| Definition | Salmonella enterica subsp. enterica serovar Typhi str. Ty2 chromosome, complete genome. |
|---|---|
| Accession | NC_004631 |
| Length | 4,791,961 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 47 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1408218..1408790) | PHAGE_Entero_2: DNA-invertase; t1346; phage(gi169936026) | 4e-82 | Click |
| 2 | 1409849..1410466 | PHAGE_Entero_HK106: tail fiber assembly protein; t1349; phage(gi428783304) | 1e-67 | Click |
| 3 | complement(1410960..1411985) | PROPHAGE_Salmon_Ty2: variable tail fiber protein; t1351; phage(gi29143754) | 3e-67 | Click |
| 4 | complement(1411988..1412566) | PHAGE_Burkho_BcepMu: gp51; t1352; phage(gi48696961) | 2e-62 | Click |
| 5 | complement(1412559..1413662) | PHAGE_Burkho_BcepMu: gp50; t1353; phage(gi48696960) | 2e-110 | Click |
| 6 | complement(1413653..1414000) | PHAGE_Burkho_BcepMu: gp49; t1354; phage(gi48696959) | 6e-34 | Click |
| 7 | complement(1414057..1414584) | PHAGE_Burkho_BcepMu: gp48; t1355; phage(gi48696958) | 3e-31 | Click |
| 8 | complement(1414581..1415735) | PHAGE_Burkho_BcepMu: gp47; t1356; phage(gi48696957) | 2e-89 | Click |
| 9 | complement(1415723..1415938) | PHAGE_Burkho_BcepMu: gp46; t1357; phage(gi48696956) | 1e-19 | Click |
| 10 | complement(1415935..1416819) | PHAGE_Burkho_BcepMu: gp45; t1358; phage(gi48696955) | 2e-76 | Click |
| 11 | complement(1416819..1419284) | PHAGE_Burkho_BcepMu: gp44; t1359; phage(gi48696954) | 1e-180 | Click |
| 12 | complement(1419460..1419795) | PHAGE_Burkho_BcepMu: gp41; t1360; phage(gi48696951) | 2e-05 | Click |
| 13 | complement(1419893..1420174) | PHAGE_Escher_HK75: hypothetical protein; t1361; phage(gi356870704) | 6e-15 | Click |
| 14 | complement(1420177..1420698) | PHAGE_Burkho_BcepMu: gp40; t1362; phage(gi48696950) | 3e-68 | Click |
| 15 | complement(1420698..1422125) | PHAGE_Burkho_BcepMu: gp39; t1363; phage(gi48696949) | 0.0 | Click |
| 16 | complement(1422115..1422369) | PHAGE_Burkho_BcepMu: gp38; t1364; phage(gi48696948) | 4e-09 | Click |
| 17 | complement(1422366..1422830) | PHAGE_Burkho_BcepMu: gp37; t1365; phage(gi48696947) | 6e-40 | Click |
| 18 | complement(1422830..1423276) | PHAGE_Burkho_BcepMu: gp36; t1366; phage(gi48696946) | 4e-36 | Click |
| 19 | complement(1423278..1423616) | PHAGE_Burkho_BcepMu: gp35; t1367; phage(gi48696945) | 3e-22 | Click |
| 20 | complement(1423626..1424579) | PHAGE_Burkho_BcepMu: gp34; t1368; phage(gi48696944) | 6e-68 | Click |
| 21 | complement(1424594..1425709) | PHAGE_Burkho_BcepMu: gp32; t1369; phage(gi48696942) | 4e-98 | Click |
| 22 | complement(1425924..1426382) | PHAGE_Burkho_BcepMu: gp31; t1370; phage(gi48696941) | 7e-33 | Click |
| 23 | complement(1426385..1427206) | PHAGE_Burkho_BcepMu: gp30; t1371; phage(gi48696940) | 1e-98 | Click |
| 24 | complement(1427187..1428683) | PHAGE_Burkho_BcepMu: gp29; t1372; phage(gi48696939) | 1e-167 | Click |
| 25 | complement(1428683..1430278) | PHAGE_Burkho_BcepMu: gp28; t1373; phage(gi48696938) | 0.0 | Click |
| 26 | complement(1430275..1430820) | PHAGE_Burkho_BcepMu: gp27; t1374; phage(gi48696937) | 3e-64 | Click |
| 27 | complement(1430820..1431131) | PHAGE_Burkho_BcepMu: gp26; t1375; phage(gi48696936) | 9e-30 | Click |
| 28 | complement(1431131..1431457) | PHAGE_Burkho_BcepMu: gp25; t1376; phage(gi48696935) | 8e-22 | Click |
| 29 | complement(1431454..1432104) | PHAGE_Burkho_BcepMu: gp23; t1377; phage(gi48696933) | 8e-09 | Click |
| 30 | complement(1432088..1432816) | PHAGE_Burkho_BcepMu: gp22; t1379; phage(gi48696932) | 5e-60 | Click |
| 31 | complement(1432819..1433169) | PHAGE_Burkho_BcepMu: gp21; t1380; phage(gi48696931) | 3e-26 | Click |
| 32 | complement(1433413..1433943) | hypothetical protein; t1381 | N/A | Click |
| 33 | 1434005..1434436 | PHAGE_Burkho_BcepMu: gp10; t1382; phage(gi48696920) | 4e-26 | Click |
| 34 | 1434446..1434610 | hypothetical protein; t1383 | N/A | Click |
| 35 | 1434614..1436383 | PHAGE_Burkho_BcepMu: gp09; t1384; phage(gi48696919) | 0.0 | Click |
| 36 | 1437563..1437832 | hypothetical protein; t1386 | N/A | Click |
| 37 | 1437860..1438390 | PHAGE_Pseudo_MP42: host nuclease inhibitor protein; t1387; phage(gi399528592) | 4e-60 | Click |
| 38 | 1438488..1438682 | hypothetical protein; t1388 | N/A | Click |
| 39 | 1438679..1438951 | hypothetical protein; t1389 | N/A | Click |
| 40 | 1438961..1439263 | hypothetical protein; t1390 | N/A | Click |
| 41 | 1439260..1439643 | PHAGE_Entero_mEp460: hypothetical protein; t1391; phage(gi428782345) | 1e-29 | Click |
| 42 | 1439636..1439851 | hypothetical protein; t1392 | N/A | Click |
