
11 complement(1969697..1970131)  hypothetical protein; Cthe_1644  N/A  Click
12 complement(1970346..1970801)  phage-associated protein; Cthe_1645  N/A  Click
13 complement(1970893..1971195)  PHAGE_Thermo_THSA_485A: VRR-NUC domain-containing protein; Cthe_1646; phage(gi397912645)  1e-27  Click
14 complement(1971496..1974051)  PHAGE_Bacill_phi105: hypothetical protein phi105_42; Cthe_1647; phage(gi22855035)  5e-51  Click
15 complement(1974048..1974473)  PHAGE_Yersin_phiR1_RT: FIG00694808: hypothetical protein; Cthe_1648; phage(gi431808968)  1e-06  Click
16 complement(1974489..1975286)  PHAGE_Staphy_37: ORF016; Cthe_1649; phage(gi66395745)  3e-57  Click
17 complement(1975291..1977213)  PHAGE_Bacill_phBC6A51: DNA polymerase I; Cthe_1650; phage(gi31415758)  3e-67  Click
18 complement(1977271..1978023)  PHAGE_Thermo_THSA_485A: hypothetical protein; Cthe_1651; phage(gi397912650)  1e-51  Click
19 complement(1978145..1978561)  PHAGE_Thermo_THSA_485A: hypothetical protein; Cthe_1652; phage(gi397912653)  2e-36  Click
20 complement(1978551..1979909)  PHAGE_Thermo_THSA_485A: SNF2-related protein; Cthe_1653; phage(gi397912655)  2e-116  Click
21 complement(1980282..1982201)  hypothetical protein; Cthe_1654  N/A  Click
22 1982360..1982566  hypothetical protein; Cthe_1655  N/A  Click
23 complement(1983046..1983882)  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1656; phage(gi16131429)  1e-26  Click
24 complement(1983905..1984198)  transposase IS3/IS911; Cthe_1657  N/A  Click
25 1984200..1984223  attL    GTTCCATTCTAACTTATTTGGGCT  N/A  Click
26 1984293..1985645  TrkH family potassium uptake protein; Cthe_1658  N/A  Click
27 1985656..1986309  TrkA-N; Cthe_1659  N/A  Click
28 complement(1987731..1988678)  transposase, IS4; Cthe_1660  N/A  Click
29 complement(1988983..1989819)  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1661; phage(gi16131429)  1e-26  Click
30 complement(1989842..1990135)  transposase IS3/IS911; Cthe_1662  N/A  Click
31 1990137..1990160  attR    GTTCCATTCTAACTTATTTGGGCT  N/A  Click
32 1990184..1990195  attR    TATCATTATATA  N/A  Click
33 complement(1990391..1990819)  endoribonuclease L-PSP; Cthe_1663  N/A  Click
34 complement(1990973..1991650)  MerR family transcriptional regulator; Cthe_1664  N/A  Click
35 complement(1991679..1992521)  Hsp33 protein; Cthe_1665  N/A  Click
36 1992713..1993660  transposase, IS4; Cthe_1666  N/A  Click
37 complement(1993828..1994544)  ABC-2 type transporter; Cthe_1667  N/A  Click
38 complement(1994546..1995250)  PHAGE_Amsact_moorei_entomopoxvirus__L_: putative ATP-binding cassette transporter; Cthe_1668; phage(gi9964444)  1e-17  Click
39 1995624..1996121  DNA recombinase, putative; Cthe_1669  N/A  Click
40 1996122..1996553  PHAGE_Clostr_phiCD27: putative phage site-specific recombinase; Cthe_1670; phage(gi209901279)  7e-05  Click
41 1996540..1998108  PHAGE_Clostr_phiCD27: putative phage site-specific recombinase; Cthe_1671; phage(gi209901279)  2e-29  Click
42 1998162..1998173  attR    TATTTGGATTTA  N/A  Click
43 complement(1998190..1998786)  hypothetical protein; Cthe_1672  N/A  Click
44 1999178..1999471  transposase IS3/IS911; Cthe_1673  N/A  Click
45 1999494..2000330  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1674; phage(gi16131429)  1e-26  Click
