Definition | Streptococcus pyogenes SSI-1, complete genome. |
---|---|
Accession | NC_004606 |
Length | 1,894,275 |
Legend
Hits against Virus and prophage DB | |
Hits against Bacterial DB or GenBank file |
Region 1, total : 51 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 441336..441350 | attL ATTTTCTGAAAAAAG | N/A | Click |
2 | 443902..444636 | PHAGE_Amsact_: putative ATP-binding cassette transporter; SPs0406; phage(gi9964444) | 1e-15 | Click |
3 | 444641..446284 | ABC transporter permease; SPs0407 | N/A | Click |
4 | complement(446427..447515) | PHAGE_Strept_6: putative integrase; SPs0408; phage(gi28876488) | 0.0 | Click |
5 | complement(447691..448242) | PHAGE_Strept_6: hypothetical protein SpyM3_1457; SPs0409; phage(gi28876487) | 2e-98 | Click |
6 | complement(448253..448636) | PHAGE_Strept_6: hypothetical protein SpyM3_1456; SPs0410; phage(gi28876486) | 2e-72 | Click |
7 | complement(448650..449024) | PHAGE_Strept_6: putative repressor; SPs0411; phage(gi28876485) | 1e-66 | Click |
8 | 449639..449830 | PHAGE_Strept_6: putative transcriptional repressor; SPs0412; phage(gi28876484) | 4e-29 | Click |
9 | 449851..450081 | PHAGE_Strept_6: hypothetical protein SpyM3_1453; SPs0413; phage(gi28876483) | 4e-38 | Click |
10 | 450169..450426 | PHAGE_Strept_6: hypothetical protein SpyM3_1452; SPs0414; phage(gi28876482) | 5e-44 | Click |
11 | 450437..450625 | PHAGE_Strept_6: hypothetical protein SpyM3_1451; SPs0415; phage(gi28876481) | 4e-25 | Click |
12 | 450606..450791 | PHAGE_Strept_6: hypothetical protein SpyM3_1450; SPs0416; phage(gi28876480) | 3e-26 | Click |
13 | 450818..450829 | attL AACGATGACAAC | N/A | Click |
14 | 450822..451205 | PHAGE_Strept_6: hypothetical protein SpyM3_1449; SPs0417; phage(gi28876479) | 1e-68 | Click |
15 | 451351..451554 | PHAGE_Strept_6: hypothetical protein SpyM3_1447; SPs0418; phage(gi28876477) | 1e-34 | Click |
16 | 451642..451941 | PHAGE_Strept_6: hypothetical protein SpyM3_1446; SPs0419; phage(gi28876476) | 6e-49 | Click |
17 | 451941..453098 | PHAGE_Strept_6: hypothetical protein SpyM3_1445; SPs0420; phage(gi28876475) | 0.0 | Click |
18 | 453091..453675 | PHAGE_Strept_6: hypothetical protein SpyM3_1444; SPs0421; phage(gi28876474) | 8e-105 | Click |
19 | 453718..455640 | PHAGE_Strept_6: putative DNA polymerase A domain; SPs0422; phage(gi28876473) | 0.0 | Click |
20 | 455645..458029 | PHAGE_Strept_6: putative DNA primase/helicase; SPs0423; phage(gi28876472) | 0.0 | Click |
21 | 458395..458670 | PHAGE_Strept_6: hypothetical protein SpyM3_1441; SPs0424; phage(gi28876471) | 1e-48 | Click |
22 | 458661..459989 | PHAGE_Strept_6: putative helicase; SPs0425; phage(gi28876470) | 0.0 | Click |
23 | 460252..460425 | PHAGE_Strept_6: hypothetical protein SpyM3_1438; SPs0426; phage(gi28876468) | 2e-25 | Click |
24 | 460428..460574 | hypothetical protein; SPs0427 | N/A | Click |
25 | 460603..460974 | PHAGE_Strept_6: putative transcriptional activator; SPs0428; phage(gi28876467) | 1e-65 | Click |
26 | 461064..461516 | PHAGE_Strept_6: putative terminase small subunit; SPs0429; phage(gi28876466) | 2e-74 | Click |
27 | 461506..462783 | PHAGE_Strept_6: putative terminase large subunit; SPs0430; phage(gi28876465) | 0.0 | Click |
28 | 462799..464331 | PHAGE_Strept_6: hypothetical protein SpyM3_1434; SPs0431; phage(gi28876464) | 0.0 | Click |
29 | 464291..465739 | PHAGE_Strept_6: hypothetical protein SpyM3_1433; SPs0432; phage(gi28876463) | 0.0 | Click |
30 | complement(465808..465960) | hypothetical protein; SPs0433 | N/A | Click |
31 | 465960..466226 | PHAGE_Strept_6: hypothetical protein SpyM3_1431; SPs0434; phage(gi28876461) | 7e-43 | Click |
32 | 466394..466963 | PHAGE_Strept_6: hypothetical protein SpyM3_1430; SPs0435; phage(gi28876460) | 1e-101 | Click |
33 | 466976..467863 | PHAGE_Strept_6: hypothetical protein SpyM3_1429; SPs0436; phage(gi28876459) | 5e-165 | Click |
34 | 467875..468231 | PHAGE_Strept_6: hypothetical protein SpyM3_1428; SPs0437; phage(gi28876458) | 2e-61 | Click |
35 | 468242..468520 | PHAGE_Strept_6: hypothetical protein SpyM3_1427; SPs0438; phage(gi28876457) | 2e-49 | Click |
36 | 468517..468861 | PHAGE_Strept_6: hypothetical protein SpyM3_1426; SPs0439; phage(gi28876456) | 1e-55 | Click |
37 | 468865..469224 | PHAGE_Strept_6: hypothetical protein SpyM3_1425; SPs0440; phage(gi28876455) | 2e-61 | Click |
38 | 469236..469835 | PHAGE_Strept_6: hypothetical protein SpyM3_1424; SPs0441; phage(gi28876454) | 1e-111 | Click |
39 | 469889..470344 | PHAGE_Strept_6: hypothetical protein SpyM3_1423; SPs0442; phage(gi28876453) | 2e-79 | Click |
40 | 470419..470652 | PHAGE_Strept_6: hypothetical protein SpyM3_1422; SPs0443; phage(gi28876452) | 2e-37 | Click |
41 | 470667..475049 | PHAGE_Strept_6: putative tail protein; SPs0444; phage(gi28876451) | 0.0 | Click |
42 | 475061..475903 | PHAGE_Strept_6: hypothetical protein SpyM3_1420; SPs0445; phage(gi28876450) | 3e-160 | Click |
43 | 476693..477892 | PHAGE_Strept_6: hypothetical protein SpyM3_1419; SPs0446; phage(gi28876449) | 0.0 | Click |
44 | 477889..478896 | PHAGE_Strept_6: putative hyaluronidase; SPs0447; phage(gi28876448) | 0.0 | Click |
45 | 480100..480921 | PHAGE_Strept_6: hypothetical protein SpyM3_1417; SPs0448; phage(gi28876447) | 1e-152 | Click |
46 | 480933..481370 | PHAGE_Strept_6: hypothetical protein SpyM3_1416; SPs0449; phage(gi28876446) | 8e-78 | Click |
