NC_012108: Cannot find summary information.

Definition Desulfovibrio desulfuricans subsp. desulfuricans str. G20 chromosome, complete genome.
Accession NC_007519
Length 3,730,232
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 32 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 926841..926853  attL    TTCCGGTAAGTAA  N/A  Click
2 complement(939853..940767)  PHAGE_Thermu_26: phage XerD-like integrase; Dde_0912; phage(gi157265417)  4e-16  Click
3 complement(940748..941122)  hypothetical protein; Dde_0913  N/A  Click
4 complement(941156..941389)  hypothetical protein; Dde_0914  N/A  Click
5 941490..941762  hypothetical protein; Dde_0915  N/A  Click
6 941759..942037  hypothetical protein; Dde_0916  N/A  Click
7 942037..943560  hypothetical protein; Dde_0917  N/A  Click
8 943636..945183  PHAGE_Bacill_36: portal protein; Dde_0918; phage(gi156564103)  2e-09  Click
9 945183..949772  PHAGE_Clostr_phi8074_B1: putative phage head protein; Dde_0919; phage(gi431810362)  2e-07  Click
10 949769..950281  hypothetical protein; Dde_0920  N/A  Click
11 950278..950631  hypothetical protein; Dde_0921  N/A  Click
12 950735..953131  PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_0922; phage(gi56692778)  5e-07  Click
13 953144..953506  hypothetical protein; Dde_0923  N/A  Click
14 953525..954388  PHAGE_Mycoba_ScottMcG: gp96; Dde_0924; phage(gi203458968)  2e-07  Click
15 954407..954766  hypothetical protein; Dde_0925  N/A  Click
16 954753..955217  hypothetical protein; Dde_0926  N/A  Click
17 955204..955563  hypothetical protein; Dde_0927  N/A  Click
18 955553..956038  PHAGE_Psychr_pOW20_A: hypothetical protein; Dde_0928; phage(gi472339833)  4e-05  Click
19 956098..956721  hypothetical protein; Dde_0929  N/A  Click
20 956734..956991  hypothetical protein; Dde_0930  N/A  Click
21 956994..958523  PHAGE_Bacill_BCD7: putative tail sheath protein; Dde_0931; phage(gi422936048)  6e-69  Click
22 958539..959000  PHAGE_Aeromo_Aeh1: gp19 tail tube protein; Dde_0932; phage(gi38640151)  1e-05  Click
23 959016..959693  PHAGE_Bacill_BCD7: hypothetical protein; Dde_0933; phage(gi422936045)  4e-11  Click
24 959837..963472  PHAGE_Haemop_HP2: orf27; Dde_0934; phage(gi17981843)  3e-48  Click
25 963481..963792  PHAGE_Cellul_phiST: hypothetical protein; Dde_0935; phage(gi472339888)  1e-12  Click
26 963796..964266  hypothetical protein; Dde_0936  N/A  Click
27 964263..964553  hypothetical protein; Dde_0937  N/A  Click
28 964577..964589  attR    TTCCGGTAAGTAA  N/A  Click
29 964620..965903  PHAGE_Entero_2: P2 gpD-like tail protein; Dde_0938; phage(gi169936019)  1e-08  Click
30 965896..966270  PHAGE_Pectob_PP1: peptidase M15A domain-containing protein; Dde_0939; phage(gi423262089)  3e-20  Click
31 966267..966686  PHAGE_Pseudo_Lu11: putative tail assembly protein; Dde_0940; phage(gi388684690)  5e-12  Click
32 966679..967728  hypothetical protein; Dde_0941  N/A  Click
33 967741..968115  hypothetical protein; Dde_0942  N/A  Click
34 968112..968375  PHAGE_Burkho_KL3: gp51; Dde_0943; phage(gi327198096)  1e-07  Click
Region 2, total : 23 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1787761..1787840  attL    TGTAATAGCTGAATTTTTAGCAGGCTTATATCCCAAAGCACCGTCTGGTACACAGCGGTGGTACACAAGGGGTATAAGCC  N/A  Click
2 1787842..1789692  PROPHAGE_Escher_Sakai: putative integrase; Dde_1730; phage(gi15834496)  6e-24  Click
3 complement(1789768..1790265)  PHAGE_Salmon_ST64B: putative antirepressor; Dde_1731; phage(gi23505485)  1e-13  Click