| 43 | 1439848..1440531 | PHAGE_Pseudo_JBD24: hypothetical protein; t1393; phage(gi448245062) | 5e-28 | Click |
| 44 | 1440528..1440758 | hypothetical protein; t1394 | N/A | Click |
| 45 | 1440748..1440963 | hypothetical protein; t1395 | N/A | Click |
| 46 | 1440953..1441405 | PHAGE_Burkho_BcepMu: gp02; t1396; phage(gi48696912) | 5e-26 | Click |
| 47 | 1441377..1441766 | PHAGE_Burkho_BcepMu: gp01; t1397; phage(gi48696911) | 2e-33 | Click |
Region 2, total : 64 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1928058..1928336 | PHAGE_Entero_mEp390: DinI-like family protein; t1864; phage(gi428782688) | 6e-26 | Click |
| 2 | 1928649..1929350 | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; t1865; phage(gi209427795) | 1e-22 | Click |
| 3 | complement(1930272..1930790) | PROPHAGE_Escher_Sakai: putative tail fiber assembly protein; t1867; phage(gi15834244) | 6e-47 | Click |
| 4 | complement(1930805..1932316) | PHAGE_Salmon_ST64B: tail protein; t1868; phage(gi23505468) | 2e-50 | Click |
| 5 | complement(1932316..1932996) | PHAGE_Haemop_Aaphi23: hypothetical protein Aaphi23p49; t1869; phage(gi31544052) | 4e-13 | Click |
| 6 | complement(1932993..1934192) | PHAGE_Iodoba_phiPLPE: gp61 putative baseplate protein; t1870; phage(gi197085675) | 3e-40 | Click |
| 7 | 1933533..1933544 | attL AATATTAGCGAT | N/A | Click |
| 8 | complement(1934193..1934546) | PHAGE_Vibrio_CP_T1: hypothetical protein; t1871; phage(gi418489248) | 7e-13 | Click |
| 9 | complement(1934562..1934699) | bacteriophage protein; t1872 | N/A | Click |
| 10 | complement(1934787..1935542) | PHAGE_Aggreg_S1249: putative baseplate protein; t1873; phage(gi273809550) | 1e-33 | Click |
| 11 | complement(1935601..1936029) | PHAGE_Acinet_Bphi_B1251: hypothetical protein; t1874; phage(gi423262025) | 9e-05 | Click |
| 12 | complement(1936029..1936760) | bacteriophage protein; t1875 | N/A | Click |
| 13 | complement(1936955..1937290) | hypothetical protein; t1876 | N/A | Click |
| 14 | complement(1937287..1938318) | PHAGE_Psychr_pOW20_A: hypothetical protein; t1877; phage(gi472339843) | 3e-22 | Click |
| 15 | complement(1938321..1938623) | PHAGE_Psychr_pOW20_A: hypothetical protein; t1878; phage(gi472339842) | 3e-05 | Click |
| 16 | complement(1938627..1939277) | PHAGE_Aggreg_S1249: hypothetical protein; t1879; phage(gi273809554) | 3e-07 | Click |
| 17 | complement(1939277..1941229) | PHAGE_Aeromo_vB_AsaM_56: putative tail-fiber/lysozyme protein; t1880; phage(gi422937553) | 8e-13 | Click |
| 18 | complement(1941407..1941859) | bacteriophage protein; t1881 | N/A | Click |
| 19 | complement(1941863..1942303) | PHAGE_Pseudo_vB_PaeM_C2_10_Ab1: hypothetical protein; t1882; phage(gi431809991) | 1e-06 | Click |
| 20 | complement(1942315..1943460) | PHAGE_Aggreg_S1249: hypothetical protein; t1883; phage(gi273809558) | 2e-39 | Click |
| 21 | complement(1943464..1944012) | bacteriophage protein; t1884 | N/A | Click |
| 22 | complement(1944002..1944391) | bacteriophage protein; t1885 | N/A | Click |
| 23 | complement(1944378..1944932) | PHAGE_Psychr_pOW20_A: hypothetical protein; t1886; phage(gi472339833) | 2e-10 | Click |
| 24 | complement(1944929..1945336) | PHAGE_Pseudo_KPP12: putative structural protein; t1887; phage(gi431811107) | 1e-08 | Click |
| 25 | complement(1945302..1945670) | bacteriophage protein; t1888 | N/A | Click |
| 26 | complement(1945712..1946653) | PHAGE_Vibrio_CP_T1: putative major capsid protein; t1889; phage(gi418489228) | 1e-19 | Click |
| 27 | complement(1946665..1947162) | bacteriophage protein; t1890 | N/A | Click |
| 28 | complement(1947167..1948399) | PHAGE_Edward_MSW_3: putative head protein; t1891; phage(gi448261038) | 6e-19 | Click |
| 29 | complement(1948414..1948944) | PHAGE_Xantho_vB_XveM_DIBBI: head morphogenesis protein; t1892; phage(gi389060406) | 2e-15 | Click |
| 30 | complement(1949036..1950505) | PHAGE_Vibrio_CP_T1: putative portal protein; t1893; phage(gi418489212) | 4e-44 | Click |
| 31 | complement(1950505..1951908) | PHAGE_Psychr_pOW20_A: phage terminase large subunit; t1894; phage(gi472339822) | 3e-157 | Click |
| 32 | complement(1951874..1952626) | PHAGE_Escher_HK639: terminase small subunit; t1895; phage(gi356870601) | 1e-13 | Click |
| 33 | complement(1952716..1952976) | bacteriophage protein; t1896 | N/A | Click |
| 34 | complement(1953040..1953417) | PHAGE_Klebsi_phiKO2: Gp63; t1897; phage(gi46402149) | 7e-45 | Click |
| 35 | complement(1953460..1953999) | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; t1898; phage(gi16765210) | 3e-81 | Click |
| 36 | complement(1953996..1954610) | PHAGE_Salmon_1: putative bacteriophage endolysin; t1899; phage(gi169257182) | 2e-112 | Click |