46 2000569..2000580  attL    TTATCTGAACGT  N/A  Click
47 2000720..2001013  transposase IS3/IS911; Cthe_1675  N/A  Click
48 2001036..2001872  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1676; phage(gi16131429)  1e-26  Click
49 complement(2002397..2003083)  PHAGE_Elepha_1: envelope glycoprotein M; Cthe_1677; phage(gi496991173)  5e-05  Click
50 complement(2003458..2004093)  hypothetical protein; Cthe_1678  N/A  Click
51 complement(2004152..2004883)  PHAGE_Microm_12T: hypothetical protein; Cthe_1679; phage(gi472342811)  8e-06  Click
52 complement(2004915..2005760)  DNA polymerase, beta-like region; Cthe_1680  N/A  Click
53 2006634..2006645  attR    TTATCTGAACGT  N/A  Click
54 2006797..2006808  attR    ATCTATTCTCTC  N/A  Click
55 2007001..2007294  transposase IS3/IS911; Cthe_1682  N/A  Click
56 2007317..2008153  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1683; phage(gi16131429)  1e-26  Click
57 2008342..2008389  attL    CTAACTTAGAAAAGCTAAAAAACTGTCTTGACAATGGGGAGCATTATA  N/A  Click
58 complement(2008356..2008961)  PHAGE_Lactob_phiAT3: putative transposase A; Cthe_1684; phage(gi48697273)  1e-05  Click
59 complement(2009036..2010760)  PHAGE_Bacill_SPBc2: ABC transporter; Cthe_1685; phage(gi9630145)  1e-45  Click
60 2010946..2011239  transposase IS3/IS911; Cthe_1686  N/A  Click
61 2011262..2012098  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1687; phage(gi16131429)  1e-26  Click
62 2012287..2012334  attR    CTAACTTAGAAAAGCTAAAAAACTGTCTTGACAATGGGGAGCATTATA  N/A  Click
63 2019951..2019962  attR    TTTAATTAAGGA  N/A  Click
Region 3, total : 32 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2005790..2005801  attL    TAAAATAGCTTG  N/A  Click
2 complement(2015423..2016259)  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1691; phage(gi16131429)  1e-26  Click
3 complement(2016282..2016575)  transposase IS3/IS911; Cthe_1692  N/A  Click
4 complement(2016683..2017234)  hypothetical protein; Cthe_1693  N/A  Click
5 complement(2017702..2018322)  hypothetical protein; Cthe_1694  N/A  Click
6 complement(2018315..2019790)  PHAGE_Campyl_CP21: radical SAM domain-containing protein; Cthe_1695; phage(gi422935302)  5e-09  Click
7 2019835..2019846  attL    TTAATGTAAAAT  N/A  Click
8 complement(2020110..2020709)  hypothetical protein; Cthe_1696  N/A  Click
9 complement(2020719..2020979)  ArsR family transcriptional regulator; Cthe_1697  N/A  Click
10 complement(2021290..2021601)  hypothetical protein; Cthe_1698  N/A  Click
11 complement(2022140..2023468)  PHAGE_Bacill_WBeta: putative site-specific recombinase; Cthe_1700; phage(gi85701406)  2e-31  Click
12 complement(2023413..2024702)  PHAGE_Bacill_WBeta: putative site-specific recombinase; Cthe_1701; phage(gi85701406)  4e-35  Click
13 2024741..2024753  attL    ATCACTCTAAAGG  N/A  Click
14 complement(2024803..2025474)  PHAGE_Deep_s_D6E: lysin; Cthe_1702; phage(gi423262347)  1e-25  Click
15 complement(2025494..2025988)  PHAGE_Halovi_HCTV_5: HNH protein; Cthe_1703; phage(gi509140261)  3e-08  Click
16 complement(2025972..2026382)  PHAGE_Bacill_PBC1: holin; Cthe_1704; phage(gi389060343)  7e-25  Click
17 complement(2026399..2028087)  PHAGE_Geobac_GBSV1: hypothetical protein GPGV1_gp33; Cthe_1705; phage(gi115334643)  3e-15  Click