4 complement(1790583..1790753)  hypothetical protein; Dde_1732  N/A  Click
5 complement(1790889..1791041)  hypothetical protein; Dde_1733  N/A  Click
6 complement(1791199..1791903)  PHAGE_Synech_Syn5: internal virion protein; Dde_1734; phage(gi148724486)  1e-08  Click
7 complement(1792651..1793217)  PHAGE_Sodali_phiSG1: resolvase; Dde_1735; phage(gi89886020)  1e-33  Click
8 complement(1793241..1793420)  hypothetical protein; Dde_1736  N/A  Click
9 complement(1793629..1794168)  PHAGE_Bacter_8: conserved phage protein pRha; Dde_1737; phage(gi200003982)  4e-31  Click
10 complement(1794309..1794878)  small HspC2 heat shock protein; Dde_1738  N/A  Click
11 complement(1795314..1796147)  PHAGE_Salmon_epsilon34: Ant; Dde_1739; phage(gi221328691)  3e-10  Click
12 1796162..1796305  hypothetical protein; Dde_1740  N/A  Click
13 complement(1796359..1796913)  PHAGE_Bacter_8: putative antirepressor; Dde_1741; phage(gi200003978)  6e-15  Click
14 complement(1797091..1800063)  PHAGE_Entero_P1: Res; Dde_1742; phage(gi46401632)  1e-69  Click
15 complement(1800075..1801412)  PHAGE_Campyl_NCTC12673: possible methylase; Dde_1743; phage(gi332672404)  5e-18  Click
16 complement(1801446..1802285)  PROPHAGE_Escher_CFT073: transposase insF; Dde_1744; phage(gi26249410)  7e-54  Click
17 complement(1802324..1802629)  PROPHAGE_Xantho_33913: ISxac3 transposase; Dde_1745; phage(gi21231087)  9e-10  Click
18 complement(1802691..1803212)  PHAGE_Campyl_NCTC12673: possible methylase; Dde_1746; phage(gi332672404)  2e-10  Click
19 complement(1803224..1803997)  hypothetical protein; Dde_1747  N/A  Click
20 complement(1803994..1807197)  PHAGE_Rhodot_RM378: similar to DNA helicase; Dde_1748; phage(gi30044094)  2e-11  Click
21 complement(1807285..1807464)  hypothetical protein; Dde_1749  N/A  Click
22 complement(1807661..1807834)  hypothetical protein; Dde_1750  N/A  Click
23 1807731..1807810  attR    TGTAATAGCTGAATTTTTAGCAGGCTTATATCCCAAAGCACCGTCTGGTACACAGCGGTGGTACACAAGGGGTATAAGCC  N/A  Click
24 1807858..1808118  hypothetical protein; Dde_1751  N/A  Click
25 1808192..1810885  PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_1752; phage(gi56692778)  1e-12  Click
Region 3, total : 40 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2766973..2766985  attL    TTGTGCCGCACAA  N/A  Click
2 2776921..2778855  PHAGE_Bacill_WBeta: putative site-specific recombinase; Dde_2774; phage(gi85701406)  3e-18  Click
3 2778862..2778996  hypothetical protein; Dde_2775  N/A  Click
4 2779050..2779382  ArsR family transcriptional regulator; Dde_2776  N/A  Click
5 2779428..2780519  permease-like protein; Dde_2777  N/A  Click
6 2780537..2780767  redox-active disulfide protein 2; Dde_2778  N/A  Click
7 complement(2780902..2781072)  hypothetical protein; Dde_2779  N/A  Click
8 2781079..2781174  hypothetical protein; Dde_2780  N/A  Click
9 2781342..2781605  PHAGE_Bacill_SPBc2: thioredoxin; Dde_2781; phage(gi9630289)  7e-05  Click
10 2781609..2782316  hypothetical protein; Dde_2782  N/A  Click
11 2782421..2782702  hypothetical protein; Dde_2783  N/A  Click
12 2782868..2782972  hypothetical protein; Dde_2784  N/A  Click
13 2782954..2783247  hypothetical protein; Dde_2785  N/A  Click
14 2783316..2783690  rhodanese-like protein; Dde_2786  N/A  Click
15 2783756..2784535  hypothetical protein; Dde_2787  N/A  Click
16 2784550..2784645  hypothetical protein; Dde_2788  N/A  Click