| 37 | complement(1954610..1954891) | PHAGE_Entero_mEp390: putative holin; t1900; phage(gi428782713) | 9e-40 | Click |
| 38 | complement(1954878..1955267) | PHAGE_Entero_mEp390: putative holin; t1901; phage(gi428782712) | 2e-45 | Click |
| 39 | 1955484..1955933 | PHAGE_Gifsy_2: hypothetical protein STM1025.Gifsy2; t1902; phage(gi169257293) | 2e-83 | Click |
| 40 | complement(1956069..1956194) | PHAGE_Gifsy_2: hypothetical protein STM1024.Gifsy2; t1903; phage(gi169257292) | 1e-17 | Click |
| 41 | complement(1956593..1957390) | PHAGE_Gifsy_2: prophage antitermination protein; late gene regulator; Lamba gpQ homolog; t1904; phage(gi169257290) | 6e-154 | Click |
| 42 | complement(1957523..1958134) | PHAGE_Gifsy_2: NinG; t1905; phage(gi169257288) | 8e-115 | Click |
| 43 | complement(1958343..1958945) | PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; t1906; phage(gi169257286) | 2e-110 | Click |
| 44 | complement(1958985..1959290) | PHAGE_Salmon_SPN3UB: hypothetical protein; t1907; phage(gi423262436) | 3e-42 | Click |
| 45 | complement(1959280..1959519) | PHAGE_Gifsy_2: bacteriophage damage-inducible protein DinI; t1908; phage(gi169257284) | 2e-38 | Click |
| 46 | complement(1959704..1960201) | PHAGE_Entero_P1: Doc; t1909; phage(gi46401725) | 4e-05 | Click |
| 47 | complement(1960212..1960499) | bacteriophage protein; t1910 | N/A | Click |
| 48 | complement(1960634..1960795) | bacteriophage protein; t1911 | N/A | Click |
| 49 | complement(1960877..1961143) | PHAGE_Salmon_SPN3UB: hypothetical protein; t1912; phage(gi423262434) | 6e-47 | Click |
| 50 | complement(1961813..1962286) | PHAGE_Pectob_ZF40: putative methylase; t1914; phage(gi422936660) | 5e-68 | Click |
| 51 | complement(1962286..1962810) | PHAGE_Gifsy_2: conserved hypothetical bacteriophage protein; t1915; phage(gi169257282) | 1e-33 | Click |
| 52 | complement(1962807..1963154) | PHAGE_Gifsy_2: hypothetical protein STM1016.Gifsy2; t1916; phage(gi169257281) | 2e-59 | Click |
| 53 | complement(1963165..1963914) | PHAGE_Gifsy_2: bacteriophage DNA replication protein; t1917; phage(gi169257280) | 1e-141 | Click |
| 54 | complement(1963917..1964900) | PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; t1918; phage(gi169257279) | 0.0 | Click |
| 55 | complement(1964985..1965359) | PHAGE_Gifsy_2: bacteriophage transcriptional activator; Lambda gpCII analog; t1919; phage(gi169257278) | 1e-54 | Click |
| 56 | 1965691..1966095 | PHAGE_Gifsy_2: putative bacteriophage regulatory protein; repressor; Lambda gpCI analog; t1920; phage(gi169257276) | 5e-15 | Click |
| 57 | 1966384..1966584 | PHAGE_Escher_P13374: host killing protein; t1921; phage(gi410491620) | 4e-11 | Click |
| 58 | 1966675..1966971 | PHAGE_Stx2_c_86: host-nuclease inhibitor protein Gam; t1922; phage(gi116222045) | 8e-38 | Click |
| 59 | 1966977..1967762 | PHAGE_Entero_HK630: Bet protein; t1923; phage(gi428782823) | 1e-144 | Click |
| 60 | 1967759..1968439 | PHAGE_Stx2_c_1717: exonuclease; t1924; phage(gi209447136) | 7e-115 | Click |
| 61 | 1968517..1969581 | PHAGE_Salmon_SPN1S: putative bacteriophage protein; t1925; phage(gi374531224) | 1e-141 | Click |
| 62 | 1969578..1970459 | PHAGE_Entero_P1: Dmt; t1926; phage(gi46401691) | 3e-73 | Click |
| 63 | 1970459..1970704 | PHAGE_Gifsy_2: hypothetical protein STM1007.Gifsy2; t1927; phage(gi169257270) | 5e-39 | Click |
| 64 | 1970704..1970715 | attR AATATTAGCGAT | N/A | Click |
| 65 | 1970745..1970993 | PHAGE_Gifsy_2: bacteriophage excisionase; t1928; phage(gi169257269) | 1e-43 | Click |
| 66 | 1970990..1972330 | PHAGE_Gifsy_2: bacteriophage integrase; t1929; phage(gi169257268) | 0.0 | Click |
Region 3, total : 9 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2036445..2036458 | attL TGAGCTGGCGGAAA | N/A | Click |
| 2 | 2043456..2043833 | PROPHAGE_Escher_CFT073: P4 family integrase; t1986; phage(gi26248244) | 2e-48 | Click |
| 3 | 2043995..2044192 | hypothetical protein; t1987 | N/A | Click |
| 4 | complement(2044404..2046680) | PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; t1988; phage(gi15800640) | 0.0 | Click |
| 5 | complement(2046711..2047031) | PHAGE_Cronob_vB_CsaM_GAP32: ATP-dependent Clp protease; t1989; phage(gi414087232) | 3e-05 | Click |
| 6 | 2047355..2047576 | PHAGE_Lactoc_bIL312: Csp; t1990; phage(gi13095918) | 5e-14 | Click |
| 7 | complement(2047706..2049652) | PHAGE_Plankt_PaV_LD: ABC transporter; t1991; phage(gi371496158) | 5e-41 | Click |
| 8 | complement(2049649..2050767) | PHAGE_Cronob_ENT47670: putative tail protein; t1992; phage(gi431810494) | 7e-05 | Click |
| 9 | 2050913..2051863 | virK protein; t1993 | N/A | Click |