47 | 481691..481984 | PHAGE_Strept_6: hypothetical protein SpyM3_1415; SPs0450; phage(gi28876445) | 1e-49 | Click |
48 | 481994..482266 | PHAGE_Strept_6: hypothetical protein SpyM3_1414; SPs0451; phage(gi28876444) | 9e-45 | Click |
49 | 482263..482490 | PHAGE_Strept_6: putative holin; SPs0452; phage(gi28876443) | 4e-35 | Click |
50 | 483070..483081 | attR AACGATGACAAC | N/A | Click |
51 | 483128..483808 | PHAGE_Strept_6: putative cell wall hydrolase, lysin; SPs0453; phage(gi28876441) | 6e-135 | Click |
52 | 484022..484645 | PHAGE_Strept_6: hypothetical protein SpyM3_1410; SPs0454; phage(gi28876440) | 3e-66 | Click |
53 | complement(484759..485745) | PHAGE_Strept_6: streptodornase (Sdn); SPs0455; phage(gi28876439) | 0.0 | Click |
54 | 485978..486160 | PHAGE_Strept_6: hypothetical protein SpyM3_1408; SPs0456; phage(gi28876438) | 7e-29 | Click |
55 | 498166..498180 | attR ATTTTCTGAAAAAAG | N/A | Click |
Region 2, total : 56 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 545487..545500 | attL ATACTTTGATTATA | N/A | Click |
2 | complement(545636..546802) | PHAGE_Strept_5: putative phage integrase; SPs0507; phage(gi28876436) | 0.0 | Click |
3 | complement(546805..546939) | hypothetical protein; SPs0508 | N/A | Click |
4 | complement(546976..547437) | PHAGE_Strept_5: hypothetical protein SpyM3_1353; SPs0509; phage(gi28876435) | 4e-84 | Click |
5 | complement(547461..547565) | PHAGE_Strept_5: hypothetical protein SpyM3_1353; SPs0510; phage(gi28876435) | 7e-08 | Click |
6 | complement(547693..547827) | hypothetical protein; SPs0511 | N/A | Click |
7 | complement(547834..547986) | PHAGE_Strept_5: hypothetical protein SpyM3_1352; SPs0512; phage(gi28876434) | 2e-22 | Click |
8 | complement(547997..548374) | PHAGE_Strept_5: putative cI-like repressor, metallo-prtoeinase motif; SPs0513; phage(gi28876433) | 1e-71 | Click |
9 | complement(548358..548717) | PHAGE_Strept_5: putative cI-like repressor; SPs0514; phage(gi28876432) | 4e-62 | Click |
10 | 548906..549124 | PHAGE_Strept_5: putative Cro-like repressor; SPs0515; phage(gi28876431) | 8e-36 | Click |
11 | 549219..549470 | PHAGE_Strept_5: hypothetical protein SpyM3_1348; SPs0516; phage(gi28876430) | 1e-44 | Click |
12 | 549501..549638 | PHAGE_Strept_5: hypothetical protein SpyM3_1347; SPs0517; phage(gi28876429) | 1e-21 | Click |
13 | 549654..549968 | PHAGE_Strept_5: hypothetical protein SpyM3_1346; SPs0518; phage(gi28876428) | 2e-55 | Click |
14 | 550197..550679 | PHAGE_Strept_5: hypothetical protein SpyM3_1345; SPs0519; phage(gi28876427) | 3e-85 | Click |
15 | 550680..551360 | PHAGE_Strept_5: hypothetical protein SpyM3_1344; SPs0520; phage(gi28876426) | 4e-129 | Click |
16 | 551462..552691 | PHAGE_Strept_5: putative helicase; SPs0521; phage(gi28876425) | 0.0 | Click |
17 | 552707..553165 | PHAGE_Strept_5: hypothetical protein SpyM3_1342; SPs0522; phage(gi28876424) | 3e-85 | Click |
18 | 553168..553980 | PHAGE_Strept_5: hypothetical protein SpyM3_1341; SPs0523; phage(gi28876423) | 5e-155 | Click |
19 | 555695..556015 | PHAGE_Strept_5: hypothetical protein SpyM3_1338; SPs0524; phage(gi28876420) | 3e-55 | Click |
20 | 556352..556603 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_16; SPs0525; phage(gi16271792) | 9e-35 | Click |
21 | 556597..556881 | PHAGE_Strept_5: hypothetical protein SpyM3_1336; SPs0526; phage(gi28876418) | 6e-52 | Click |
22 | 556878..557291 | PHAGE_Strept_5: hypothetical protein SpyM3_1335; SPs0527; phage(gi28876417) | 5e-77 | Click |
23 | 557317..557739 | PHAGE_Strept_1: hypothetical protein SpyM3_0696; SPs0528; phage(gi28876161) | 3e-43 | Click |
24 | 557838..558077 | PHAGE_Strept_5: hypothetical protein SpyM3_1333; SPs0529; phage(gi28876415) | 3e-39 | Click |
25 | 558243..558428 | PHAGE_Strept_5: hypothetical protein SpyM3_1332; SPs0530; phage(gi28876414) | 9e-29 | Click |
26 | 558682..559218 | PHAGE_Strept_5: hypothetical protein SpyM3_1331; SPs0531; phage(gi28876413) | 3e-95 | Click |
27 | 559669..560103 | PHAGE_Strept_5: hypothetical protein SpyM3_1330; SPs0532; phage(gi28876412) | 3e-78 | Click |
28 | 560737..561093 | PHAGE_Strept_5: hypothetical protein SpyM3_1329; SPs0533; phage(gi28876411) | 7e-63 | Click |
29 | 561059..561349 | PHAGE_Strept_5: putative terminase large subunit; SPs0534; phage(gi28876410) | 4e-51 | Click |
30 | 562393..563682 | PHAGE_Strept_5: hypothetical protein SpyM3_1326; SPs0535; phage(gi28876408) | 0.0 | Click |
31 | 563651..564559 | PHAGE_Strept_5: hypothetical protein SpyM3_1325; SPs0536; phage(gi28876407) | 1e-174 | Click |
32 | 564566..564832 | PHAGE_Strept_5: hypothetical protein SpyM3_1324; SPs0537; phage(gi28876406) | 5e-43 | Click |
33 | 564982..565554 | PHAGE_Strept_5: hypothetical protein SpyM3_1323; SPs0538; phage(gi28876405) | 8e-100 | Click |
34 | 565572..566462 | PHAGE_Strept_5: hypothetical protein SpyM3_1322; SPs0539; phage(gi28876404) | 3e-166 | Click |
35 | 566475..566768 | PHAGE_Strept_5: hypothetical protein SpyM3_1321; SPs0540; phage(gi28876403) | 1e-49 | Click |
36 | 566782..567126 | PHAGE_Strept_5: hypothetical protein SpyM3_1320; SPs0541; phage(gi28876402) | 9e-58 | Click |
37 | 567123..567434 | PHAGE_Strept_5: hypothetical protein SpyM3_1319; SPs0542; phage(gi28876401) | 3e-53 | Click |
