| Definition | Staphylococcus aureus subsp. aureus Mu50, complete genome. |
|---|---|
| Accession | NC_002758 |
| Length | 2,878,529 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 22 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 865041..867413 | PHAGE_Lactoc_Q54: putative ribonuclease; SAV0780; phage(gi115304286) | 3e-97 | Click |
| 2 | 867435..867899 | SsrA-binding protein; SAV0782 | N/A | Click |
| 3 | 867990..868348 | tRNA | N/A | Click |
| 4 | 868335..868349 | attL TCCCGCCGTCTCCAT | N/A | Click |
| 5 | complement(868462..869568) | PHAGE_Bacill_phIS3501: phage integrase; SAV0783; phage(gi422934298) | 1e-79 | Click |
| 6 | complement(869574..870158) | PHAGE_Lactoc_bIL311: repressor; SAV0784; phage(gi13095660) | 3e-15 | Click |
| 7 | 870376..870585 | PHAGE_Lactoc_bIL311: ps3 protein 14-like transcriptional regulator; SAV0785; phage(gi19343481) | 2e-11 | Click |
| 8 | 870621..870848 | PHAGE_Strept_PH15: cro-like protein; SAV0786; phage(gi190151423) | 1e-07 | Click |
| 9 | 870845..870991 | hypothetical protein; SAV0787 | N/A | Click |
| 10 | 870984..871193 | PHAGE_Staphy_PT1028: ORF021; SAV0788; phage(gi66395185) | 3e-32 | Click |
| 11 | 871196..871513 | PHAGE_Staphy_PT1028: ORF016; SAV0789; phage(gi66395180) | 2e-22 | Click |
| 12 | 871580..872449 | PHAGE_Staphy_PT1028: ORF003; SAV0790; phage(gi66395167) | 4e-142 | Click |
| 13 | 872466..873935 | PHAGE_Staphy_3A: ORF002; SAV0791; phage(gi66395590) | 2e-80 | Click |
| 14 | 874137..874583 | PHAGE_Staphy_PT1028: ORF013; SAV0792; phage(gi66395177) | 1e-12 | Click |
| 15 | 874585..874869 | PHAGE_Staphy_StB27: hypothetical protein; SAV0793; phage(gi431809698) | 2e-10 | Click |
| 16 | 874866..875507 | PHAGE_Staphy_PT1028: ORF008; SAV0794; phage(gi66395172) | 5e-107 | Click |
| 17 | 875957..876298 | PHAGE_Staphy_PT1028: ORF015; SAV0795; phage(gi66395179) | 7e-61 | Click |
| 18 | 876310..876888 | PHAGE_Campyl_CP30A: recombination endonuclease; SAV0796; phage(gi410493113) | 3e-05 | Click |
| 19 | 876906..877124 | hypothetical protein; SAV0797 | N/A | Click |
| 20 | 877175..877702 | PHAGE_Staphy_PT1028: ORF010; SAV0798; phage(gi66395174) | 5e-92 | Click |
| 21 | 877669..878046 | PHAGE_Staphy_PT1028: ORF014; SAV0799; phage(gi66395178) | 5e-59 | Click |
| 22 | 878043..878612 | PHAGE_Staphy_PT1028: ORF009; SAV0800; phage(gi66395173) | 5e-105 | Click |
| 23 | 878889..879857 | PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; SAV0801; phage(gi134287370) | 5e-14 | Click |
| 24 | 880082..880276 | PHAGE_Strept_5093: hypothetical protein st5093phage_45; SAV0802; phage(gi238801925) | 9e-05 | Click |
| 25 | 882820..882834 | attR TCCCGCCGTCTCCAT | N/A | Click |
Region 2, total : 69 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 917450..917482 | attL CGTTGTTAAGCCATTCTTGACTTCCGGAAATGG | N/A | Click |
| 2 | complement(917507..918556) | PHAGE_Staphy_phiETA2: integrase; SAV0847; phage(gi122891715) | 0.0 | Click |
| 3 | 918668..918847 | PHAGE_Staphy_phiNM: excisionase; SAV0848; phage(gi118430726) | 7e-27 | Click |
| 4 | complement(918827..919759) | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp03; SAV0849; phage(gi118430727) | 8e-174 | Click |
| 5 | complement(919791..920255) | PHAGE_Staphy_85: ORF030; SAV0850; phage(gi66394898) | 3e-68 | Click |
| 6 | complement(920268..920597) | PHAGE_Staphy_SMSAP5: putative phage regulatory protein; SAV0851; phage(gi422935832) | 4e-58 | Click |