| 10 | complement(2051860..2053518) | PHAGE_Entero_P2: Old; t1994; phage(gi9630369) | 5e-06 | Click |
| 11 | 2065436..2065449 | attR TGAGCTGGCGGAAA | N/A | Click |
Region 4, total : 14 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2734604..2734615 | attL GCTTAATAACCT | N/A | Click |
| 2 | 2735202..2736233 | PROPHAGE_Escher_MG1655: CP4-57 prophage; integrase; t2647; phage(gi16130540) | 2e-117 | Click |
| 3 | complement(2738152..2738724) | PHAGE_Entero_P4: amber mutation-suppressing protein; t2648; phage(gi9627520) | 1e-102 | Click |
| 4 | complement(2738798..2738965) | PHAGE_Entero_P4: transactivation protein; t2649; phage(gi9627519) | 1e-24 | Click |
| 5 | complement(2739295..2740029) | PHAGE_Entero_P4: head size determination protein sid; t2650; phage(gi9627518) | 5e-133 | Click |
| 6 | 2740629..2740847 | PHAGE_Entero_P4: transcriptional regulator; t2651; phage(gi9627517) | 4e-37 | Click |
| 7 | 2741030..2741434 | PHAGE_Entero_P4: putative CI repressor; t2652; phage(gi9627516) | 4e-56 | Click |
| 8 | 2741427..2741714 | PHAGE_Entero_P4: helper derepression protein; t2653; phage(gi9627515) | 4e-50 | Click |
| 9 | 2741707..2742162 | PHAGE_Entero_P4: hypothetical protein P4p08; t2654; phage(gi9627514) | 4e-89 | Click |
| 10 | 2742298..2742618 | PHAGE_Entero_P4: hypothetical protein P4p07; t2655; phage(gi9627513) | 6e-57 | Click |
| 11 | 2742633..2744966 | PHAGE_Entero_P4: DNA primase; t2656; phage(gi9627512) | 0.0 | Click |
| 12 | complement(2745590..2746363) | reverse transcriptase; t2657 | N/A | Click |
| 13 | complement(2746332..2746520) | hypothetical protein; t2658 | N/A | Click |
| 14 | complement(2746767..2746985) | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); t2659; phage(gi169936018) | 4e-21 | Click |
| 15 | complement(2747076..2748176) | PHAGE_Entero_2: P2 gpD-like tail protein; t2660; phage(gi169936019) | 0.0 | Click |
| 16 | 2759926..2759937 | attR GCTTAATAACCT | N/A | Click |
Region 5, total : 47 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3489900..3489911 | attL TATCTCCCGGTT | N/A | Click |
| 2 | complement(3498618..3500264) | PHAGE_Ostreo_2: putative acetolactate synthase large subunit; t3397; phage(gi314055125) | 3e-65 | Click |
| 3 | complement(3500404..3500502) | ilvG operon leader peptide; t3398 | N/A | Click |
| 4 | complement(3501128..3502180) | PHAGE_Entero_2: P2 Int-like protein; t3400; phage(gi169936064) | 1e-100 | Click |
| 5 | complement(3502344..3502496) | hypothetical protein; t3401 | N/A | Click |
| 6 | complement(3502576..3503145) | PHAGE_Entero_2: P2 CI-like protein; t3402; phage(gi169936063) | 3e-35 | Click |
| 7 | 3503271..3503492 | PHAGE_Pasteu_F108: Cox; t3403; phage(gi109302900) | 2e-05 | Click |
| 8 | 3503525..3504034 | PHAGE_Entero_2: bacteriophage regulatory protein CII; t3404; phage(gi169936061) | 1e-83 | Click |
| 9 | 3504209..3504433 | hypothetical protein; t3405 | N/A | Click |
| 10 | 3504456..3504797 | PHAGE_Entero_2: hypothetical protein STM2733.Fels2; t3406; phage(gi169936058) | 1e-51 | Click |
| 11 | 3504865..3505098 | PHAGE_Entero_2: hypothetical protein STM2732.Fels2; t3407; phage(gi169936057) | 1e-26 | Click |
| 12 | 3505098..3505325 | PHAGE_Entero_2: P2 gpOrf82-like protein; t3408; phage(gi169936056) | 5e-35 | Click |
| 13 | 3505322..3506179 | PHAGE_Entero_2: DNA adenine methylase-like protein; t3409; phage(gi169936055) | 9e-119 | Click |
| 14 | 3506176..3508590 | PHAGE_Entero_2: P2 gpA-like protein; t3410; phage(gi169936054) | 0.0 | Click |
| 15 | 3508744..3508932 | PHAGE_Entero_2: hypothetical protein STM2728.Fels2; t3411; phage(gi169936053) | 6e-28 | Click |
| 16 | complement(3509000..3509299) | lipoprotein; t3412 | N/A | Click |
| 17 | complement(3509408..3510214) | lipoprotein; t3413 | N/A | Click |
| 18 | 3510900..3511814 | hypothetical protein; t3414 | N/A | Click |
| 19 | 3511811..3512551 | hypothetical protein; t3415 | N/A | Click |
| 20 | complement(3512586..3513623) | PHAGE_Entero_2: P2 gpQ-like protein; t3416; phage(gi169936049) | 4e-173 | Click |
| 21 | complement(3513623..3515389) | PHAGE_Entero_2: P2 gpP-like protein; t3417; phage(gi169936048) | 0.0 | Click |
| 22 | 3515532..3516365 | PHAGE_Entero_2: P2 gpO-like protein; t3418; phage(gi169936047) | 2e-129 | Click |
| 23 | 3516382..3517440 | PHAGE_Entero_2: P2 gpN-like major capsid protein; t3419; phage(gi169936046) | 6e-178 | Click |
| 24 | 3517444..3518094 | PHAGE_Entero_2: P2 gpM-like protein; t3420; phage(gi169936045) | 4e-113 | Click |
| 25 | 3518127..3518654 | PHAGE_Entero_2: P2 gpL-like protein; t3421; phage(gi169936044) | 1e-78 | Click |
| 26 | 3518654..3518857 | PHAGE_Entero_2: P2 gpX-like tail protein; t3422; phage(gi169936043) | 1e-32 | Click |