38 | 567482..567826 | PHAGE_Strept_5: hypothetical protein SpyM3_1318; SPs0543; phage(gi28876400) | 4e-63 | Click |
39 | 567828..568238 | PHAGE_Strept_5: hypothetical protein SpyM3_1317; SPs0544; phage(gi28876399) | 8e-74 | Click |
40 | 568250..568756 | PHAGE_Strept_5: hypothetical protein SpyM3_1316; SPs0545; phage(gi28876398) | 2e-92 | Click |
41 | 568769..569086 | PHAGE_Strept_5: hypothetical protein SpyM3_1315; SPs0546; phage(gi28876397) | 1e-54 | Click |
42 | 569059..569517 | PHAGE_Strept_5: hypothetical protein SpyM3_1314; SPs0547; phage(gi28876396) | 6e-85 | Click |
43 | 569510..571315 | PHAGE_Strept_5: putative platlet-binding protein, minor tail fiber protein; SPs0548; phage(gi28876395) | 0.0 | Click |
44 | 571316..572800 | PHAGE_Strept_5: putative minor structural protein; SPs0549; phage(gi28876394) | 0.0 | Click |
45 | 572801..576241 | PHAGE_Strept_5: putative tail protein; SPs0550; phage(gi28876393) | 0.0 | Click |
46 | 576246..578108 | PHAGE_Strept_5: putative minor structural protein; SPs0551; phage(gi28876392) | 0.0 | Click |
47 | 578119..578466 | PHAGE_Strept_5: hypothetical protein SpyM3_1309; SPs0552; phage(gi28876391) | 5e-62 | Click |
48 | 578616..579035 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_48; SPs0553; phage(gi16271824) | 3e-08 | Click |
49 | 578938..579270 | PHAGE_Strept_5: putative holin; SPs0554; phage(gi28876389) | 8e-55 | Click |
50 | 579272..580036 | PHAGE_Strept_5: putative cell wall hydrolase, lysin; SPs0555; phage(gi28876388) | 1e-152 | Click |
51 | 580048..580650 | PHAGE_Strept_5: hypothetical protein SpyM3_1305; SPs0556; phage(gi28876387) | 1e-111 | Click |
52 | 580661..581434 | PHAGE_Strept_5: hypothetical protein SpyM3_1304; SPs0557; phage(gi28876386) | 9e-141 | Click |
53 | 581444..581665 | PHAGE_Strept_5: hypothetical protein SpyM3_1303; SPs0558; phage(gi28876385) | 5e-36 | Click |
54 | 581665..582324 | PHAGE_Strept_5: hypothetical protein SpyM3_1302; SPs0559; phage(gi28876384) | 1e-125 | Click |
55 | complement(582446..583201) | PHAGE_Strept_5: exotoxin type A precursor; SPs0560; phage(gi28876383) | 9e-146 | Click |
56 | 583421..583603 | PHAGE_Strept_5: hypothetical protein SpyM3_1300; SPs0561; phage(gi28876382) | 3e-28 | Click |
57 | 583678..583691 | attR ATACTTTGATTATA | N/A | Click |
58 | 583794..585149 | PHAGE_Acanth_mimivirus: putative RNA methyltransferase; SPs0562; phage(gi311977789) | 4e-23 | Click |
Region 3, total : 65 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 624975..624986 | attL TCTGATATAATA | N/A | Click |
2 | complement(625070..626224) | PHAGE_Temper_1: integrase-like protein; SPs0597; phage(gi16271777) | 0.0 | Click |
3 | complement(626343..626735) | PHAGE_Temper_1: hypothetical protein phiNIH1.1_02; SPs0598; phage(gi16271778) | 1e-70 | Click |
4 | complement(626875..627255) | PHAGE_Temper_1: hypothetical protein phiNIH1.1_03; SPs0599; phage(gi16271779) | 7e-72 | Click |
5 | complement(627269..627628) | PHAGE_Temper_1: repressor protein; SPs0600; phage(gi16271780) | 3e-63 | Click |
6 | 628424..628615 | PHAGE_Strept_4: hypothetical protein SpyM3_1262; SPs0601; phage(gi28876376) | 2e-29 | Click |
7 | 628626..629354 | PHAGE_Temper_1: antirepressor; SPs0602; phage(gi16271781) | 7e-137 | Click |
8 | 629387..629536 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_06; SPs0603; phage(gi16271782) | 8e-22 | Click |
9 | complement(629533..629733) | PHAGE_Strept_4: hypothetical protein SpyM3_1259; SPs0604; phage(gi28876373) | 5e-33 | Click |
10 | 629722..629976 | PHAGE_Strept_4: hypothetical protein SpyM3_1258; SPs0605; phage(gi28876372) | 3e-43 | Click |
11 | 630222..630479 | PHAGE_Strept_4: hypothetical protein SpyM3_1257; SPs0606; phage(gi28876371) | 7e-45 | Click |
12 | 630508..630693 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_07; SPs0607; phage(gi16271783) | 5e-28 | Click |
13 | 630787..631044 | PHAGE_Strept_4: putative replication protein; SPs0608; phage(gi28876369) | 9e-43 | Click |
14 | 631166..631579 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_08; SPs0609; phage(gi16271784) | 2e-77 | Click |
15 | 631560..631793 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_09; SPs0610; phage(gi16271785) | 9e-40 | Click |
16 | 631920..632195 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_10; SPs0611; phage(gi16271786) | 2e-49 | Click |
17 | 632217..632699 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_11; SPs0612; phage(gi16271787) | 2e-84 | Click |
18 | 632700..633374 | PHAGE_Temper_1: recombination protein; SPs0613; phage(gi16271788) | 2e-125 | Click |
19 | 633367..633786 | PHAGE_Temper_1: single-strand binding protein; SPs0614; phage(gi16271789) | 3e-76 | Click |
20 | 633792..633995 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_14; SPs0615; phage(gi16271790) | 1e-33 | Click |
21 | 634082..634435 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_15; SPs0616; phage(gi16271791) | 8e-65 | Click |
22 | 634432..634788 | PHAGE_Strept_4: hypothetical protein SpyM3_1247; SPs0617; phage(gi28876361) | 1e-64 | Click |
23 | 634785..635036 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_16; SPs0618; phage(gi16271792) | 7e-43 | Click |
24 | 635030..635314 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_17; SPs0619; phage(gi16271793) | 4e-52 | Click |
25 | 635371..635580 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_18; SPs0620; phage(gi16271794) | 1e-35 | Click |