18 complement(2028099..2029256)  hypothetical protein; Cthe_1706  N/A  Click
19 complement(2029269..2031173)  PHAGE_Lister_LP_030_2: phage capsid and scaffold; Cthe_1707; phage(gi514051949)  8e-30  Click
20 complement(2031173..2031877)  PHAGE_Clostr_phiCD38_2: tail component protein; Cthe_1708; phage(gi333798124)  1e-23  Click
21 complement(2031877..2034156)  PHAGE_Geobac_virus_E2: putative tail tape measure protein; Cthe_1709; phage(gi148747742)  5e-55  Click
22 complement(2034366..2034689)  hypothetical protein; Cthe_1710  N/A  Click
23 complement(2034818..2035270)  hypothetical protein; Cthe_1711  N/A  Click
24 complement(2035656..2036768)  PHAGE_Spirop_1_R8A2B: putative transposase; Cthe_1712; phage(gi9626114)  1e-18  Click
25 complement(2037023..2037595)  PHAGE_Clostr_phi3626: major tail protein; Cthe_1713; phage(gi20065974)  6e-35  Click
26 complement(2037598..2037927)  PHAGE_Clostr_phiCD6356: hypothetical protein; Cthe_1714; phage(gi326536857)  3e-18  Click
27 complement(2037924..2038316)  PHAGE_Bacill_BtCS33: head-tail joining protein; Cthe_1715; phage(gi392972717)  1e-16  Click
28 complement(2038309..2038635)  PHAGE_Geobac_virus_E2: putative head-tail adaptor; Cthe_1716; phage(gi148747735)  6e-16  Click
29 complement(2038632..2039204)  PHAGE_Rhizob_16_3: p008; Cthe_1717; phage(gi195546539)  8e-16  Click
30 complement(2039246..2039686)  hypothetical protein; Cthe_1718  N/A  Click
31 complement(2039699..2040988)  PHAGE_Bacill_virus_1: Phage capsid protein; Cthe_1719; phage(gi155042936)  4e-07  Click
32 complement(2041016..2041759)  PHAGE_Geobac_virus_E2: putative Clp peptidase; Cthe_1720; phage(gi148747731)  1e-67  Click
33 complement(2041764..2043023)  PHAGE_Shigel_SfII: portal protein; Cthe_1721; phage(gi526244639)  9e-71  Click
34 complement(2043035..2045584)  PHAGE_Mycoba_Cjw1: gp8; Cthe_1722; phage(gi29565887)  9e-117  Click
35 complement(2045577..2046059)  PHAGE_Burkho_phi1026b: gp1; Cthe_1723; phage(gi38707891)  6e-20  Click
36 2049165..2049177  attR    ATCACTCTAAAGG  N/A  Click
37 2052373..2052384  attR    TTAATGTAAAAT  N/A  Click
38 2052540..2052551  attR    TAAAATAGCTTG  N/A  Click
Region 4, total : 18 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2361881..2361900  attL    AAACCCAGCTTACCGTTTTA  N/A  Click
2 2361920..2361931  attL    CATAATTCTATA  N/A  Click
3 2372443..2373429  PROPHAGE_Shewan_MR-1: ISSod4, transposase; Cthe_1991; phage(gi24373869)  4e-85  Click
4 2373483..2373776  transposase IS3/IS911; Cthe_1992  N/A  Click
5 2373799..2374635  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_1993; phage(gi16131429)  1e-26  Click
6 2374762..2374774  attL    CCCTTGACATCCT  N/A  Click
7 2374762..2374774  attL    CCCTTGACATCCT  N/A  Click
8 complement(2374867..2375205)  hypothetical protein; Cthe_1994  N/A  Click
9 2375284..2376798  PROPHAGE_Escher_CFT073: transposase; Cthe_1995; phage(gi26248360)  6e-06  Click
10 2376792..2377517  PROPHAGE_Escher_CFT073: transposase/IS protein; Cthe_1996; phage(gi26248359)  1e-31  Click
11 complement(2377543..2377857)  hypothetical protein; Cthe_1997  N/A  Click
12 complement(2377870..2378625)  PHAGE_Mycoba_Gizmo: portal protein; Cthe_1998; phage(gi509142024)  4e-07  Click