| 27 | 3518861..3519076 | PHAGE_Entero_2: lysis protein; t3423; phage(gi169936042) | 6e-29 | Click |
| 28 | 3519096..3519569 | PHAGE_Entero_2: endolysin; t3424; phage(gi169936041) | 7e-81 | Click |
| 29 | 3519571..3519948 | hypothetical protein; t3425 | N/A | Click |
| 30 | 3519945..3520373 | PHAGE_Entero_2: P2 LysB-like protein; t3426; phage(gi169936038) | 2e-55 | Click |
| 31 | 3520469..3520900 | PHAGE_Entero_2: P2 gpR-like tail completion protein; t3427; phage(gi169936036) | 2e-72 | Click |
| 32 | 3520893..3521339 | PHAGE_Entero_2: P2 gpS-like tail completion protein; t3428; phage(gi169936035) | 2e-72 | Click |
| 33 | 3521408..3521986 | PHAGE_Entero_2: P2 gpV-like protein; t3429; phage(gi169936034) | 4e-96 | Click |
| 34 | 3521983..3522342 | PHAGE_Entero_2: P2 gpW-like baseplate protein; t3430; phage(gi169936033) | 4e-51 | Click |
| 35 | 3522329..3523237 | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; t3431; phage(gi169936032) | 3e-147 | Click |
| 36 | 3523230..3523835 | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; t3432; phage(gi169936031) | 3e-110 | Click |
| 37 | 3523832..3525346 | PHAGE_Entero_2: P2 gpH-like protein; t3433; phage(gi169936030) | 4e-122 | Click |
| 38 | 3525346..3525939 | PHAGE_Entero_HK106: tail fiber assembly protein; t3434; phage(gi428783304) | 1e-62 | Click |
| 39 | complement(3525911..3526351) | PHAGE_Entero_mEp213: tail fiber assembly protein; t3435; phage(gi428782612) | 1e-25 | Click |
| 40 | 3526780..3527346 | PHAGE_Entero_2: DNA-invertase; t3437; phage(gi169936026) | 9e-88 | Click |
| 41 | 3527489..3528661 | PHAGE_Entero_2: P2 gpFI-like protein; t3438; phage(gi169936025) | 0.0 | Click |
| 42 | 3528671..3529186 | PHAGE_Entero_2: P2 gpFII-like protein; t3439; phage(gi169936024) | 8e-92 | Click |
| 43 | 3529241..3529543 | PHAGE_Entero_2: P2 gpE-like tail protein; t3440; phage(gi169936023) | 2e-44 | Click |
| 44 | 3529558..3529677 | PHAGE_Entero_2: P2 gpE-like protein; t3441; phage(gi169936022) | 1e-14 | Click |
| 45 | 3529670..3532747 | PHAGE_Entero_2: P2 gpT-like tail protein; t3442; phage(gi169936021) | 0.0 | Click |
| 46 | 3532744..3533229 | PHAGE_Entero_2: P2 gpU-like tail protein; t3443; phage(gi169936020) | 3e-74 | Click |
| 47 | 3533226..3534326 | PHAGE_Entero_2: P2 gpD-like tail protein; t3444; phage(gi169936019) | 0.0 | Click |
| 48 | 3534417..3534635 | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); t3445; phage(gi169936018) | 2e-22 | Click |
| 49 | 3540712..3540723 | attR TATCTCCCGGTT | N/A | Click |
Region 6, total : 29 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3512586..3513623) | PHAGE_Entero_2: P2 gpQ-like protein; t3416; phage(gi169936049) | 4e-173 | Click |
| 2 | complement(3513623..3515389) | PHAGE_Entero_2: P2 gpP-like protein; t3417; phage(gi169936048) | 0.0 | Click |
| 3 | 3515532..3516365 | PHAGE_Entero_2: P2 gpO-like protein; t3418; phage(gi169936047) | 2e-129 | Click |
| 4 | 3516382..3517440 | PHAGE_Entero_2: P2 gpN-like major capsid protein; t3419; phage(gi169936046) | 6e-178 | Click |
| 5 | 3517444..3518094 | PHAGE_Entero_2: P2 gpM-like protein; t3420; phage(gi169936045) | 4e-113 | Click |
| 6 | 3518127..3518654 | PHAGE_Entero_2: P2 gpL-like protein; t3421; phage(gi169936044) | 1e-78 | Click |
| 7 | 3518654..3518857 | PHAGE_Entero_2: P2 gpX-like tail protein; t3422; phage(gi169936043) | 1e-32 | Click |
| 8 | 3518861..3519076 | PHAGE_Entero_2: lysis protein; t3423; phage(gi169936042) | 6e-29 | Click |
| 9 | 3519096..3519569 | PHAGE_Entero_2: endolysin; t3424; phage(gi169936041) | 7e-81 | Click |
| 10 | 3519571..3519948 | hypothetical protein; t3425 | N/A | Click |
| 11 | 3519945..3520373 | PHAGE_Entero_2: P2 LysB-like protein; t3426; phage(gi169936038) | 2e-55 | Click |
| 12 | 3520469..3520900 | PHAGE_Entero_2: P2 gpR-like tail completion protein; t3427; phage(gi169936036) | 2e-72 | Click |
| 13 | 3520893..3521339 | PHAGE_Entero_2: P2 gpS-like tail completion protein; t3428; phage(gi169936035) | 2e-72 | Click |
| 14 | 3521408..3521986 | PHAGE_Entero_2: P2 gpV-like protein; t3429; phage(gi169936034) | 4e-96 | Click |
| 15 | 3521983..3522342 | PHAGE_Entero_2: P2 gpW-like baseplate protein; t3430; phage(gi169936033) | 4e-51 | Click |
| 16 | 3522329..3523237 | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; t3431; phage(gi169936032) | 3e-147 | Click |
| 17 | 3523230..3523835 | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; t3432; phage(gi169936031) | 3e-110 | Click |
| 18 | 3523832..3525346 | PHAGE_Entero_2: P2 gpH-like protein; t3433; phage(gi169936030) | 4e-122 | Click |