17 2784897..2785034  hypothetical protein; Dde_2789  N/A  Click
18 2785171..2785308  hypothetical protein; Dde_2790  N/A  Click
19 2785456..2786544  arsenical-resistance protein; Dde_2791  N/A  Click
20 2786618..2787058  protein tyrosine phosphatase; Dde_2792  N/A  Click
21 2787055..2787489  protein tyrosine phosphatase; Dde_2793  N/A  Click
22 2787500..2787667  hypothetical protein; Dde_2794  N/A  Click
23 2787767..2788360  PHAGE_Bacter_8: putative antirepressor; Dde_2795; phage(gi200003978)  6e-15  Click
24 2788572..2789405  PHAGE_Salmon_epsilon34: Ant; Dde_2796; phage(gi221328691)  2e-08  Click
25 complement(2789411..2789512)  hypothetical protein; Dde_2797  N/A  Click
26 2789842..2790411  small HspC2 heat shock protein; Dde_2798  N/A  Click
27 2790555..2791169  PHAGE_Bacter_8: conserved phage protein pRha; Dde_2799; phage(gi200003982)  5e-31  Click
28 complement(2791181..2792122)  PHAGE_Clostr_st: putative restriction endonuclase; Dde_2800; phage(gi80159877)  9e-08  Click
29 2792494..2792673  hypothetical protein; Dde_2802  N/A  Click
30 2792697..2793263  PHAGE_Sodali_phiSG1: resolvase; Dde_2803; phage(gi89886020)  2e-33  Click
31 2794012..2794716  PHAGE_Synech_Syn5: internal virion protein; Dde_2804; phage(gi148724486)  1e-08  Click
32 2795036..2795353  PHAGE_Bacill_PM1: hypothetical protein; Dde_2805; phage(gi472438275)  4e-13  Click
33 2795367..2795585  PHAGE_Entero_mEp460: regulatory protein Rha; Dde_2806; phage(gi428782357)  2e-13  Click
34 2795600..2796136  PHAGE_Synech_S_SSM7: hypothetical protein; Dde_2807; phage(gi326783864)  3e-12  Click
35 complement(2796212..2796898)  PROPHAGE_Escher_Sakai: putative ATP-dependent protease; Dde_2808; phage(gi15833954)  2e-31  Click
36 2796990..2797002  attR    TTGTGCCGCACAA  N/A  Click
37 complement(2797035..2797931)  hypothetical protein; Dde_2809  N/A  Click
38 complement(2798052..2798222)  hypothetical protein; Dde_2810  N/A  Click
39 complement(2798297..2798653)  hypothetical protein; Dde_2811  N/A  Click
40 2798669..2799034  hypothetical protein; Dde_2812  N/A  Click
41 complement(2799085..2799186)  hypothetical protein; Dde_2813  N/A  Click
42 2799295..2801463  PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_2814; phage(gi56692778)  5e-09  Click
Region 4, total : 15 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 3323331..3324095  PROPHAGE_Xantho_33913: ISxcC1 transposase; Dde_3342; phage(gi21231060)  9e-69  Click
2 3324143..3324343  hypothetical protein; Dde_3343  N/A  Click
3 complement(3324577..3325125)  hypothetical protein; Dde_3344  N/A  Click
4 complement(3325260..3325745)  PHAGE_Rhodob_RcapMu: c-repressor; Dde_3345; phage(gi356870844)  1e-07  Click
5 3325698..3325856  hypothetical protein; Dde_3346  N/A  Click
6 3326015..3326464  hypothetical protein; Dde_3347  N/A  Click
7 3326464..3326715  hypothetical protein; Dde_3348  N/A  Click
8 3326712..3326906  hypothetical protein; Dde_3349  N/A  Click
9 3326918..3329044  PHAGE_Pseudo_MP22: transposase A; Dde_3350; phage(gi157834977)  2e-27  Click
10 3329054..3329758  PHAGE_Rhodob_RcapMu: transposition protein B; Dde_3351; phage(gi356870854)  1e-12  Click
11 3329755..3330369  hypothetical protein; Dde_3352  N/A  Click
12 3330362..3330565  hypothetical protein; Dde_3353  N/A  Click
13 3330574..3331086  PHAGE_Haemop_SuMu: host-nuclease inhibitor protein; Dde_3354; phage(gi418489043)  1e-07  Click
14 3331096..3331368  hypothetical protein; Dde_3355  N/A  Click
