| Definition | Desulfovibrio desulfuricans subsp. desulfuricans str. G20 chromosome, complete genome. |
|---|---|
| Accession | NC_007519 |
| Length | 3,730,232 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 32 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 926841..926853 | attL TTCCGGTAAGTAA | N/A | Click |
| 2 | complement(939853..940767) | PHAGE_Thermu_26: phage XerD-like integrase; Dde_0912; phage(gi157265417) | 4e-16 | Click |
| 3 | complement(940748..941122) | hypothetical protein; Dde_0913 | N/A | Click |
| 4 | complement(941156..941389) | hypothetical protein; Dde_0914 | N/A | Click |
| 5 | 941490..941762 | hypothetical protein; Dde_0915 | N/A | Click |
| 6 | 941759..942037 | hypothetical protein; Dde_0916 | N/A | Click |
| 7 | 942037..943560 | hypothetical protein; Dde_0917 | N/A | Click |
| 8 | 943636..945183 | PHAGE_Bacill_36: portal protein; Dde_0918; phage(gi156564103) | 2e-09 | Click |
| 9 | 945183..949772 | PHAGE_Clostr_phi8074_B1: putative phage head protein; Dde_0919; phage(gi431810362) | 2e-07 | Click |
| 10 | 949769..950281 | hypothetical protein; Dde_0920 | N/A | Click |
| 11 | 950278..950631 | hypothetical protein; Dde_0921 | N/A | Click |
| 12 | 950735..953131 | PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_0922; phage(gi56692778) | 5e-07 | Click |
| 13 | 953144..953506 | hypothetical protein; Dde_0923 | N/A | Click |
| 14 | 953525..954388 | PHAGE_Mycoba_ScottMcG: gp96; Dde_0924; phage(gi203458968) | 2e-07 | Click |
| 15 | 954407..954766 | hypothetical protein; Dde_0925 | N/A | Click |
| 16 | 954753..955217 | hypothetical protein; Dde_0926 | N/A | Click |
| 17 | 955204..955563 | hypothetical protein; Dde_0927 | N/A | Click |
| 18 | 955553..956038 | PHAGE_Psychr_pOW20_A: hypothetical protein; Dde_0928; phage(gi472339833) | 4e-05 | Click |
| 19 | 956098..956721 | hypothetical protein; Dde_0929 | N/A | Click |
| 20 | 956734..956991 | hypothetical protein; Dde_0930 | N/A | Click |
| 21 | 956994..958523 | PHAGE_Bacill_BCD7: putative tail sheath protein; Dde_0931; phage(gi422936048) | 6e-69 | Click |
| 22 | 958539..959000 | PHAGE_Aeromo_Aeh1: gp19 tail tube protein; Dde_0932; phage(gi38640151) | 1e-05 | Click |
| 23 | 959016..959693 | PHAGE_Bacill_BCD7: hypothetical protein; Dde_0933; phage(gi422936045) | 4e-11 | Click |
| 24 | 959837..963472 | PHAGE_Haemop_HP2: orf27; Dde_0934; phage(gi17981843) | 3e-48 | Click |
| 25 | 963481..963792 | PHAGE_Cellul_phiST: hypothetical protein; Dde_0935; phage(gi472339888) | 1e-12 | Click |
| 26 | 963796..964266 | hypothetical protein; Dde_0936 | N/A | Click |
| 27 | 964263..964553 | hypothetical protein; Dde_0937 | N/A | Click |
| 28 | 964577..964589 | attR TTCCGGTAAGTAA | N/A | Click |
| 29 | 964620..965903 | PHAGE_Entero_2: P2 gpD-like tail protein; Dde_0938; phage(gi169936019) | 1e-08 | Click |
| 30 | 965896..966270 | PHAGE_Pectob_PP1: peptidase M15A domain-containing protein; Dde_0939; phage(gi423262089) | 3e-20 | Click |