| 7 | 920758..920949 | PHAGE_Staphy_IPLA35: cro; SAV0852; phage(gi215401115) | 2e-30 | Click |
| 8 | complement(921171..921380) | PHAGE_Staphy_phiSLT: hypothetical protein phiSLTp09; SAV0854; phage(gi12719401) | 6e-33 | Click |
| 9 | 921437..922216 | PHAGE_Staphy_47: ORF017; SAV0855; phage(gi66395673) | 1e-134 | Click |
| 10 | 922217..922441 | PHAGE_Staphy_phiMR25: hypothetical protein; SAV0856; phage(gi189427130) | 4e-38 | Click |
| 11 | 922481..922624 | PHAGE_Staphy_71: ORF132; SAV0857; phage(gi66396109) | 1e-19 | Click |
| 12 | complement(922646..923293) | PHAGE_Staphy_EW: ORF020; SAV0858; phage(gi66395827) | 9e-106 | Click |
| 13 | 923364..923585 | PHAGE_Staphy_26: hypothetical protein SAP26_gp37; SAV0859; phage(gi304443275) | 1e-34 | Click |
| 14 | 923832..924134 | PHAGE_Staphy_phiSLT: hypothetical protein phiSLTp14; SAV0860; phage(gi12719406) | 1e-51 | Click |
| 15 | complement(924276..924410) | hypothetical protein; SAV0861 | N/A | Click |
| 16 | 924409..924630 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp13; SAV0862; phage(gi118430737) | 1e-37 | Click |
| 17 | 924623..924745 | PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp14; SAV0863; phage(gi215401184) | 1e-06 | Click |
| 18 | 925247..925672 | PHAGE_Staphy_IPLA88: putative ssDNA binding protein; SAV0864; phage(gi215401185) | 2e-71 | Click |
| 19 | 925683..926234 | PHAGE_Staphy_88: ORF027; SAV0865; phage(gi66396359) | 2e-108 | Click |
| 20 | 926235..926909 | PHAGE_Staphy_85: ORF020; SAV0866; phage(gi66394890) | 6e-130 | Click |
| 21 | complement(927049..927330) | PHAGE_Staphy_CN125: hypothetical protein CURR004; SAV0867; phage(gi239507426) | 2e-51 | Click |
| 22 | 927395..928126 | PHAGE_Staphy_85: ORF017; SAV0868; phage(gi66394887) | 3e-70 | Click |
| 23 | 928139..928924 | PHAGE_Staphy_55: ORF016; SAV0869; phage(gi66396129) | 4e-150 | Click |
| 24 | 928921..929079 | PHAGE_Staphy_CN125: hypothetical protein CUR021; SAV0870; phage(gi239507382) | 2e-22 | Click |
| 25 | 929092..929313 | PHAGE_Staphy_phiSLT: hypothetical protein phiSLTp23; SAV0871; phage(gi12719415) | 2e-37 | Click |
| 26 | 929323..929727 | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp23; SAV0872; phage(gi156604040) | 2e-75 | Click |
| 27 | 929919..930290 | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp24; SAV0873; phage(gi156604041) | 1e-68 | Click |
| 28 | 930291..930539 | PHAGE_Staphy_phiPV83: phi PVL ORF 51 homologue; SAV0874; phage(gi9635703) | 3e-43 | Click |
| 29 | 930551..930802 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp30; SAV0875; phage(gi118430754) | 1e-38 | Click |
| 30 | 930795..931331 | PHAGE_Staphy_55: ORF023; SAV0876; phage(gi66396136) | 4e-99 | Click |
| 31 | 931368..931574 | PHAGE_Staphy_69: ORF072; SAV0877; phage(gi66395349) | 3e-33 | Click |
| 32 | 931571..931765 | PHAGE_Staphy_phiMR25: hypothetical protein; SAV0878; phage(gi189427158) | 1e-30 | Click |
| 33 | 931762..931965 | PHAGE_Staphy_77: 77ORF072; SAV0879; phage(gi41189571) | 3e-33 | Click |
| 34 | 931958..932194 | PHAGE_Staphy_69: ORF061; SAV0880; phage(gi66395342) | 2e-40 | Click |
| 35 | 932184..932570 | PHAGE_Staphy_96: ORF037; SAV0881; phage(gi66395922) | 3e-68 | Click |
| 36 | 932570..932743 | PHAGE_Staphy_96: ORF105; SAV0882; phage(gi66395960) | 5e-25 | Click |
| 37 | 932801..932890 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp35; SAV0883; phage(gi118430759) | 1e-08 | Click |