| 19 | 3525346..3525939 | PHAGE_Entero_HK106: tail fiber assembly protein; t3434; phage(gi428783304) | 1e-62 | Click |
| 20 | complement(3525911..3526351) | PHAGE_Entero_mEp213: tail fiber assembly protein; t3435; phage(gi428782612) | 1e-25 | Click |
| 21 | 3526780..3527346 | PHAGE_Entero_2: DNA-invertase; t3437; phage(gi169936026) | 9e-88 | Click |
| 22 | 3527489..3528661 | PHAGE_Entero_2: P2 gpFI-like protein; t3438; phage(gi169936025) | 0.0 | Click |
| 23 | 3528671..3529186 | PHAGE_Entero_2: P2 gpFII-like protein; t3439; phage(gi169936024) | 8e-92 | Click |
| 24 | 3529241..3529543 | PHAGE_Entero_2: P2 gpE-like tail protein; t3440; phage(gi169936023) | 2e-44 | Click |
| 25 | 3529558..3529677 | PHAGE_Entero_2: P2 gpE-like protein; t3441; phage(gi169936022) | 1e-14 | Click |
| 26 | 3529670..3532747 | PHAGE_Entero_2: P2 gpT-like tail protein; t3442; phage(gi169936021) | 0.0 | Click |
| 27 | 3532744..3533229 | PHAGE_Entero_2: P2 gpU-like tail protein; t3443; phage(gi169936020) | 3e-74 | Click |
| 28 | 3533226..3534326 | PHAGE_Entero_2: P2 gpD-like tail protein; t3444; phage(gi169936019) | 0.0 | Click |
| 29 | 3534417..3534635 | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); t3445; phage(gi169936018) | 2e-22 | Click |
Region 7, total : 40 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4446847..4446860 | attL CTTTTTTCACCAGT | N/A | Click |
| 2 | 4446878..4447798 | PROPHAGE_Salmon_LT2: integrase; t4280; phage(gi16766072) | 7e-63 | Click |
| 3 | 4448315..4448824 | hypothetical protein; t4281 | N/A | Click |
| 4 | 4448920..4449300 | hypothetical protein; t4282 | N/A | Click |
| 5 | 4449766..4450350 | hypothetical protein; t4283 | N/A | Click |
| 6 | 4450347..4450643 | hypothetical protein; t4284 | N/A | Click |
| 7 | 4450721..4451179 | hypothetical protein; t4285 | N/A | Click |
| 8 | 4451268..4453217 | PHAGE_Caulob_phiCbK: putative ArdC-like antirestriction protein; t4286; phage(gi414087906) | 6e-26 | Click |
| 9 | 4453289..4454197 | hypothetical protein; t4287 | N/A | Click |
| 10 | 4454271..4455170 | hypothetical protein; t4288 | N/A | Click |
| 11 | 4455212..4455571 | hypothetical protein; t4289 | N/A | Click |
| 12 | complement(4455671..4455940) | hypothetical protein; t4290 | N/A | Click |
| 13 | complement(4456072..4457346) | PHAGE_Cronob_ENT39118: DNA polymerase; t4291; phage(gi431811050) | 6e-152 | Click |
| 14 | 4457565..4457942 | PHAGE_Burkho_KS14: gp9; t4293; phage(gi327198278) | 1e-05 | Click |
| 15 | complement(4458029..4458247) | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); t4294; phage(gi169936018) | 1e-28 | Click |
| 16 | complement(4458315..4459415) | PHAGE_Entero_2: P2 gpD-like tail protein; t4295; phage(gi169936019) | 0.0 | Click |
| 17 | complement(4459412..4459897) | PHAGE_Entero_2: P2 gpU-like tail protein; t4296; phage(gi169936020) | 1e-82 | Click |
| 18 | complement(4459897..4462677) | PHAGE_Entero_2: P2 gpT-like tail protein; t4297; phage(gi169936021) | 4e-117 | Click |
| 19 | complement(4462670..4462789) | PHAGE_Entero_2: P2 gpE-like protein; t4298; phage(gi169936022) | 8e-15 | Click |
| 20 | complement(4462804..4463106) | PHAGE_Entero_2: P2 gpE-like tail protein; t4299; phage(gi169936023) | 4e-46 | Click |
| 21 | complement(4463161..4463676) | PHAGE_Entero_2: P2 gpFII-like protein; t4300; phage(gi169936024) | 7e-94 | Click |
| 22 | complement(4463686..4464858) | PHAGE_Entero_2: P2 gpFI-like protein; t4301; phage(gi169936025) | 0.0 | Click |
| 23 | 4465393..4466115 | invasion-associated secreted protein; t4303 | N/A | Click |
| 24 | complement(4466313..4466720) | PHAGE_Entero_2: P2 gpG-like protein; t4304; phage(gi169936028) | 8e-66 | Click |
| 25 | complement(4466727..4468346) | PHAGE_Entero_2: P2 gpH-like protein; t4305; phage(gi169936030) | 2e-160 | Click |
| 26 | complement(4468343..4468948) | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; t4306; phage(gi169936031) | 3e-110 | Click |
| 27 | complement(4468941..4469849) | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; t4307; phage(gi169936032) | 4e-159 | Click |
| 28 | complement(4469836..4470195) | PHAGE_Entero_2: P2 gpW-like baseplate protein; t4308; phage(gi169936033) | 2e-58 | Click |
| 29 | complement(4470192..4470770) | PHAGE_Entero_2: P2 gpV-like protein; t4309; phage(gi169936034) | 3e-111 | Click |
| 30 | complement(4470839..4471285) | PHAGE_Entero_2: P2 gpS-like tail completion protein; t4310; phage(gi169936035) | 1e-77 | Click |
| 31 | complement(4471805..4472230) | PHAGE_Entero_2: P2 LysB-like protein; t4312; phage(gi169936038) | 6e-69 | Click |
| 32 | complement(4472230..4472607) | hypothetical protein; t4313 | N/A | Click |