26 | 635590..635994 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; SPs0621; phage(gi16271795) | 3e-74 | Click |
27 | 635991..636161 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_20; SPs0622; phage(gi16271796) | 6e-28 | Click |
28 | 636158..636664 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_21; SPs0623; phage(gi16271797) | 1e-96 | Click |
29 | 637105..637545 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPs0624; phage(gi16271798) | 2e-81 | Click |
30 | 638522..639040 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_23; SPs0625; phage(gi16271799) | 4e-94 | Click |
31 | 639019..639696 | PHAGE_Temper_1: putative ABC transporter; SPs0626; phage(gi16271800) | 2e-131 | Click |
32 | 639819..640088 | PHAGE_Strept_4: hypothetical protein SpyM3_1234; SPs0627; phage(gi28876348) | 5e-46 | Click |
33 | 640149..640526 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_25; SPs0628; phage(gi16271801) | 2e-69 | Click |
34 | 640577..641050 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_26; SPs0629; phage(gi16271802) | 6e-81 | Click |
35 | 641133..642344 | PHAGE_Temper_1: terminase large subunit; SPs0630; phage(gi16271803) | 0.0 | Click |
36 | 642358..643860 | PHAGE_Temper_1: minor capsid protein; SPs0631; phage(gi16271804) | 0.0 | Click |
37 | 643865..645343 | PHAGE_Temper_1: minor capsid protein; SPs0632; phage(gi16271805) | 0.0 | Click |
38 | 645315..645554 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_30; SPs0633; phage(gi16271806) | 2e-39 | Click |
39 | 645616..645882 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_31; SPs0634; phage(gi16271807) | 7e-43 | Click |
40 | 646008..646622 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_32; SPs0635; phage(gi16271808) | 4e-111 | Click |
41 | 646626..647444 | PHAGE_Temper_1: major capsid protein; SPs0636; phage(gi16271809) | 3e-150 | Click |
42 | 647498..647914 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_34; SPs0637; phage(gi16271810) | 1e-58 | Click |
43 | 647904..648236 | PHAGE_Temper_1: minor capsid protein; SPs0638; phage(gi16271811) | 2e-60 | Click |
44 | 648236..648592 | PHAGE_Temper_1: minor capsid protein; SPs0639; phage(gi16271812) | 4e-65 | Click |
45 | 648589..648987 | PHAGE_Temper_1: minor capsid protein; SPs0640; phage(gi16271813) | 2e-72 | Click |
46 | 648987..649472 | PHAGE_Temper_1: tail protein; SPs0641; phage(gi16271814) | 5e-90 | Click |
47 | 649511..649945 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_39; SPs0642; phage(gi16271815) | 4e-77 | Click |
48 | 649949..650530 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_40; SPs0643; phage(gi16271816) | 7e-110 | Click |
49 | 650520..653780 | PHAGE_Temper_1: tail protein; SPs0644; phage(gi16271817) | 0.0 | Click |
50 | 653777..654493 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_42; SPs0645; phage(gi16271818) | 5e-138 | Click |
51 | 655250..655600 | hypothetical protein; SPs0646 | N/A | Click |
52 | 655918..656634 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_43; SPs0647; phage(gi16271819) | 4e-131 | Click |
53 | 656631..657644 | PHAGE_Temper_1: hyaluronidase; SPs0648; phage(gi16271820) | 0.0 | Click |
54 | 657659..659542 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_45; SPs0649; phage(gi16271821) | 0.0 | Click |
55 | 659554..659985 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_46; SPs0650; phage(gi16271822) | 2e-77 | Click |
56 | 660312..660599 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_47; SPs0651; phage(gi16271823) | 7e-50 | Click |
57 | 660610..660906 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_48; SPs0652; phage(gi16271824) | 2e-50 | Click |
58 | 660903..661088 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_49; SPs0653; phage(gi16271825) | 2e-28 | Click |
59 | 661199..662401 | PHAGE_Temper_1: cell wall hydrolase; SPs0654; phage(gi16271826) | 0.0 | Click |
60 | 662541..663065 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_51; SPs0655; phage(gi16271827) | 8e-101 | Click |
61 | 663053..663919 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_52; SPs0656; phage(gi16271828) | 2e-162 | Click |
62 | 664373..665002 | PHAGE_Temper_1: SpeL; SPs0657; phage(gi16271829) | 8e-120 | Click |
63 | 665478..666053 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_53; SPs0658; phage(gi16271830) | 6e-113 | Click |
64 | 666047..666334 | PHAGE_Temper_1: hypothetical protein phiNIH1.1_54; SPs0659; phage(gi16271831) | 2e-35 | Click |
65 | 666754..666765 | attR TCTGATATAATA | N/A | Click |
66 | 666835..667566 | two-component response regulator; SPs0660 | N/A | Click |
67 | 667563..669296 | PHAGE_Entero_2008: putative 2-component sensor protein YehU; SPs0661; phage(gi209427798) | 1e-27 | Click |
Region 4, total : 57 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 724653..724928 | PHAGE_Bacill_36: DNA-binding HU protein; SPs0716; phage(gi156564019) | 3e-29 | Click |
2 | 724911..724930 | attL AAAGACGCTGTTAAATAATT | N/A | Click |
3 | complement(725017..726159) | PHAGE_Strept_3: putative integrase; SPs0717; phage(gi28876315) | 0.0 | Click |
4 | complement(726283..726801) | PHAGE_Strept_3: hypothetical protein SpyM3_1144; SPs0718; phage(gi28876314) | 2e-96 | Click |
5 | complement(726813..727568) | PHAGE_Strept_3: putative cI-like repressor; SPs0719; phage(gi28876313) | 1e-141 | Click |
