Definition | Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome. |
---|---|
Accession | NC_007493 |
Length | 3,188,609 |
Legend
Hits against Virus and prophage DB | |
Hits against Bacterial DB or GenBank file |
Region 1, total : 26 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(220172..221230) | PHAGE_Clostr_phiCD27: putative phage DNA-binding protein; RSP_1622; phage(gi209901309) | 7e-15 | Click |
2 | complement(221252..221896) | hypothetical protein; RSP_1624 | N/A | Click |
3 | complement(222110..222592) | hypothetical protein; RSP_1625 | N/A | Click |
4 | complement(222605..223414) | PHAGE_Roseob_1: hypothetical protein RDJLphi1_gp61; RSP_1626; phage(gi331028115) | 7e-62 | Click |
5 | complement(223468..224274) | PHAGE_Burkho_phiE125: DNA adenine methylase; RSP_1627; phage(gi17975188) | 4e-51 | Click |
6 | 224676..225674 | sensor histidine protein kinase; RSP_1628 | N/A | Click |
7 | 225687..226076 | response regulator receiver domain-containing protein; RSP_1629 | N/A | Click |
8 | complement(226147..226464) | PHAGE_Rhodob_RcapNL: hypothetical protein; RSP_1630; phage(gi461474983) | 3e-26 | Click |
9 | complement(226598..226936) | hypothetical protein; RSP_1631 | N/A | Click |
10 | complement(226940..227257) | PHAGE_Pseudo_MP42: hypothetical protein; RSP_1632; phage(gi399528628) | 4e-05 | Click |
11 | complement(227264..228748) | PHAGE_Salini_CW02: putative tail fiber; RSP_1633; phage(gi423261944) | 3e-07 | Click |
12 | complement(228765..229655) | PHAGE_Salico_CGphi29: hypothetical protein; RSP_1635; phage(gi472340191) | 2e-22 | Click |
13 | complement(229655..234661) | PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; RSP_1636; phage(gi374531664) | 7e-61 | Click |
14 | complement(234724..234960) | hypothetical protein; RSP_1637 | N/A | Click |
15 | complement(235044..235418) | hypothetical protein; RSP_1638 | N/A | Click |
16 | complement(235421..235861) | PHAGE_Strept_phiSASD1: gp14; RSP_1639; phage(gi298103499) | 7e-08 | Click |
17 | complement(235871..236251) | PHAGE_Tetras_SI1: hypothetical protein; RSP_6012; phage(gi472342242) | 2e-05 | Click |
18 | complement(236255..236422) | hypothetical protein; RSP_6013 | N/A | Click |
19 | complement(236419..236892) | PHAGE_Tetras_SI1: hypothetical protein; RSP_1640; phage(gi472342243) | 5e-12 | Click |
20 | complement(236889..237221) | PHAGE_Rhodob_RcapNL: phage head-tail adapter protein; RSP_1641; phage(gi461474968) | 1e-05 | Click |
21 | complement(237218..237724) | hypothetical protein; RSP_1643 | N/A | Click |
22 | complement(237729..238019) | PHAGE_Ambyst_virus: unknown; RSP_1644; phage(gi45686081) | 7e-06 | Click |
23 | complement(238152..239486) | PHAGE_Rhodob_RcapNL: HK97 family major capsid protein; RSP_1645; phage(gi461474964) | 7e-50 | Click |
24 | 239740..240483 | transmembrane protein; RSP_1646 | N/A | Click |
25 | complement(240494..241453) | PHAGE_Rhodob_RcapNL: peptidase S49; RSP_1647; phage(gi461474963) | 9e-30 | Click |
26 | complement(241450..242718) | PHAGE_Xantho_CP1: putative head portal protein; RSP_1648; phage(gi431811001) | 2e-27 | Click |
Region 2, total : 38 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(645363..646172) | PHAGE_Roseob_1: hypothetical protein RDJLphi1_gp61; RSP_2050; phage(gi331028115) | 3e-61 | Click |
2 | complement(646227..647033) | PHAGE_Burkho_phiE125: DNA adenine methylase; RSP_2052; phage(gi17975188) | 2e-53 | Click |
3 | 647337..648242 | PHAGE_Azospi_Cd: hypothetical protein APCd_gp01; RSP_2053; phage(gi168495104) | 2e-13 | Click |
4 | complement(648313..648630) | PHAGE_Rhodob_RcapNL: hypothetical protein; RSP_2054; phage(gi461474983) | 3e-26 | Click |
5 | complement(648767..649084) | hypothetical protein; RSP_2055 | N/A | Click |