| 31 | 966267..966686 | PHAGE_Pseudo_Lu11: putative tail assembly protein; Dde_0940; phage(gi388684690) | 5e-12 | Click |
| 32 | 966679..967728 | hypothetical protein; Dde_0941 | N/A | Click |
| 33 | 967741..968115 | hypothetical protein; Dde_0942 | N/A | Click |
| 34 | 968112..968375 | PHAGE_Burkho_KL3: gp51; Dde_0943; phage(gi327198096) | 1e-07 | Click |
Region 2, total : 23 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1787761..1787840 | attL TGTAATAGCTGAATTTTTAGCAGGCTTATATCCCAAAGCACCGTCTGGTACACAGCGGTGGTACACAAGGGGTATAAGCC | N/A | Click |
| 2 | 1787842..1789692 | PROPHAGE_Escher_Sakai: putative integrase; Dde_1730; phage(gi15834496) | 6e-24 | Click |
| 3 | complement(1789768..1790265) | PHAGE_Salmon_ST64B: putative antirepressor; Dde_1731; phage(gi23505485) | 1e-13 | Click |
| 4 | complement(1790583..1790753) | hypothetical protein; Dde_1732 | N/A | Click |
| 5 | complement(1790889..1791041) | hypothetical protein; Dde_1733 | N/A | Click |
| 6 | complement(1791199..1791903) | PHAGE_Synech_Syn5: internal virion protein; Dde_1734; phage(gi148724486) | 1e-08 | Click |
| 7 | complement(1792651..1793217) | PHAGE_Sodali_phiSG1: resolvase; Dde_1735; phage(gi89886020) | 1e-33 | Click |
| 8 | complement(1793241..1793420) | hypothetical protein; Dde_1736 | N/A | Click |
| 9 | complement(1793629..1794168) | PHAGE_Bacter_8: conserved phage protein pRha; Dde_1737; phage(gi200003982) | 4e-31 | Click |
| 10 | complement(1794309..1794878) | small HspC2 heat shock protein; Dde_1738 | N/A | Click |
| 11 | complement(1795314..1796147) | PHAGE_Salmon_epsilon34: Ant; Dde_1739; phage(gi221328691) | 3e-10 | Click |
| 12 | 1796162..1796305 | hypothetical protein; Dde_1740 | N/A | Click |
| 13 | complement(1796359..1796913) | PHAGE_Bacter_8: putative antirepressor; Dde_1741; phage(gi200003978) | 6e-15 | Click |
| 14 | complement(1797091..1800063) | PHAGE_Entero_P1: Res; Dde_1742; phage(gi46401632) | 1e-69 | Click |
| 15 | complement(1800075..1801412) | PHAGE_Campyl_NCTC12673: possible methylase; Dde_1743; phage(gi332672404) | 5e-18 | Click |
| 16 | complement(1801446..1802285) | PROPHAGE_Escher_CFT073: transposase insF; Dde_1744; phage(gi26249410) | 7e-54 | Click |
| 17 | complement(1802324..1802629) | PROPHAGE_Xantho_33913: ISxac3 transposase; Dde_1745; phage(gi21231087) | 9e-10 | Click |
| 18 | complement(1802691..1803212) | PHAGE_Campyl_NCTC12673: possible methylase; Dde_1746; phage(gi332672404) | 2e-10 | Click |
| 19 | complement(1803224..1803997) | hypothetical protein; Dde_1747 | N/A | Click |
| 20 | complement(1803994..1807197) | PHAGE_Rhodot_RM378: similar to DNA helicase; Dde_1748; phage(gi30044094) | 2e-11 | Click |
| 21 | complement(1807285..1807464) | hypothetical protein; Dde_1749 | N/A | Click |
| 22 | complement(1807661..1807834) | hypothetical protein; Dde_1750 | N/A | Click |
| 23 | 1807731..1807810 | attR TGTAATAGCTGAATTTTTAGCAGGCTTATATCCCAAAGCACCGTCTGGTACACAGCGGTGGTACACAAGGGGTATAAGCC | N/A | Click |
| 24 | 1807858..1808118 | hypothetical protein; Dde_1751 | N/A | Click |