6 | 727770..727982 | PHAGE_Strept_3: putative Cro-like repressor protein; SPs0720; phage(gi28876312) | 2e-33 | Click |
7 | 728252..728563 | PHAGE_Strept_3: putative excisionase; SPs0721; phage(gi28876311) | 3e-57 | Click |
8 | 728565..728750 | PHAGE_Strept_3: hypothetical protein SpyM3_1140; SPs0722; phage(gi28876310) | 3e-28 | Click |
9 | 728844..729113 | PHAGE_Strept_4: putative replication protein; SPs0723; phage(gi28876369) | 3e-18 | Click |
10 | 729254..729640 | PHAGE_Strept_3: hypothetical protein SpyM3_1139; SPs0724; phage(gi28876309) | 7e-72 | Click |
11 | 729621..729854 | PHAGE_Strept_3: hypothetical protein SpyM3_1138; SPs0725; phage(gi28876308) | 4e-40 | Click |
12 | 730000..730206 | PHAGE_Strept_3: hypothetical protein SpyM3_1137; SPs0726; phage(gi28876307) | 2e-32 | Click |
13 | 730262..730435 | PHAGE_Strept_3: hypothetical protein SpyM3_1136; SPs0727; phage(gi28876306) | 6e-26 | Click |
14 | 730440..730592 | PHAGE_Strept_3: hypothetical protein SpyM3_1135; SPs0728; phage(gi28876305) | 2e-22 | Click |
15 | 730595..731521 | PHAGE_Strept_3: putative recombinase; SPs0729; phage(gi28876304) | 6e-176 | Click |
16 | 731518..731718 | PHAGE_Strept_3: hypothetical protein SpyM3_1133; SPs0730; phage(gi28876303) | 5e-33 | Click |
17 | 731711..732508 | PHAGE_Strept_3: hypothetical protein SpyM3_1132; SPs0731; phage(gi28876302) | 7e-154 | Click |
18 | 732630..732722 | hypothetical protein; SPs0732 | N/A | Click |
19 | 732873..733268 | PHAGE_Strept_3: hypothetical protein SpyM3_1131; SPs0733; phage(gi28876301) | 1e-71 | Click |
20 | 733265..734611 | PHAGE_Strept_3: hypothetical protein SpyM3_1130; SPs0734; phage(gi28876300) | 0.0 | Click |
21 | 734622..734954 | PHAGE_Strept_3: hypothetical protein SpyM3_1129; SPs0735; phage(gi28876299) | 7e-59 | Click |
22 | 734951..735463 | PHAGE_Strept_3: hypothetical protein SpyM3_1128; SPs0736; phage(gi28876298) | 1e-92 | Click |
23 | 735499..735816 | PHAGE_Strept_3: hypothetical protein SpyM3_1127; SPs0737; phage(gi28876297) | 2e-55 | Click |
24 | 735813..735968 | PHAGE_Strept_3: hypothetical protein SpyM3_1126; SPs0738; phage(gi28876296) | 1e-22 | Click |
25 | 735965..736216 | PHAGE_Strept_3: hypothetical protein SpyM3_1125; SPs0739; phage(gi28876295) | 1e-42 | Click |
26 | 736385..736711 | PHAGE_Strept_3: hypothetical protein SpyM3_1124; SPs0740; phage(gi28876294) | 9e-56 | Click |
27 | 736819..737163 | PHAGE_Strept_3: hypothetical protein SpyM3_1123; SPs0741; phage(gi28876293) | 5e-64 | Click |
28 | 737311..737667 | PHAGE_Strept_3: hypothetical protein SpyM3_1122; SPs0742; phage(gi28876292) | 4e-64 | Click |
29 | 737664..738932 | PHAGE_Strept_3: putative structural protein; SPs0743; phage(gi28876291) | 0.0 | Click |
30 | 738922..740418 | PHAGE_Strept_3: hypothetical protein SpyM3_1120; SPs0744; phage(gi28876290) | 0.0 | Click |
31 | 740424..740648 | PHAGE_Strept_3: hypothetical protein SpyM3_1119; SPs0745; phage(gi28876289) | 2e-39 | Click |
32 | 740725..740877 | PHAGE_Strept_3: hypothetical protein SpyM3_1118; SPs0746; phage(gi28876288) | 9e-24 | Click |
33 | 740870..741136 | PHAGE_Strept_3: hypothetical protein SpyM3_1117; SPs0747; phage(gi28876287) | 7e-43 | Click |
34 | 741138..741353 | PHAGE_Strept_3: hypothetical protein SpyM3_1116; SPs0748; phage(gi28876286) | 2e-36 | Click |
35 | 741435..742850 | PHAGE_Strept_3: putative terminase; SPs0749; phage(gi28876285) | 0.0 | Click |
36 | 742931..743392 | PHAGE_Strept_3: hypothetical protein SpyM3_1114; SPs0750; phage(gi28876284) | 1e-81 | Click |
37 | 743417..744328 | PHAGE_Strept_3: putative structural protein; SPs0751; phage(gi28876283) | 7e-172 | Click |
38 | 744328..744528 | PHAGE_Strept_3: hypothetical protein SpyM3_1112; SPs0752; phage(gi28876282) | 4e-32 | Click |
39 | 744571..744960 | PHAGE_Strept_3: hypothetical protein SpyM3_1111; SPs0753; phage(gi28876281) | 1e-69 | Click |
40 | 744902..745258 | PHAGE_Strept_3: hypothetical protein SpyM3_1110; SPs0754; phage(gi28876280) | 2e-60 | Click |
41 | 745251..745487 | PHAGE_Strept_3: hypothetical protein SpyM3_1109; SPs0755; phage(gi28876279) | 6e-38 | Click |
42 | 745488..745823 | PHAGE_Strept_3: hypothetical protein SpyM3_1108; SPs0756; phage(gi28876278) | 3e-59 | Click |
43 | 745839..746429 | PHAGE_Strept_3: putative structural protein; SPs0757; phage(gi28876277) | 9e-110 | Click |
44 | 746440..746703 | PHAGE_Strept_3: hypothetical protein SpyM3_1106; SPs0758; phage(gi28876276) | 1e-42 | Click |
45 | 746718..747089 | PHAGE_Strept_3: hypothetical protein SpyM3_1105; SPs0759; phage(gi28876275) | 3e-65 | Click |
46 | 747089..749452 | PHAGE_Strept_3: putative human platelet-binding protein; SPs0760; phage(gi28876274) | 0.0 | Click |
47 | 749449..750144 | PHAGE_Strept_3: hypothetical protein SpyM3_1103; SPs0761; phage(gi28876273) | 4e-135 | Click |
48 | 750126..752099 | PHAGE_Strept_3: putative platelet-binding protein; SPs0762; phage(gi28876272) | 0.0 | Click |
49 | 752138..753208 | PHAGE_Strept_3: hyaluronoglucosaminidase; SPs0763; phage(gi28876271) | 0.0 | Click |
50 | 753223..755004 | PHAGE_Strept_3: hypothetical protein SpyM3_1100; SPs0764; phage(gi28876270) | 0.0 | Click |
51 | 755013..755444 | PHAGE_Strept_3: hypothetical protein SpyM3_1099; SPs0765; phage(gi28876269) | 2e-76 | Click |