6 | complement(649109..649426) | PHAGE_Pseudo_MP42: hypothetical protein; RSP_2056; phage(gi399528628) | 3e-05 | Click |
7 | complement(649433..650917) | PHAGE_Pseudo_F10: hypothetical protein PPF10_gp025; RSP_2057; phage(gi148912790) | 9e-09 | Click |
8 | 650507..650519 | attL GGCGCCGCCGGTG | N/A | Click |
9 | complement(650933..651823) | PHAGE_Salico_CGphi29: hypothetical protein; RSP_2058; phage(gi472340191) | 5e-23 | Click |
10 | complement(651823..656844) | PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; RSP_2059; phage(gi374531664) | 2e-59 | Click |
11 | complement(656968..657153) | hypothetical protein; RSP_2061 | N/A | Click |
12 | complement(657288..657674) | hypothetical protein; RSP_2062 | N/A | Click |
13 | complement(657671..658114) | PHAGE_Strept_phiSASD1: gp14; RSP_2063; phage(gi298103499) | 9e-08 | Click |
14 | complement(658124..658504) | PHAGE_Tetras_SI1: hypothetical protein; RSP_2064; phage(gi472342242) | 1e-05 | Click |
15 | complement(658508..659065) | PHAGE_Burkho_phi1026b: gp9; RSP_2065; phage(gi38707899) | 1e-05 | Click |
16 | complement(659065..659397) | PHAGE_Tetras_SI1: hypothetical protein; RSP_2066; phage(gi472342244) | 4e-05 | Click |
17 | complement(659394..659735) | PHAGE_Burkho_phi1026b: gp7; RSP_6031; phage(gi38707897) | 2e-06 | Click |
18 | complement(659732..660166) | PHAGE_Parame_1: hypothetical protein; RSP_6032; phage(gi340025742) | 1e-09 | Click |
19 | complement(660237..661538) | PHAGE_Pseudo_vB_PaeS_PMG1: major capsid protein; RSP_2067; phage(gi374531651) | 1e-79 | Click |
20 | complement(661551..662390) | PHAGE_Entero_mEp235: head maturation protease; RSP_2068; phage(gi428781814) | 2e-73 | Click |
21 | complement(662387..663637) | PHAGE_Tetras_SI1: portal protein; RSP_2069; phage(gi472342257) | 2e-82 | Click |
22 | complement(663637..665346) | PHAGE_Burkho_Bcep176: gp79; RSP_2070; phage(gi77864705) | 3e-132 | Click |
23 | complement(665348..665824) | PHAGE_Rhodob_RcapNL: hypothetical protein; RSP_2071; phage(gi461474960) | 4e-18 | Click |
24 | complement(665867..666766) | PHAGE_Rhodob_RcapNL: HNH endonuclease; RSP_2072; phage(gi461474959) | 1e-32 | Click |
25 | complement(666873..667535) | hypothetical protein; RSP_6033 | N/A | Click |
26 | complement(667532..668104) | hypothetical protein; RSP_2073 | N/A | Click |
27 | complement(668308..668991) | PHAGE_Pseudo_phi297: putative DNA replication protein O; RSP_2074; phage(gi374531278) | 5e-11 | Click |
28 | complement(668998..669633) | PHAGE_Rhodob_RcapNL: hypothetical protein; RSP_6034; phage(gi461475017) | 2e-24 | Click |
29 | complement(669791..670129) | hypothetical protein; RSP_6035 | N/A | Click |
30 | 670405..670755 | putative transcriptional regulator; RSP_2075 | N/A | Click |
31 | complement(670762..671064) | hypothetical protein; RSP_2076 | N/A | Click |
32 | 671395..671727 | hypothetical protein; RSP_2077 | N/A | Click |
33 | 671724..672122 | PHAGE_Loktan_pCB2051_A: hypothetical protein; RSP_2078; phage(gi472341435) | 3e-22 | Click |
34 | 672245..674056 | PHAGE_Salmon_E1: phage-related DNA-binding protein; RSP_2079; phage(gi170676297) | 1e-06 | Click |
35 | 674082..674094 | attR GGCGCCGCCGGTG | N/A | Click |
36 | 674132..674362 | PHAGE_Rhodob_RcapNL: hypothetical protein; RSP_6036; phage(gi461474992) | 1e-18 | Click |
37 | 674362..675387 | PHAGE_Rhodob_RcapNL: phage integrase/recombinase; RSP_2080; phage(gi461474991) | 2e-72 | Click |
38 | complement(675421..675497) | tRNA | N/A | Click |
39 | complement(675541..676011) | GNAT family acetyltransferase; RSP_2081 | N/A | Click |
40 | complement(676328..676639) | putative NADH-ubiquinone oxidoreductase-related protein; RSP_2082 | N/A | Click |
41 | 676895..679078 | PHAGE_Acidia_9: putative helicase; RSP_2083; phage(gi171473669) | 1e-07 | Click |