| 33 | complement(4472612..4473082) | PHAGE_Entero_2: endolysin; t4314; phage(gi169936041) | 7e-87 | Click |
| 34 | complement(4473102..4473317) | PHAGE_Entero_2: lysis protein; t4315; phage(gi169936042) | 1e-34 | Click |
| 35 | complement(4473321..4473524) | PHAGE_Entero_2: P2 gpX-like tail protein; t4316; phage(gi169936043) | 9e-35 | Click |
| 36 | complement(4473524..4473988) | PHAGE_Entero_2: P2 gpL-like protein; t4317; phage(gi169936044) | 6e-86 | Click |
| 37 | complement(4474082..4474732) | PHAGE_Entero_2: P2 gpM-like protein; t4318; phage(gi169936045) | 8e-116 | Click |
| 38 | complement(4474736..4475800) | PHAGE_Entero_2: P2 gpN-like major capsid protein; t4319; phage(gi169936046) | 0.0 | Click |
| 39 | complement(4475817..4476650) | PHAGE_Entero_2: P2 gpO-like protein; t4320; phage(gi169936047) | 2e-145 | Click |
| 40 | 4476356..4476369 | attR CTTTTTTCACCAGT | N/A | Click |
| 41 | 4476793..4478559 | PHAGE_Entero_2: P2 gpP-like protein; t4322; phage(gi169936048) | 0.0 | Click |
| 42 | 4478556..4479602 | PHAGE_Entero_2: P2 gpQ-like protein; t4321; phage(gi169936049) | 6e-179 | Click |
Region 8, total : 58 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4446021..4446055 | attL GCCTTCGGGTGGTACAGCCCTTTAATCTTTGGAAA | N/A | Click |
| 2 | 4446878..4447798 | PROPHAGE_Salmon_LT2: integrase; t4280; phage(gi16766072) | 7e-63 | Click |
| 3 | 4448208..4448242 | attR GCCTTCGGGTGGTACAGCCCTTTAATCTTTGGAAA | N/A | Click |
| 4 | 4448315..4448824 | hypothetical protein; t4281 | N/A | Click |
| 5 | 4448920..4449300 | hypothetical protein; t4282 | N/A | Click |
| 6 | 4449766..4450350 | hypothetical protein; t4283 | N/A | Click |
| 7 | 4450347..4450643 | hypothetical protein; t4284 | N/A | Click |
| 8 | 4450721..4451179 | hypothetical protein; t4285 | N/A | Click |
| 9 | 4451268..4453217 | PHAGE_Caulob_phiCbK: putative ArdC-like antirestriction protein; t4286; phage(gi414087906) | 6e-26 | Click |
| 10 | 4453289..4454197 | hypothetical protein; t4287 | N/A | Click |
| 11 | 4454271..4455170 | hypothetical protein; t4288 | N/A | Click |
| 12 | 4455212..4455571 | hypothetical protein; t4289 | N/A | Click |
| 13 | complement(4455671..4455940) | hypothetical protein; t4290 | N/A | Click |
| 14 | complement(4456072..4457346) | PHAGE_Cronob_ENT39118: DNA polymerase; t4291; phage(gi431811050) | 6e-152 | Click |
| 15 | 4457565..4457942 | PHAGE_Burkho_KS14: gp9; t4293; phage(gi327198278) | 1e-05 | Click |
| 16 | complement(4458029..4458247) | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); t4294; phage(gi169936018) | 1e-28 | Click |
| 17 | complement(4458315..4459415) | PHAGE_Entero_2: P2 gpD-like tail protein; t4295; phage(gi169936019) | 0.0 | Click |
| 18 | complement(4459412..4459897) | PHAGE_Entero_2: P2 gpU-like tail protein; t4296; phage(gi169936020) | 1e-82 | Click |
| 19 | complement(4459897..4462677) | PHAGE_Entero_2: P2 gpT-like tail protein; t4297; phage(gi169936021) | 4e-117 | Click |
| 20 | complement(4462670..4462789) | PHAGE_Entero_2: P2 gpE-like protein; t4298; phage(gi169936022) | 8e-15 | Click |
| 21 | complement(4462804..4463106) | PHAGE_Entero_2: P2 gpE-like tail protein; t4299; phage(gi169936023) | 4e-46 | Click |
| 22 | complement(4463161..4463676) | PHAGE_Entero_2: P2 gpFII-like protein; t4300; phage(gi169936024) | 7e-94 | Click |
| 23 | complement(4463686..4464858) | PHAGE_Entero_2: P2 gpFI-like protein; t4301; phage(gi169936025) | 0.0 | Click |
| 24 | 4465393..4466115 | invasion-associated secreted protein; t4303 | N/A | Click |
| 25 | complement(4466313..4466720) | PHAGE_Entero_2: P2 gpG-like protein; t4304; phage(gi169936028) | 8e-66 | Click |
| 26 | complement(4466727..4468346) | PHAGE_Entero_2: P2 gpH-like protein; t4305; phage(gi169936030) | 2e-160 | Click |
| 27 | complement(4468343..4468948) | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; t4306; phage(gi169936031) | 3e-110 | Click |
| 28 | complement(4468941..4469849) | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; t4307; phage(gi169936032) | 4e-159 | Click |
| 29 | complement(4469836..4470195) | PHAGE_Entero_2: P2 gpW-like baseplate protein; t4308; phage(gi169936033) | 2e-58 | Click |
| 30 | complement(4470192..4470770) | PHAGE_Entero_2: P2 gpV-like protein; t4309; phage(gi169936034) | 3e-111 | Click |
| 31 | complement(4470839..4471285) | PHAGE_Entero_2: P2 gpS-like tail completion protein; t4310; phage(gi169936035) | 1e-77 | Click |
| 32 | 4471789..4471800 | attL CGCATTCAGATC | N/A | Click |
| 33 | complement(4471805..4472230) | PHAGE_Entero_2: P2 LysB-like protein; t4312; phage(gi169936038) | 6e-69 | Click |
| 34 | complement(4472230..4472607) | hypothetical protein; t4313 | N/A | Click |