13 complement(2378816..2379886)  PHAGE_Spirop_1_R8A2B: putative transposase; Cthe_1999; phage(gi9626114)  2e-13  Click
14 2380761..2380773  attR    CCCTTGACATCCT  N/A  Click
15 complement(2380863..2381699)  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_2000; phage(gi16131429)  1e-26  Click
16 complement(2381722..2382015)  transposase IS3/IS911; Cthe_2001  N/A  Click
17 complement(2382106..2382582)  hypothetical protein; Cthe_2002  N/A  Click
18 2383682..2385166  PROPHAGE_Escher_CFT073: transposase; Cthe_2004; phage(gi26248360)  1e-15  Click
19 2385166..2385924  PROPHAGE_Escher_CFT073: transposase/IS protein; Cthe_2005; phage(gi26248359)  4e-46  Click
20 complement(2387414..2387932)  hypothetical protein; Cthe_2008  N/A  Click
21 complement(2388072..2388701)  hypothetical protein; Cthe_2009  N/A  Click
22 complement(2388911..2390149)  hypothetical protein; Cthe_2010  N/A  Click
23 2391217..2391229  attR    CCCTTGACATCCT  N/A  Click
24 2391312..2391323  attR    CATAATTCTATA  N/A  Click
25 complement(2391319..2392155)  PROPHAGE_Escher_MG1655: IS150 transposase B; Cthe_2012; phage(gi16131429)  1e-26  Click
26 2401548..2401567  attR    AAACCCAGCTTACCGTTTTA  N/A  Click
Region 5, total : 48 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(2921887..2925150)  PHAGE_Bathyc_BpV1: hypothetical protein; Cthe_2451; phage(gi313768125)  2e-47  Click
2 complement(2925365..2927173)  oligopeptidase F; Cthe_2452  N/A  Click
3 complement(2927226..2927582)  hypothetical protein; Cthe_2453  N/A  Click
4 complement(2927793..2930921)  PHAGE_Bacill_0305phi8_36: virion structural protein; Cthe_2454; phage(gi156564144)  4e-08  Click
5 2931114..2931190  tRNA  N/A  Click
6 2931143..2931196  attL    GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG  N/A  Click
7 complement(2931283..2932395)  PHAGE_Phage_OH2: integrase; Cthe_2455; phage(gi526118367)  1e-41  Click
8 complement(2932453..2932875)  nuclease; Cthe_2456  N/A  Click
9 2932954..2933160  PHAGE_Staphy_X2: ORF083; Cthe_2457; phage(gi66394730)  2e-17  Click
10 complement(2933136..2933600)  PHAGE_Staphy_X2: ORF031; Cthe_2458; phage(gi66394700)  2e-21  Click
11 complement(2933630..2934070)  PHAGE_Bacill_phi105: hypothetical protein phi105_33; Cthe_2459; phage(gi22855026)  2e-23  Click
12 complement(2934086..2934514)  PHAGE_Geobac_GBSV1: immunity repressor protein; Cthe_2460; phage(gi115334658)  5e-12  Click
13 2934642..2934881  PHAGE_Lister_B054: gp42; Cthe_2461; phage(gi157325326)  2e-07  Click
14 2934900..2935646  PHAGE_Bacill_PM1: hypothetical protein; Cthe_2462; phage(gi472438275)  4e-44  Click
15 2935643..2935867  DNA binding domain-containing protein; Cthe_2463  N/A  Click
16 2936562..2937113  PHAGE_Bacill_phi105: hypothetical protein phi105_38; Cthe_2464; phage(gi22855031)  4e-28  Click
17 2937114..2938019  PHAGE_Geobac_virus_E2: hypothetical protein GBVE2_gp036; Cthe_2465; phage(gi148747763)  2e-73  Click
18 2938591..2939673  PHAGE_Mycoba_Butters: hypothetical protein; Cthe_2466; phage(gi479336522)  2e-06  Click
19 2939670..2940506  PHAGE_Lactob_c5: putative DnaC; Cthe_2467; phage(gi418488188)  6e-25  Click
20 2940508..2940882  hypothetical protein; Cthe_2468  N/A  Click
21 2940930..2941352  PHAGE_Thermo_THSA_485A: prophage LambdaCh01, RinA family protein phage transcriptional regulator; Cthe_2469; phage(gi397912642)  1e-14  Click