Region 3, total : 13 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 967939..967952 | attL GCGCAAGGCCGCGC | N/A | Click |
2 | complement(976154..978163) | PHAGE_Entero_mEp213: tail length tape measure protein; RSP_2351; phage(gi428782602) | 3e-23 | Click |
3 | complement(978176..979708) | PHAGE_Burkho_KS9: terminase gp2; RSP_2352; phage(gi255033734) | 3e-52 | Click |
4 | complement(979786..980181) | PHAGE_Burkho_phiE125: putative terminase (small subunit); RSP_2353; phage(gi17975162) | 6e-07 | Click |
5 | complement(980178..980492) | hypothetical protein; RSP_6046 | N/A | Click |
6 | complement(980495..980911) | hypothetical protein; RSP_6047 | N/A | Click |
7 | complement(980904..981326) | PHAGE_Rhizob_3: p011; RSP_2354; phage(gi195546542) | 5e-10 | Click |
8 | 981816..983288 | hypothetical protein; RSP_2356 | N/A | Click |
9 | complement(983273..983623) | PHAGE_Bacill_phi105: hypothetical protein phi105_50; RSP_2355; phage(gi22855043) | 1e-22 | Click |
10 | complement(983626..984222) | hypothetical protein; RSP_2357 | N/A | Click |
11 | complement(984222..985484) | PHAGE_Burkho_KS9: major capsid protein gp5; RSP_2358; phage(gi255033737) | 2e-19 | Click |
12 | complement(985754..986074) | hypothetical protein; RSP_2359 | N/A | Click |
13 | complement(986071..987264) | PHAGE_Klebsi_phiKO2: putative portal protein; RSP_2360; phage(gi46402090) | 5e-42 | Click |
14 | 987133..987146 | attR GCGCAAGGCCGCGC | N/A | Click |
15 | complement(987339..989156) | PROPHAGE_Escher_Sakai: putative integrase; RSP_2361; phage(gi15834496) | 2e-27 | Click |
Region 4, total : 19 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 1106883..1108127 | PHAGE_Strept_6: terminase large subunit; RSP_2467; phage(gi93007440) | 4e-64 | Click |
2 | 1108200..1109375 | PHAGE_Marino_P12026: phage portal protein, HK97 family; RSP_2468; phage(gi399528319) | 3e-19 | Click |
3 | 1109377..1109610 | hypothetical protein; RSP_2469 | N/A | Click |
4 | 1109615..1110178 | PHAGE_Tetras_SI1: phage prohead protease; RSP_2470; phage(gi472342256) | 3e-26 | Click |
5 | 1110244..1111440 | PHAGE_Salmon_ST64B: Major capsid protein precursor; RSP_2471; phage(gi23505451) | 1e-67 | Click |
6 | 1111535..1112134 | PHAGE_Rhizob_3: p008; RSP_2472; phage(gi195546539) | 6e-05 | Click |
7 | 1112134..1112469 | putative phage tail-head adaptor; RSP_6053 | N/A | Click |
8 | 1112466..1112864 | hypothetical protein; RSP_6054 | N/A | Click |
9 | 1112902..1113315 | PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; RSP_2473; phage(gi461474972) | 9e-20 | Click |
10 | 1113315..1113833 | hypothetical protein; RSP_2474 | N/A | Click |
11 | 1113856..1114476 | PHAGE_Vibrio_vB_VpaS_MAR10: tail tape measure protein; RSP_2475; phage(gi428782128) | 1e-13 | Click |
12 | 1114486..1115118 | PHAGE_Roseob_1: putative glycoside hydrolase; RSP_2476; phage(gi331028135) | 7e-45 | Click |
13 | 1115118..1116002 | PHAGE_Tetras_SI1: hypothetical protein; RSP_2477; phage(gi472342235) | 7e-29 | Click |
14 | 1115999..1116439 | PHAGE_Rhodob_RcapMu: putative tail assembly protein; RSP_2478; phage(gi356870891) | 2e-05 | Click |
15 | 1116439..1120329 | PHAGE_Tetras_SI1: hypothetical protein; RSP_2479; phage(gi472342233) | 7e-33 | Click |
16 | 1120333..1120746 | hypothetical protein; RSP_2480 | N/A | Click |
17 | 1120739..1121545 | serine O-acetyltransferase; RSP_2481 | N/A | Click |
18 | complement(1121645..1122973) | PHAGE_Equid__4: large tegument protein; RSP_4050; phage(gi9629749) | 1e-07 | Click |
19 | complement(1122984..1124375) | PHAGE_Synech_S_SM2: transketolase central region-containing protein; RSP_4049; phage(gi326781943) | 1e-10 | Click |