| 38 | 932905..933324 | PHAGE_Staphy_phiNM: transcriptional activator RinA; SAV0884; phage(gi118430760) | 1e-20 | Click |
| 39 | 933511..933951 | PHAGE_Staphy_TEM123: phage terminase small subunit; SAV0885; phage(gi388570350) | 1e-77 | Click |
| 40 | 933938..935215 | PHAGE_Staphy_phiNM: phage terminase large subunit; SAV0886; phage(gi118430762) | 0.0 | Click |
| 41 | 935226..936761 | PHAGE_Staphy_phiNM: phage portal protein; SAV0887; phage(gi118430763) | 0.0 | Click |
| 42 | 936768..937763 | PHAGE_Staphy_phiNM: phage head morphogenesis protein; SAV0888; phage(gi118430764) | 0.0 | Click |
| 43 | 937836..938006 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp41; SAV0889; phage(gi118430765) | 4e-25 | Click |
| 44 | 938141..938755 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp42; SAV0890; phage(gi118430766) | 2e-109 | Click |
| 45 | 938769..939077 | PHAGE_Staphy_phiNM: head protein; SAV0891; phage(gi118430767) | 2e-49 | Click |
| 46 | 939209..939742 | PHAGE_Staphy_phiNM: head protein; SAV0892; phage(gi118430767) | 6e-96 | Click |
| 47 | 939764..940051 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp44; SAV0893; phage(gi118430768) | 8e-49 | Click |
| 48 | 940060..940392 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp45; SAV0894; phage(gi118430769) | 3e-57 | Click |
| 49 | 940389..940691 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp46; SAV0895; phage(gi118430770) | 9e-53 | Click |
| 50 | 940691..941038 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp47; SAV0896; phage(gi118430771) | 1e-62 | Click |
| 51 | 941050..941433 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp48; SAV0897; phage(gi118430772) | 2e-71 | Click |
| 52 | 941452..942033 | PHAGE_Staphy_phiNM: major tail protein; SAV0898; phage(gi118430773) | 1e-109 | Click |
| 53 | 942095..942460 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp50; SAV0899; phage(gi118430774) | 6e-62 | Click |
| 54 | 942580..942834 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp51; SAV0900; phage(gi118430775) | 1e-43 | Click |
| 55 | 942851..946315 | PHAGE_Staphy_phiNM: phage tape measure protein; SAV0901; phage(gi118430776) | 0.0 | Click |
| 56 | 946328..947275 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp53; SAV0902; phage(gi118430777) | 0.0 | Click |
| 57 | 947284..949185 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp54; SAV0903; phage(gi118430778) | 0.0 | Click |
| 58 | 949200..951110 | PHAGE_Staphy_phiNM: hypothetical protein SAPPV1_gp55; SAV0904; phage(gi118430779) | 0.0 | Click |
| 59 | 951110..952933 | PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp60; SAV0905; phage(gi122891774) | 0.0 | Click |
| 60 | 952933..953310 | PHAGE_Staphy_phiETA: hypothetical protein phiETA_58; SAV0906; phage(gi17426286) | 1e-65 | Click |
| 61 | 953314..953487 | PHAGE_Staphy_phiETA: similar to phage phi105 ORF44; SAV0907; phage(gi17426287) | 2e-29 | Click |
| 62 | 953528..953827 | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAV0908; phage(gi448244681) | 2e-52 | Click |
| 63 | 953964..955862 | PHAGE_Staphy_phiNM: cell wall hydrolase; SAV0909; phage(gi118430784) | 0.0 | Click |
| 64 | 955875..957113 | PHAGE_Staphy_26: tail fiber; SAV0910; phage(gi304443261) | 0.0 | Click |
| 65 | 957119..957514 | PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp66; SAV0911; phage(gi122891780) | 1e-70 | Click |