52 | 755771..756061 | PHAGE_Strept_3: hypothetical protein SpyM3_1098; SPs0766; phage(gi28876268) | 6e-50 | Click |
53 | 756072..756527 | PHAGE_Strept_3: putative holin protein; SPs0767; phage(gi28876267) | 8e-82 | Click |
54 | complement(756504..756638) | hypothetical protein; SPs0768 | N/A | Click |
55 | 756639..757853 | PHAGE_Strept_3: putative N-acetylmuramoyl-L-alanine amidase, lysin; SPs0769; phage(gi28876266) | 0.0 | Click |
56 | 758098..758892 | PHAGE_Strept_3: putative mitogenic factor; SPs0770; phage(gi28876265) | 3e-151 | Click |
57 | 758959..759141 | PHAGE_Strept_3: hypothetical protein SpyM3_1094; SPs0771; phage(gi28876264) | 5e-28 | Click |
58 | 759311..759330 | attR AAAGACGCTGTTAAATAATT | N/A | Click |
59 | 759671..761533 | PHAGE_Parame_AR158: hypothetical protein AR158_C785L; SPs0772; phage(gi157953975) | 1e-30 | Click |
Region 5, total : 65 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | complement(877707..878327) | PHAGE_Lactob_KC5a: hypothetical protein; SPs0875; phage(gi90592577) | 2e-18 | Click |
2 | 878343..878354 | attL CTATTTTTGCTG | N/A | Click |
3 | complement(878427..878564) | hypothetical protein; SPs0876 | N/A | Click |
4 | complement(878690..879601) | PHAGE_Strept_2: putative integrase; SPs0877; phage(gi28876262) | 3e-174 | Click |
5 | complement(879898..880203) | hypothetical protein; SPs0878 | N/A | Click |
6 | complement(880213..880923) | PHAGE_Strept_2: putative repressor protein; SPs0879; phage(gi28876261) | 9e-137 | Click |
7 | 881373..881519 | PHAGE_Strept_2: hypothetical protein SpyM3_0976; SPs0880; phage(gi28876260) | 6e-23 | Click |
8 | complement(881653..882531) | PHAGE_Strept_2: hypothetical protein SpyM3_0974; SPs0881; phage(gi28876258) | 2e-144 | Click |
9 | complement(882684..883094) | PHAGE_Strept_2: hypothetical protein SpyM3_0972; SPs0882; phage(gi28876256) | 1e-68 | Click |
10 | 883144..883383 | PHAGE_Strept_2: hypothetical protein SpyM3_0971; SPs0883; phage(gi28876255) | 3e-39 | Click |
11 | 883395..883640 | PHAGE_Strept_2: hypothetical protein SpyM3_0970; SPs0884; phage(gi28876254) | 1e-40 | Click |
12 | complement(883959..884198) | PHAGE_Strept_2: hypothetical protein SpyM3_0968; SPs0885; phage(gi28876252) | 2e-38 | Click |
13 | 884344..884550 | PHAGE_Strept_2: hypothetical protein SpyM3_0967; SPs0886; phage(gi28876251) | 9e-29 | Click |
14 | 884628..884924 | PHAGE_Strept_2: hypothetical protein SpyM3_0966; SPs0887; phage(gi28876250) | 5e-52 | Click |
15 | 884921..885055 | PHAGE_Strept_2: hypothetical protein SpyM3_0965; SPs0888; phage(gi28876249) | 7e-21 | Click |
16 | 885071..885385 | PHAGE_Strept_2: hypothetical protein SpyM3_0964; SPs0889; phage(gi28876248) | 2e-55 | Click |
17 | 885614..886096 | PHAGE_Strept_2: hypothetical protein SpyM3_0963; SPs0890; phage(gi28876247) | 9e-85 | Click |
18 | 886097..886777 | PHAGE_Strept_2: hypothetical protein SpyM3_0962; SPs0891; phage(gi28876246) | 4e-129 | Click |
19 | 886879..888108 | PHAGE_Strept_2: putative DEAD box family helicase; SPs0892; phage(gi28876245) | 0.0 | Click |
20 | 888124..888582 | PHAGE_Strept_2: hypothetical protein SpyM3_0960; SPs0893; phage(gi28876244) | 3e-85 | Click |
21 | complement(888617..888778) | orf53b-like protein; SPs0894 | N/A | Click |
22 | 888810..889397 | PHAGE_Strept_2: hypothetical protein SpyM3_0959; SPs0895; phage(gi28876243) | 1e-110 | Click |
23 | 889387..889941 | PHAGE_Strept_2: putative DNA primase; SPs0896; phage(gi28876242) | 5e-104 | Click |
24 | 890535..890861 | PHAGE_Strept_2: putative DNA primase; SPs0897; phage(gi28876241) | 2e-63 | Click |
25 | 890884..890988 | hypothetical protein; SPs0898 | N/A | Click |
26 | 891124..891537 | PHAGE_Strept_2: hypothetical protein SpyM3_0956; SPs0899; phage(gi28876240) | 7e-80 | Click |
27 | 891534..891854 | PHAGE_Strept_2: hypothetical protein SpyM3_0955; SPs0900; phage(gi28876239) | 2e-55 | Click |
28 | 891838..892041 | PHAGE_Strept_2: hypothetical protein SpyM3_0954; SPs0901; phage(gi28876238) | 5e-33 | Click |
29 | 892038..892322 | PHAGE_Strept_phi3396: hypothetical protein phi3396_19; SPs0902; phage(gi126011081) | 8e-41 | Click |
30 | 892401..892721 | PHAGE_Strept_2: putative DNA methyltransferase; SPs0903; phage(gi28876237) | 6e-60 | Click |
31 | 892912..893313 | PHAGE_Strept_2: hypothetical protein SpyM3_0952; SPs0904; phage(gi28876236) | 2e-75 | Click |
32 | 893313..893948 | PHAGE_Strept_2: hypothetical protein SpyM3_0951; SPs0905; phage(gi28876235) | 1e-121 | Click |
33 | 894221..894661 | PHAGE_Strept_2: hypothetical protein SpyM3_0950; SPs0906; phage(gi28876234) | 4e-81 | Click |
34 | 895247..895585 | PHAGE_Strept_2: hypothetical protein SpyM3_0948; SPs0907; phage(gi28876232) | 2e-64 | Click |
35 | 895757..896224 | PHAGE_Strept_2: hypothetical protein SpyM3_0947; SPs0908; phage(gi28876231) | 7e-86 | Click |
36 | 896239..897993 | PHAGE_Strept_2: hypothetical protein SpyM3_0946; SPs0909; phage(gi28876230) | 0.0 | Click |
37 | 897990..898160 | PHAGE_Strept_2: hypothetical protein SpyM3_0945; SPs0910; phage(gi28876229) | 6e-25 | Click |
38 | 898183..898419 | PHAGE_Strept_2: hypothetical protein SpyM3_0944; SPs0911; phage(gi28876228) | 7e-37 | Click |
39 | 898453..899673 | PHAGE_Strept_2: hypothetical protein SpyM3_0943; SPs0912; phage(gi28876227) | 0.0 | Click |
40 | 899651..900316 | PHAGE_Strept_2: putative ClpP protease ATP-dependent protease proteolytic subunit; SPs0913; phage(gi28876226) | 3e-119 | Click |