22 2941811..2942653  PHAGE_Parame_bursaria_Chlorella_virus_AR158: hypothetical protein AR158_C701R; Cthe_2470; phage(gi157953891)  5e-48  Click
23 2942646..2943926  hypothetical protein; Cthe_2471  N/A  Click
24 2944119..2944964  PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_27; Cthe_2472; phage(gi13487828)  1e-45  Click
25 2945216..2945665  PHAGE_Phage_OH2: terminase small subunit; Cthe_2473; phage(gi526118336)  4e-39  Click
26 2945643..2946899  PHAGE_Phage_OH2: terminase large subunit; Cthe_2474; phage(gi526118335)  7e-113  Click
27 2946915..2948348  PHAGE_Phage_OH2: phage portal protein, SPP1; Cthe_2475; phage(gi526118334)  7e-91  Click
28 2948505..2949914  PHAGE_Phage_OH2: SPP1 family phage head morphogenesis protein; Cthe_2476; phage(gi526118333)  5e-76  Click
29 2949911..2950117  PHAGE_Phage_OH2: hypothetical protein; Cthe_2477; phage(gi526118332)  3e-07  Click
30 2950290..2950847  PHAGE_Staphy_PH15: putative phage minor capsid protein; Cthe_2478; phage(gi119967838)  6e-21  Click
31 2950866..2951789  PHAGE_Clostr_phi_CD119: putative capsid protein; Cthe_2479; phage(gi90592716)  2e-71  Click
32 2951926..2952327  PHAGE_Phage_OH2: hypothetical protein; Cthe_2480; phage(gi526118328)  5e-05  Click
33 2952324..2952659  PHAGE_Clostr_phi_CD119: hypothetical protein CDBPCV119_gp11; Cthe_2481; phage(gi90592647)  3e-06  Click
34 2952656..2953066  PHAGE_Phage_OH2: hypothetical protein; Cthe_2482; phage(gi526118326)  3e-13  Click
35 2953056..2953475  PHAGE_Phage_OH2: hypothetical protein; Cthe_2483; phage(gi526118325)  2e-11  Click
36 complement(2953638..2954927)  PROPHAGE_Escher_CFT073: transposase; Cthe_2484; phage(gi26248352)  1e-18  Click
37 2955379..2956425  PHAGE_Strept_EJ_1: sheath tail protein; Cthe_2485; phage(gi39653727)  3e-45  Click
38 2956446..2956922  PHAGE_Phage_OH2: core tail protein; Cthe_2486; phage(gi526118322)  9e-21  Click
39 2956939..2957352  PHAGE_Phage_OH2: hypothetical protein; Cthe_2487; phage(gi526118321)  3e-15  Click
40 2957545..2959380  PHAGE_Phage_OH2: phage tape measure protein; Cthe_2488; phage(gi526118320)  3e-91  Click
41 2959377..2960036  PHAGE_Phage_OH2: peptidoglycan-binding lysin domain-containing; Cthe_2489; phage(gi526118319)  6e-26  Click
42 2960033..2960977  PHAGE_Phage_OH2: hypothetical protein; Cthe_2490; phage(gi526118318)  4e-57  Click
43 2961204..2961599  PHAGE_Phage_OH2: hypothetical protein; Cthe_2491; phage(gi526118316)  2e-19  Click
44 2961599..2962657  PHAGE_Phage_OH2: baseplate J; Cthe_2492; phage(gi526118315)  3e-62  Click
45 2962647..2963249  PHAGE_Phage_OH2: hypothetical protein; Cthe_2493; phage(gi526118314)  1e-08  Click
46 2963259..2963543  hypothetical protein; Cthe_2494  N/A  Click
47 2963546..2964928  PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp29; Cthe_2495; phage(gi209901266)  5e-07  Click
48 2964933..2965253  PHAGE_Clostr_phiCD27: hypothetical protein phiCD27_gp30; Cthe_2496; phage(gi209901267)  1e-11  Click
49 2965495..2965785  hypothetical protein; Cthe_2497  N/A  Click
50 2965801..2966457  PHAGE_Bacill_phi105: hypothetical protein phi105_26; Cthe_2498; phage(gi22855019)  3e-32  Click
51 2968318..2968371  attR    GGTTTCCTAAACCGCAGGTCAGGGGTTCGAATCCCTTTGGGCACACCAGAAAAG  N/A  Click