| 25 | 1808192..1810885 | PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_1752; phage(gi56692778) | 1e-12 | Click |
Region 3, total : 40 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2766973..2766985 | attL TTGTGCCGCACAA | N/A | Click |
| 2 | 2776921..2778855 | PHAGE_Bacill_WBeta: putative site-specific recombinase; Dde_2774; phage(gi85701406) | 3e-18 | Click |
| 3 | 2778862..2778996 | hypothetical protein; Dde_2775 | N/A | Click |
| 4 | 2779050..2779382 | ArsR family transcriptional regulator; Dde_2776 | N/A | Click |
| 5 | 2779428..2780519 | permease-like protein; Dde_2777 | N/A | Click |
| 6 | 2780537..2780767 | redox-active disulfide protein 2; Dde_2778 | N/A | Click |
| 7 | complement(2780902..2781072) | hypothetical protein; Dde_2779 | N/A | Click |
| 8 | 2781079..2781174 | hypothetical protein; Dde_2780 | N/A | Click |
| 9 | 2781342..2781605 | PHAGE_Bacill_SPBc2: thioredoxin; Dde_2781; phage(gi9630289) | 7e-05 | Click |
| 10 | 2781609..2782316 | hypothetical protein; Dde_2782 | N/A | Click |
| 11 | 2782421..2782702 | hypothetical protein; Dde_2783 | N/A | Click |
| 12 | 2782868..2782972 | hypothetical protein; Dde_2784 | N/A | Click |
| 13 | 2782954..2783247 | hypothetical protein; Dde_2785 | N/A | Click |
| 14 | 2783316..2783690 | rhodanese-like protein; Dde_2786 | N/A | Click |
| 15 | 2783756..2784535 | hypothetical protein; Dde_2787 | N/A | Click |
| 16 | 2784550..2784645 | hypothetical protein; Dde_2788 | N/A | Click |
| 17 | 2784897..2785034 | hypothetical protein; Dde_2789 | N/A | Click |
| 18 | 2785171..2785308 | hypothetical protein; Dde_2790 | N/A | Click |
| 19 | 2785456..2786544 | arsenical-resistance protein; Dde_2791 | N/A | Click |
| 20 | 2786618..2787058 | protein tyrosine phosphatase; Dde_2792 | N/A | Click |
| 21 | 2787055..2787489 | protein tyrosine phosphatase; Dde_2793 | N/A | Click |
| 22 | 2787500..2787667 | hypothetical protein; Dde_2794 | N/A | Click |
| 23 | 2787767..2788360 | PHAGE_Bacter_8: putative antirepressor; Dde_2795; phage(gi200003978) | 6e-15 | Click |
| 24 | 2788572..2789405 | PHAGE_Salmon_epsilon34: Ant; Dde_2796; phage(gi221328691) | 2e-08 | Click |
| 25 | complement(2789411..2789512) | hypothetical protein; Dde_2797 | N/A | Click |
| 26 | 2789842..2790411 | small HspC2 heat shock protein; Dde_2798 | N/A | Click |
| 27 | 2790555..2791169 | PHAGE_Bacter_8: conserved phage protein pRha; Dde_2799; phage(gi200003982) | 5e-31 | Click |
| 28 | complement(2791181..2792122) | PHAGE_Clostr_st: putative restriction endonuclase; Dde_2800; phage(gi80159877) | 9e-08 | Click |
| 29 | 2792494..2792673 | hypothetical protein; Dde_2802 | N/A | Click |
| 30 | 2792697..2793263 | PHAGE_Sodali_phiSG1: resolvase; Dde_2803; phage(gi89886020) | 2e-33 | Click |
| 31 | 2794012..2794716 | PHAGE_Synech_Syn5: internal virion protein; Dde_2804; phage(gi148724486) | 1e-08 | Click |
| 32 | 2795036..2795353 | PHAGE_Bacill_PM1: hypothetical protein; Dde_2805; phage(gi472438275) | 4e-13 | Click |