41 | 900342..901526 | PHAGE_Strept_2: hypothetical protein SpyM3_0941; SPs0914; phage(gi28876225) | 0.0 | Click |
42 | 901540..901668 | PHAGE_Strept_2: hypothetical protein SpyM3_0940; SPs0915; phage(gi28876224) | 2e-16 | Click |
43 | 901671..901973 | PHAGE_Strept_2: hypothetical protein SpyM3_0939; SPs0916; phage(gi28876223) | 9e-53 | Click |
44 | 901985..902308 | PHAGE_Strept_2: hypothetical protein SpyM3_0938; SPs0917; phage(gi28876222) | 4e-57 | Click |
45 | 902305..902682 | PHAGE_Strept_2: hypothetical protein SpyM3_0937; SPs0918; phage(gi28876221) | 5e-67 | Click |
46 | 902679..903104 | PHAGE_Strept_2: hypothetical protein SpyM3_0936; SPs0919; phage(gi28876220) | 1e-80 | Click |
47 | 903123..903734 | PHAGE_Strept_2: hypothetical protein SpyM3_0935; SPs0920; phage(gi28876219) | 3e-115 | Click |
48 | 903787..904113 | PHAGE_Strept_2: hypothetical protein SpyM3_0934; SPs0921; phage(gi28876218) | 3e-56 | Click |
49 | 904143..904310 | PHAGE_Strept_2: hypothetical protein SpyM3_0933; SPs0922; phage(gi28876217) | 6e-25 | Click |
50 | 904323..908246 | PHAGE_Strept_2: hypothetical protein SpyM3_0932; SPs0923; phage(gi28876216) | 0.0 | Click |
51 | 908291..908953 | PHAGE_Strept_2: hypothetical protein SpyM3_0931; SPs0924; phage(gi28876215) | 1e-125 | Click |
52 | 909710..910060 | hypothetical protein; SPs0925 | N/A | Click |
53 | 910378..911097 | PHAGE_Strept_2: hypothetical protein SpyM3_0930; SPs0926; phage(gi28876214) | 6e-112 | Click |
54 | 911139..912206 | PHAGE_Strept_3: hyaluronoglucosaminidase; SPs0927; phage(gi28876271) | 1e-166 | Click |
55 | 912216..914234 | PHAGE_Strept_2: hypothetical protein SpyM3_0927; SPs0928; phage(gi28876211) | 0.0 | Click |
56 | complement(914221..914640) | PHAGE_Strept_phi3396: hypothetical protein phi3396_52; SPs0929; phage(gi126011114) | 3e-32 | Click |
57 | 915073..915297 | PHAGE_Strept_2: hypothetical protein SpyM3_0925; SPs0930; phage(gi28876209) | 2e-36 | Click |
58 | 915307..915582 | PHAGE_Strept_2: hypothetical protein SpyM3_0924; SPs0931; phage(gi28876208) | 2e-45 | Click |
59 | 915579..915806 | PHAGE_Strept_2: putative holin; SPs0932; phage(gi28876207) | 4e-35 | Click |
60 | 915922..917130 | PHAGE_Strept_2: putative cell wall hydrolase; SPs0933; phage(gi28876206) | 0.0 | Click |
61 | complement(917246..917602) | PHAGE_Strept_1: hypothetical protein SpyM3_0732; SPs0934; phage(gi28876197) | 4e-62 | Click |
62 | complement(917660..917899) | PHAGE_Strept_1: hypothetical protein SpyM3_0733; SPs0935; phage(gi28876198) | 2e-42 | Click |
63 | complement(918555..918710) | PHAGE_Strept_phi3396: hypothetical protein phi3396_58; SPs0936; phage(gi126011120) | 8e-22 | Click |
64 | 918855..919064 | PHAGE_Strept_1: hypothetical protein SpyM3_0736; SPs0937; phage(gi28876201) | 4e-33 | Click |
65 | 920198..922030 | PHAGE_Lausan: putative translation elongation factor 1-alpha; SPs0938; phage(gi327409596) | 4e-06 | Click |
66 | 922473..923570 | PHAGE_Stx2_c_86: putative long tail fiber protein; SPs0939; phage(gi116222013) | 5e-70 | Click |
67 | 924828..924839 | attR CTATTTTTGCTG | N/A | Click |
Region 6, total : 58 CDS
# | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
---|---|---|---|---|
1 | 1098746..1098757 | attL ATATCAAAAAAG | N/A | Click |
2 | 1100328..1100339 | attL TTTTTTGTCAAT | N/A | Click |
3 | 1105128..1105826 | PHAGE_Amsact_: putative ATP-binding cassette transporter; SPs1115; phage(gi9964444) | 2e-14 | Click |
4 | 1105836..1106621 | ABC transporter permease; SPs1116 | N/A | Click |
5 | complement(1106752..1107366) | hypothetical protein; SPs1117 | N/A | Click |
6 | 1107458..1107802 | tRNA | N/A | Click |
7 | complement(1107957..1108145) | PHAGE_Strept_2: hypothetical protein SpyM3_0919; SPs1118; phage(gi28876203) | 5e-30 | Click |
8 | complement(1108258..1109040) | PHAGE_Strept_2: streptococcal superantigen SSA; SPs1119; phage(gi28876204) | 7e-152 | Click |
9 | complement(1109253..1110443) | PHAGE_Strept_2: hypothetical protein SpyM3_0921; SPs1120; phage(gi28876205) | 0.0 | Click |
10 | complement(1110515..1111195) | PHAGE_Strept_1: putative cell wall amidase; SPs1121; phage(gi28876196) | 1e-132 | Click |
11 | complement(1111839..1112066) | PHAGE_Strept_1: putative holin; SPs1122; phage(gi28876195) | 5e-35 | Click |
12 | complement(1112063..1112335) | PHAGE_Strept_1: hypothetical protein SpyM3_0729; SPs1123; phage(gi28876194) | 9e-45 | Click |
13 | complement(1112347..1112979) | PHAGE_Strept_1: hypothetical protein SpyM3_0728; SPs1124; phage(gi28876193) | 1e-113 | Click |
14 | complement(1112982..1113410) | PHAGE_Strept_1: hypothetical protein SpyM3_0727; SPs1125; phage(gi28876192) | 9e-76 | Click |
15 | complement(1113422..1115326) | PHAGE_Strept_1: hypothetical protein SpyM3_0726; SPs1126; phage(gi28876191) | 0.0 | Click |
16 | complement(1115336..1116046) | PHAGE_Strept_1: hyaluronidase; SPs1127; phage(gi28876190) | 1e-131 | Click |
17 | complement(1116339..1116956) | PHAGE_Strept_1: putative tail fiber protein; SPs1128; phage(gi28876189) | 2e-113 | Click |
18 | complement(1118387..1119157) | PHAGE_Strept_1: putative tail protein; SPs1129; phage(gi28876188) | 1e-145 | Click |
19 | complement(1119170..1123288) | PHAGE_Strept_1: tail tapemeasure protein; SPs1130; phage(gi28876187) | 0.0 | Click |