Region 5, total : 18 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(1685926..1688079) | PHAGE_Pseudo_vB_PaeS_PMG1: tail tape measure protein; RSP_2994; phage(gi374531664) | 2e-25 | Click |
2 | 1688885..1688896 | attL CGATCCCTCAAC | N/A | Click |
3 | complement(1689113..1689598) | PHAGE_Xantho_Xp10: endonuclease of the HNH family with predicted DNA-binding module at C-terminus; RSP_6243; phage(gi32128470) | 2e-21 | Click |
4 | complement(1690255..1690626) | hypothetical protein; RSP_6244 | N/A | Click |
5 | complement(1690672..1691094) | PHAGE_Tetras_SI1: hypothetical protein; RSP_6245; phage(gi472342243) | 9e-07 | Click |
6 | complement(1691095..1691412) | PHAGE_Geobac_E2: putative head-tail adaptor; RSP_6246; phage(gi148747735) | 5e-05 | Click |
7 | complement(1691414..1691755) | PHAGE_Clostr_phi3626: Gp7 protein; RSP_6247; phage(gi20065970) | 4e-06 | Click |
8 | complement(1691779..1692888) | PHAGE_Azospi_Cd: Phage major capsid protein; RSP_2995; phage(gi168495136) | 4e-15 | Click |
9 | complement(1692961..1693485) | PHAGE_Tetras_SI1: phage prohead protease; RSP_2996; phage(gi472342256) | 2e-24 | Click |
10 | complement(1693482..1694708) | PHAGE_Azospi_Cd: portal protein; RSP_2997; phage(gi168495134) | 4e-33 | Click |
11 | complement(1694748..1696334) | PHAGE_Pseudo_PAJU2: putative terminase; RSP_2998; phage(gi209552421) | 1e-137 | Click |
12 | complement(1696321..1696761) | PHAGE_Pseudo_PAJU2: hypothetical protein PAJU2_gp01; RSP_2999; phage(gi209552420) | 4e-11 | Click |
13 | complement(1697025..1697336) | hypothetical protein; RSP_3000 | N/A | Click |
14 | complement(1697390..1697896) | PHAGE_Xantho_Xp10: endonuclease of the HNH family; RSP_3001; phage(gi32128429) | 2e-17 | Click |
15 | complement(1697978..1698358) | PHAGE_Burkho_phiE125: putative class I holin; RSP_6248; phage(gi17975232) | 8e-09 | Click |
16 | complement(1698327..1698719) | hypothetical protein; RSP_6249 | N/A | Click |
17 | complement(1699690..1700622) | hypothetical protein; RSP_6250 | N/A | Click |
18 | complement(1704125..1704520) | histone-like nucleoid-structuring protein H-NS; RSP_0002 | N/A | Click |
19 | 1704599..1704610 | attR CGATCCCTCAAC | N/A | Click |
20 | complement(1704748..1706277) | PHAGE_Bacill_WBeta: putative site-specific recombinase; RSP_0003; phage(gi85701406) | 1e-12 | Click |
Region 6, total : 12 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 1920691..1920742 | attL TTGACTGTTAATCAATTGGTCGTAGGTTCGATCCCTACCGCCGGAGCCAAAA | N/A | Click |
2 | complement(1921201..1921707) | PHAGE_Mycoba_Che9d: gp68; RSP_0206; phage(gi29566475) | 2e-05 | Click |
3 | complement(1921743..1922249) | hypothetical protein; RSP_0207 | N/A | Click |
4 | complement(1922251..1923312) | hypothetical protein; RSP_0208 | N/A | Click |
5 | complement(1923314..1923868) | PHAGE_Bacill_1: Putative prohead peptidase; RSP_0209; phage(gi158348421) | 2e-09 | Click |
6 | complement(1923868..1925028) | PHAGE_Synech_S_CBS3: major capsid protein; RSP_0211; phage(gi331028011) | 1e-15 | Click |
7 | complement(1925115..1925456) | PHAGE_Bacill_1: HNH endonuclease; RSP_0212; phage(gi155042931) | 3e-07 | Click |
8 | complement(1925447..1927102) | PHAGE_Cronob_ENT39118: terminase large subunit; RSP_0213; phage(gi431811047) | 6e-33 | Click |
9 | complement(1927099..1927404) | phage protein; RSP_0214 | N/A | Click |
10 | complement(1927567..1928904) | PHAGE_Mycoba_Pipefish: gp57; RSP_0215; phage(gi109521897) | 3e-08 | Click |
11 | complement(1929125..1929337) | hypothetical protein; RSP_0216 | N/A | Click |
12 | complement(1929613..1930242) | hypothetical protein; RSP_6102 | N/A | Click |
13 | complement(1930262..1931503) | PHAGE_Salmon_vB_SosS_Oslo: integrase; RSP_0217; phage(gi399528791) | 1e-25 | Click |
14 | 1931668..1931719 | attR TTGACTGTTAATCAATTGGTCGTAGGTTCGATCCCTACCGCCGGAGCCAAAA | N/A | Click |