| 35 | complement(4472612..4473082) | PHAGE_Entero_2: endolysin; t4314; phage(gi169936041) | 7e-87 | Click |
| 36 | complement(4473102..4473317) | PHAGE_Entero_2: lysis protein; t4315; phage(gi169936042) | 1e-34 | Click |
| 37 | complement(4473321..4473524) | PHAGE_Entero_2: P2 gpX-like tail protein; t4316; phage(gi169936043) | 9e-35 | Click |
| 38 | complement(4473524..4473988) | PHAGE_Entero_2: P2 gpL-like protein; t4317; phage(gi169936044) | 6e-86 | Click |
| 39 | complement(4474082..4474732) | PHAGE_Entero_2: P2 gpM-like protein; t4318; phage(gi169936045) | 8e-116 | Click |
| 40 | complement(4474736..4475800) | PHAGE_Entero_2: P2 gpN-like major capsid protein; t4319; phage(gi169936046) | 0.0 | Click |
| 41 | complement(4475817..4476650) | PHAGE_Entero_2: P2 gpO-like protein; t4320; phage(gi169936047) | 2e-145 | Click |
| 42 | 4476793..4478559 | PHAGE_Entero_2: P2 gpP-like protein; t4322; phage(gi169936048) | 0.0 | Click |
| 43 | 4478556..4479602 | PHAGE_Entero_2: P2 gpQ-like protein; t4321; phage(gi169936049) | 6e-179 | Click |
| 44 | complement(4479651..4480346) | hypothetical protein; t4323 | N/A | Click |
| 45 | complement(4480366..4481430) | hypothetical protein; t4324 | N/A | Click |
| 46 | complement(4481427..4482491) | hypothetical protein; t4325 | N/A | Click |
| 47 | complement(4482501..4482719) | hypothetical protein; t4326 | N/A | Click |
| 48 | complement(4483416..4485824) | PHAGE_Entero_2: P2 gpA-like protein; t4328; phage(gi169936054) | 0.0 | Click |
| 49 | complement(4485815..4486675) | PHAGE_Entero_2: DNA adenine methylase-like protein; t4329; phage(gi169936055) | 3e-130 | Click |
| 50 | complement(4486672..4487256) | PHAGE_Vibrio_vB_VpaM_MAR: putative exonuclease; t4330; phage(gi428782757) | 2e-45 | Click |
| 51 | complement(4487253..4487480) | PHAGE_Entero_2: P2 gpOrf82-like protein; t4331; phage(gi169936056) | 9e-40 | Click |
| 52 | complement(4487480..4487713) | PHAGE_Entero_2: hypothetical protein STM2732.Fels2; t4332; phage(gi169936057) | 1e-35 | Click |
| 53 | complement(4487781..4488122) | PHAGE_Entero_2: hypothetical protein STM2733.Fels2; t4333; phage(gi169936058) | 2e-49 | Click |
| 54 | complement(4488086..4488286) | PHAGE_Entero_2: hypothetical protein STM2735.Fels2; t4334; phage(gi169936060) | 9e-13 | Click |
| 55 | complement(4488294..4488803) | PHAGE_Entero_2: bacteriophage regulatory protein CII; t4335; phage(gi169936061) | 5e-91 | Click |
| 56 | complement(4488836..4489078) | PHAGE_Entero_2: bacteriophage regulatory protein Ap1; t4336; phage(gi169936062) | 2e-40 | Click |
| 57 | 4489195..4489827 | PHAGE_Entero_2: P2 CI-like protein; t4337; phage(gi169936063) | 5e-116 | Click |
| 58 | 4489831..4490856 | PHAGE_Entero_2: P2 Int-like protein; t4338; phage(gi169936064) | 0.0 | Click |
| 59 | 4491188..4491199 | attR CGCATTCAGATC | N/A | Click |
| 60 | 4491584..4491697 | hypothetical protein; t4340 | N/A | Click |
| 61 | 4491933..4492220 | hypothetical protein; t4341 | N/A | Click |
| 62 | 4492231..4493121 | PHAGE_Microm_12T: hypothetical protein; t4342; phage(gi472342811) | 2e-06 | Click |
Region 9, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4666559..4666572 | attL GAGTCCGGCCTTCG | N/A | Click |
| 2 | 4666742..4668007 | PHAGE_Entero_P4: integrase; t4518; phage(gi9627511) | 0.0 | Click |
| 3 | complement(4668070..4669146) | PHAGE_Plankt_PaV_LD: protein kinase; t4519; phage(gi371496162) | 4e-16 | Click |
| 4 | complement(4669143..4670216) | PHAGE_Plankt_PaV_LD: protein kinase; t4520; phage(gi371496162) | 2e-56 | Click |
| 5 | complement(4670191..4671354) | PHAGE_Plankt_PaV_LD: protein phosphatase; t4521; phage(gi371496161) | 6e-34 | Click |
| 6 | complement(4671630..4672196) | PHAGE_Entero_P4: amber mutation-suppressing protein; t4522; phage(gi9627520) | 3e-63 | Click |
| 7 | complement(4672212..4672451) | PHAGE_Entero_P2: Ogr; t4523; phage(gi9630356) | 2e-14 | Click |
| 8 | complement(4672455..4673315) | PHAGE_Entero_P4: head size determination protein sid; t4524; phage(gi9627518) | 9e-20 | Click |
| 9 | 4673738..4674061 | PHAGE_Entero_P4: transcriptional regulator; t4525; phage(gi9627517) | 8e-28 | Click |
| 10 | 4674162..4674545 | PHAGE_Entero_P4: putative CI repressor; t4526; phage(gi9627516) | 5e-38 | Click |
| 11 | 4674542..4674769 | hypothetical protein; t4527 | N/A | Click |
| 12 | 4674766..4675086 | PHAGE_Entero_P4: hypothetical protein P4p07; t4528; phage(gi9627513) | 5e-53 | Click |
| 13 | 4677655..4677795 | PHAGE_Entero_P4: hypothetical protein P4p05; t4530; phage(gi19263411) | 5e-07 | Click |
| 14 | 4677962..4677975 | attR GAGTCCGGCCTTCG | N/A | Click |