20 | complement(1123314..1123430) | PHAGE_Strept_phi3396: hypothetical protein phi3396_44; SPs1131; phage(gi126011106) | 1e-14 | Click |
21 | complement(1123496..1123798) | PHAGE_Strept_1: hypothetical protein SpyM3_0720; SPs1132; phage(gi28876185) | 2e-52 | Click |
22 | complement(1123891..1124475) | PHAGE_Strept_1: putative major tail protein; SPs1133; phage(gi28876184) | 2e-107 | Click |
23 | complement(1124487..1124867) | PHAGE_Strept_1: hypothetical protein SpyM3_0718; SPs1134; phage(gi28876183) | 2e-67 | Click |
24 | complement(1124860..1125258) | PHAGE_Strept_1: hypothetical protein SpyM3_0717; SPs1135; phage(gi28876182) | 5e-72 | Click |
25 | complement(1125260..1125622) | PHAGE_Strept_1: hypothetical protein SpyM3_0716; SPs1136; phage(gi28876181) | 7e-64 | Click |
26 | complement(1125615..1125923) | PHAGE_Strept_1: hypothetical protein SpyM3_0715; SPs1137; phage(gi28876180) | 4e-52 | Click |
27 | complement(1125923..1126096) | PHAGE_Strept_1: hypothetical protein SpyM3_0714; SPs1138; phage(gi28876179) | 3e-26 | Click |
28 | complement(1126110..1127243) | PHAGE_Strept_1: major coat protein; SPs1139; phage(gi28876178) | 0.0 | Click |
29 | complement(1127260..1128066) | PHAGE_Strept_1: head maturation protease; SPs1140; phage(gi28876177) | 5e-152 | Click |
30 | complement(1128047..1129234) | PHAGE_Strept_1: portal protein; SPs1141; phage(gi28876176) | 0.0 | Click |
31 | complement(1129602..1131332) | PHAGE_Strept_1: large terminase subunit; SPs1142; phage(gi28876175) | 0.0 | Click |
32 | complement(1131345..1131662) | PHAGE_Strept_1: hypothetical protein SpyM3_0709; SPs1143; phage(gi28876174) | 2e-53 | Click |
33 | complement(1131803..1132114) | PHAGE_Strept_1: hypothetical protein SpyM3_0708; SPs1144; phage(gi28876173) | 2e-52 | Click |
34 | complement(1132101..1132538) | PHAGE_Strept_1: hypothetical protein SpyM3_0707; SPs1145; phage(gi28876172) | 9e-72 | Click |
35 | complement(1132513..1132716) | PHAGE_Strept_1: hypothetical protein SpyM3_0706; SPs1146; phage(gi28876171) | 5e-38 | Click |
36 | complement(1132774..1133067) | PHAGE_Strept_1: hypothetical protein SpyM3_0705; SPs1147; phage(gi28876170) | 1e-51 | Click |
37 | complement(1133221..1133796) | PHAGE_Strept_1: site-specific recombinase; SPs1148; phage(gi28876169) | 5e-110 | Click |
38 | complement(1133956..1134357) | PHAGE_Strept_1: putative transcriptional activator; SPs1149; phage(gi28876168) | 8e-58 | Click |
39 | complement(1134372..1135235) | PHAGE_Strept_1: hypothetical protein SpyM3_0702; SPs1150; phage(gi28876167) | 3e-149 | Click |
40 | complement(1135201..1135539) | PHAGE_Strept_1: putaive immunity repressor protein; SPs1151; phage(gi28876166) | 8e-62 | Click |
41 | complement(1136500..1137132) | PHAGE_Strept_1: hypothetical protein SpyM3_0697; SPs1152; phage(gi28876162) | 1e-120 | Click |
42 | complement(1137134..1137418) | PHAGE_Strept_1: hypothetical protein SpyM3_0696; SPs1153; phage(gi28876161) | 9e-48 | Click |
43 | complement(1137415..1137876) | PHAGE_Strept_1: hypothetical protein SpyM3_0695; SPs1154; phage(gi28876160) | 5e-82 | Click |
44 | complement(1137866..1138096) | PHAGE_Strept_1: hypothetical protein SpyM3_0694; SPs1155; phage(gi28876159) | 1e-31 | Click |
45 | complement(1138086..1138316) | PHAGE_Strept_1: hypothetical protein SpyM3_0693; SPs1156; phage(gi28876158) | 4e-39 | Click |
46 | complement(1138313..1138891) | PHAGE_Strept_1: Similar to E. coli DnaC protein; SPs1157; phage(gi28876157) | 1e-93 | Click |
47 | 1138944..1139072 | hypothetical protein; SPs1158 | N/A | Click |
48 | complement(1139125..1139961) | PHAGE_Strept_1: hypothetical protein SpyM3_0691; SPs1159; phage(gi28876156) | 7e-144 | Click |
49 | complement(1139879..1141234) | PHAGE_Strept_1: putative DNA polymerase III delta prime subunit; SPs1160; phage(gi28876155) | 0.0 | Click |
50 | complement(1141515..1141706) | PHAGE_Strept_1: hypothetical protein SpyM3_0689; SPs1161; phage(gi28876154) | 1e-28 | Click |
51 | complement(1141799..1142116) | PHAGE_Strept_1: hypothetical protein SpyM3_0688; SPs1162; phage(gi28876153) | 2e-44 | Click |
52 | complement(1142130..1142849) | PHAGE_Strept_1: hypothetical protein SpyM3_0687; SPs1163; phage(gi28876152) | 1e-135 | Click |
53 | 1142891..1143400 | hypothetical protein; SPs1164 | N/A | Click |
54 | complement(1143520..1143654) | PHAGE_Strept_phi3396: hypothetical protein phi3396_07; SPs1165; phage(gi126011069) | 3e-18 | Click |
55 | complement(1143728..1143940) | PHAGE_Strept_1: hypothetical protein SpyM3_0686; SPs1166; phage(gi28876151) | 8e-36 | Click |
56 | complement(1143975..1144250) | PHAGE_Strept_1: hypothetical protein SpyM3_0685; SPs1167; phage(gi28876150) | 4e-46 | Click |
57 | 1144503..1144514 | attR TTTTTTGTCAAT | N/A | Click |
58 | 1144539..1144889 | PHAGE_Strept_1: putative repressor; SPs1168; phage(gi28876149) | 5e-61 | Click |
59 | 1144893..1145285 | PHAGE_Strept_1: hypothetical protein SpyM3_0683; SPs1169; phage(gi28876148) | 2e-73 | Click |
60 | 1145293..1146036 | PHAGE_Strept_1: hypothetical protein SpyM3_0682; SPs1170; phage(gi28876147) | 2e-136 | Click |
61 | complement(1146086..1146214) | hypothetical protein; SPs1171 | N/A | Click |
62 | 1146302..1147543 | PHAGE_Strept_1: putative integrase; SPs1172; phage(gi28876146) | 0.0 | Click |
63 | 1161348..1161359 | attR ATATCAAAAAAG | N/A | Click |