15 3331388..3331675  PHAGE_Rhodob_RcapMu: DNA-binding protein HU; Dde_3356; phage(gi356870859)  9e-13  Click
Region 5, total : 15 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(3333815..3334552)  PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; Dde_3361; phage(gi24373866)  1e-26  Click
2 complement(3334690..3334977)  PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; Dde_3362; phage(gi17546153)  4e-08  Click
3 3335001..3335693  hypothetical protein; Dde_3363  N/A  Click
4 complement(3335977..3336777)  PROPHAGE_Xantho_306: ISxcd1 transposase; Dde_3364; phage(gi21242257)  1e-117  Click
5 complement(3336798..3337064)  PROPHAGE_Xantho_306: ISxac2 transposase; Dde_3365; phage(gi21244663)  7e-35  Click
6 3337063..3337428  hypothetical protein; Dde_3366  N/A  Click
7 3337535..3338032  PHAGE_Burkho_KS9: endolysin gp23; Dde_3367; phage(gi255033754)  4e-19  Click
8 3338036..3338644  hypothetical protein; Dde_3368  N/A  Click
9 3338644..3338970  hypothetical protein; Dde_3369  N/A  Click
10 3338967..3339263  PHAGE_Escher_D108: hypothetical protein; Dde_3370; phage(gi281199669)  2e-12  Click
11 3339268..3339864  PHAGE_Helico_2: hypothetical protein; Dde_3371; phage(gi370703038)  4e-06  Click
12 3339877..3341349  PHAGE_Burkho_BcepMu: gp28; Dde_3372; phage(gi48696938)  3e-140  Click
13 3341360..3342931  PHAGE_Burkho_BcepMu: gp29; Dde_3373; phage(gi48696939)  3e-55  Click
14 3342921..3344201  PHAGE_Burkho_BcepMu: gp30; Dde_3374; phage(gi48696940)  4e-33  Click
15 3344357..3345250  PHAGE_Burkho_BcepMu: gp32; Dde_3375; phage(gi48696942)  3e-28  Click
Region 6, total : 17 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 3346188..3346200  attL    GGACCTCGACAAG  N/A  Click
2 3351086..3353287  PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; Dde_3386; phage(gi428782750)  2e-66  Click
3 3353289..3353804  hypothetical protein; Dde_3387  N/A  Click
4 3353804..3354637  hypothetical protein; Dde_3388  N/A  Click
5 3354624..3355346  PHAGE_Haemop_HP2: orf35; Dde_3389; phage(gi17981851)  4e-08  Click
6 3355768..3356229  PHAGE_Lactob_LP65: hypothetical protein LP65_gp132; Dde_3390; phage(gi56693180)  2e-07  Click
7 3356201..3357364  PHAGE_Haemop_HP2: orf29; Dde_3391; phage(gi17981845)  4e-19  Click
8 3357364..3358011  PHAGE_Ralsto_phiRSA1: phage tail protein gpI; Dde_3392; phage(gi145708096)  2e-06  Click
9 3358022..3359581  PROPHAGE_Salmon_Ty2: variable tail fiber protein; Dde_3393; phage(gi29143754)  2e-17  Click
10 3359594..3360178  PHAGE_Entero_SfV: tail fibre assembly protein; Dde_3394; phage(gi19549010)  5e-07  Click
11 3360417..3360602  PHAGE_Pseudo_B3: Com translational regulator; Dde_3395; phage(gi56692616)  5e-08  Click
12 3360762..3361904  PHAGE_Burkho_phiE255: gp29, conserved hypothetical protein; Dde_3396; phage(gi134288813)  1e-134  Click
13 3361901..3362491  PHAGE_Burkho_phiE255: gp30, formyl transferase, putative; Dde_3397; phage(gi134288807)  1e-41  Click
14 3362598..3362610  attR    GGACCTCGACAAG  N/A  Click
15 3362885..3364108  PHAGE_Pseudo_vB_PaeS_PMG1: integrase; Dde_3398; phage(gi374531680)  4e-16  Click
16 3364112..3365350  hypothetical protein; Dde_3399  N/A  Click
17 complement(3365660..3365857)  hypothetical protein; Dde_3400  N/A  Click
18 3365890..3366162  hypothetical protein; Dde_3401  N/A  Click
19 complement(3366244..3366408)  PROPHAGE_Escher_CFT073: transposase insF; Dde_3402; phage(gi26250329)  2e-06  Click