| 33 | 2795367..2795585 | PHAGE_Entero_mEp460: regulatory protein Rha; Dde_2806; phage(gi428782357) | 2e-13 | Click |
| 34 | 2795600..2796136 | PHAGE_Synech_S_SSM7: hypothetical protein; Dde_2807; phage(gi326783864) | 3e-12 | Click |
| 35 | complement(2796212..2796898) | PROPHAGE_Escher_Sakai: putative ATP-dependent protease; Dde_2808; phage(gi15833954) | 2e-31 | Click |
| 36 | 2796990..2797002 | attR TTGTGCCGCACAA | N/A | Click |
| 37 | complement(2797035..2797931) | hypothetical protein; Dde_2809 | N/A | Click |
| 38 | complement(2798052..2798222) | hypothetical protein; Dde_2810 | N/A | Click |
| 39 | complement(2798297..2798653) | hypothetical protein; Dde_2811 | N/A | Click |
| 40 | 2798669..2799034 | hypothetical protein; Dde_2812 | N/A | Click |
| 41 | complement(2799085..2799186) | hypothetical protein; Dde_2813 | N/A | Click |
| 42 | 2799295..2801463 | PHAGE_Singap_iridovirus: hypothetical protein ORF141R; Dde_2814; phage(gi56692778) | 5e-09 | Click |
Region 4, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3323331..3324095 | PROPHAGE_Xantho_33913: ISxcC1 transposase; Dde_3342; phage(gi21231060) | 9e-69 | Click |
| 2 | 3324143..3324343 | hypothetical protein; Dde_3343 | N/A | Click |
| 3 | complement(3324577..3325125) | hypothetical protein; Dde_3344 | N/A | Click |
| 4 | complement(3325260..3325745) | PHAGE_Rhodob_RcapMu: c-repressor; Dde_3345; phage(gi356870844) | 1e-07 | Click |
| 5 | 3325698..3325856 | hypothetical protein; Dde_3346 | N/A | Click |
| 6 | 3326015..3326464 | hypothetical protein; Dde_3347 | N/A | Click |
| 7 | 3326464..3326715 | hypothetical protein; Dde_3348 | N/A | Click |
| 8 | 3326712..3326906 | hypothetical protein; Dde_3349 | N/A | Click |
| 9 | 3326918..3329044 | PHAGE_Pseudo_MP22: transposase A; Dde_3350; phage(gi157834977) | 2e-27 | Click |
| 10 | 3329054..3329758 | PHAGE_Rhodob_RcapMu: transposition protein B; Dde_3351; phage(gi356870854) | 1e-12 | Click |
| 11 | 3329755..3330369 | hypothetical protein; Dde_3352 | N/A | Click |
| 12 | 3330362..3330565 | hypothetical protein; Dde_3353 | N/A | Click |
| 13 | 3330574..3331086 | PHAGE_Haemop_SuMu: host-nuclease inhibitor protein; Dde_3354; phage(gi418489043) | 1e-07 | Click |
| 14 | 3331096..3331368 | hypothetical protein; Dde_3355 | N/A | Click |
| 15 | 3331388..3331675 | PHAGE_Rhodob_RcapMu: DNA-binding protein HU; Dde_3356; phage(gi356870859) | 9e-13 | Click |
Region 5, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3333815..3334552) | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfB; Dde_3361; phage(gi24373866) | 1e-26 | Click |
| 2 | complement(3334690..3334977) | PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; Dde_3362; phage(gi17546153) | 4e-08 | Click |
| 3 | 3335001..3335693 | hypothetical protein; Dde_3363 | N/A | Click |
| 4 | complement(3335977..3336777) | PROPHAGE_Xantho_306: ISxcd1 transposase; Dde_3364; phage(gi21242257) | 1e-117 | Click |
| 5 | complement(3336798..3337064) | PROPHAGE_Xantho_306: ISxac2 transposase; Dde_3365; phage(gi21244663) | 7e-35 | Click |
| 6 | 3337063..3337428 | hypothetical protein; Dde_3366 | N/A | Click |
| 7 | 3337535..3338032 | PHAGE_Burkho_KS9: endolysin gp23; Dde_3367; phage(gi255033754) | 4e-19 | Click |
| 8 | 3338036..3338644 | hypothetical protein; Dde_3368 | N/A | Click |
| 9 | 3338644..3338970 | hypothetical protein; Dde_3369 | N/A | Click |
| 10 | 3338967..3339263 | PHAGE_Escher_D108: hypothetical protein; Dde_3370; phage(gi281199669) | 2e-12 | Click |
| 11 | 3339268..3339864 | PHAGE_Helico_2: hypothetical protein; Dde_3371; phage(gi370703038) | 4e-06 | Click |
| 12 | 3339877..3341349 | PHAGE_Burkho_BcepMu: gp28; Dde_3372; phage(gi48696938) | 3e-140 | Click |
| 13 | 3341360..3342931 | PHAGE_Burkho_BcepMu: gp29; Dde_3373; phage(gi48696939) | 3e-55 | Click |
| 14 | 3342921..3344201 | PHAGE_Burkho_BcepMu: gp30; Dde_3374; phage(gi48696940) | 4e-33 | Click |
| 15 | 3344357..3345250 | PHAGE_Burkho_BcepMu: gp32; Dde_3375; phage(gi48696942) | 3e-28 | Click |
Region 6, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3346188..3346200 | attL GGACCTCGACAAG | N/A | Click |
| 2 | 3351086..3353287 | PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; Dde_3386; phage(gi428782750) | 2e-66 | Click |
| 3 | 3353289..3353804 | hypothetical protein; Dde_3387 | N/A | Click |
| 4 | 3353804..3354637 | hypothetical protein; Dde_3388 | N/A | Click |
| 5 | 3354624..3355346 | PHAGE_Haemop_HP2: orf35; Dde_3389; phage(gi17981851) | 4e-08 | Click |
| 6 | 3355768..3356229 | PHAGE_Lactob_LP65: hypothetical protein LP65_gp132; Dde_3390; phage(gi56693180) | 2e-07 | Click |
| 7 | 3356201..3357364 | PHAGE_Haemop_HP2: orf29; Dde_3391; phage(gi17981845) | 4e-19 | Click |
| 8 | 3357364..3358011 | PHAGE_Ralsto_phiRSA1: phage tail protein gpI; Dde_3392; phage(gi145708096) | 2e-06 | Click |
| 9 | 3358022..3359581 | PROPHAGE_Salmon_Ty2: variable tail fiber protein; Dde_3393; phage(gi29143754) | 2e-17 | Click |
| 10 | 3359594..3360178 | PHAGE_Entero_SfV: tail fibre assembly protein; Dde_3394; phage(gi19549010) | 5e-07 | Click |
| 11 | 3360417..3360602 | PHAGE_Pseudo_B3: Com translational regulator; Dde_3395; phage(gi56692616) | 5e-08 | Click |
| 12 | 3360762..3361904 | PHAGE_Burkho_phiE255: gp29, conserved hypothetical protein; Dde_3396; phage(gi134288813) | 1e-134 | Click |
| 13 | 3361901..3362491 | PHAGE_Burkho_phiE255: gp30, formyl transferase, putative; Dde_3397; phage(gi134288807) | 1e-41 | Click |
| 14 | 3362598..3362610 | attR GGACCTCGACAAG | N/A | Click |
| 15 | 3362885..3364108 | PHAGE_Pseudo_vB_PaeS_PMG1: integrase; Dde_3398; phage(gi374531680) | 4e-16 | Click |
| 16 | 3364112..3365350 | hypothetical protein; Dde_3399 | N/A | Click |
| 17 | complement(3365660..3365857) | hypothetical protein; Dde_3400 | N/A | Click |
| 18 | 3365890..3366162 | hypothetical protein; Dde_3401 | N/A | Click |
| 19 | complement(3366244..3366408) | PROPHAGE_Escher_CFT073: transposase insF; Dde_3402; phage(gi26250329) | 2e-06 | Click |