| 66 | 957570..958007 | PHAGE_Staphy_11: holin; SAV0912; phage(gi29028615) | 3e-78 | Click |
| 67 | 957988..959433 | PHAGE_Staphy_phiMR11: endolysin; SAV0913; phage(gi162290173) | 0.0 | Click |
| 68 | 959700..959828 | hypothetical protein; SAV0914 | N/A | Click |
| 69 | 959899..960009 | PHAGE_Staphy_55: ORF187; SAV0915; phage(gi66396189) | 2e-14 | Click |
| 70 | 960529..961161 | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; SAV0916; phage(gi399498806) | 3e-09 | Click |
| 71 | 961930..961962 | attR CGTTGTTAAGCCATTCTTGACTTCCGGAAATGG | N/A | Click |
Region 3, total : 65 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2082980..2082991 | attL AAGTTGCAACAC | N/A | Click |
| 2 | 2083515..2083694 | PHAGE_Staphy_phiN315: hypothetical protein SAS058; SAV1940; phage(gi30043926) | 6e-28 | Click |
| 3 | 2083718..2084026 | PHAGE_Staphy_phiN315: hypothetical protein SA1753; SAV1941; phage(gi30043927) | 3e-49 | Click |
| 4 | complement(2084317..2084667) | PHAGE_Staphy_phiN315: hypothetical protein SA1754; SAV1942; phage(gi30043928) | 4e-58 | Click |
| 5 | complement(2086164..2086655) | PHAGE_Staphy_phiN315: STAPHYLOKINASE PRECURSOR; SAV1944; phage(gi30043932) | 2e-89 | Click |
| 6 | complement(2086870..2087601) | PHAGE_Staphy_3: amidase; SAV1945; phage(gi156604072) | 2e-147 | Click |
| 7 | complement(2087613..2087867) | PHAGE_Staphy_phiN315: holin homolog; SAV1946; phage(gi30043934) | 3e-43 | Click |
| 8 | complement(2088079..2088213) | PHAGE_Staphy_phiN315: hypothetical protein SAS059; SAV1947; phage(gi30043935) | 2e-16 | Click |
| 9 | complement(2088364..2089146) | PHAGE_Staphy_phiN315: enterotoxin P; SAV1948; phage(gi30043936) | 2e-115 | Click |
| 10 | 2089230..2089469 | hypothetical protein; SAV1949 | N/A | Click |
| 11 | complement(2089510..2089884) | PHAGE_Staphy_phiN315: hypothetical protein SA1762; SAV1950; phage(gi30043938) | 6e-65 | Click |
| 12 | complement(2089940..2090269) | PHAGE_Staphy_phiN315: hypothetical protein SA1763; SAV1951; phage(gi30043939) | 2e-55 | Click |
| 13 | complement(2090273..2090425) | PHAGE_Staphy_phiN315: hypothetical protein SAS061; SAV1952; phage(gi30043940) | 2e-22 | Click |
| 14 | complement(2090418..2094200) | PHAGE_Staphy_phiN315: hypothetical protein SA1764; SAV1953; phage(gi30043941) | 0.0 | Click |
| 15 | complement(2094216..2095700) | PHAGE_Staphy_phiN315: hypothetical protein SA1765; SAV1954; phage(gi30043942) | 0.0 | Click |
| 16 | complement(2095697..2100226) | PHAGE_Staphy_phiN315: hypothetical protein SA1766; SAV1955; phage(gi30043943) | 0.0 | Click |
| 17 | complement(2100471..2100821) | PHAGE_Staphy_phiN315: hypothetical protein SA1767; SAV1956; phage(gi30043944) | 1e-61 | Click |
| 18 | complement(2101137..2101781) | PHAGE_Staphy_phiN315: hypothetical protein SA1768; SAV1957; phage(gi30043945) | 8e-121 | Click |
| 19 | complement(2101782..2102189) | PHAGE_Staphy_phiN315: hypothetical protein SA1769; SAV1958; phage(gi30043946) | 8e-76 | Click |
| 20 | complement(2102186..2102590) | PHAGE_Staphy_phiN315: hypothetical protein SA1770; SAV1959; phage(gi30043947) | 1e-71 | Click |
| 21 | complement(2102587..2102949) | PHAGE_Staphy_phiN315: hypothetical protein SA1771; SAV1960; phage(gi30043948) | 2e-67 | Click |
| 22 | complement(2102933..2103217) | PHAGE_Staphy_phiN315: hypothetical protein SA1772; SAV1961; phage(gi30043949) | 2e-48 | Click |
| 23 | complement(2103207..2103491) | PHAGE_Staphy_phiN315: hypothetical protein SA1773; SAV1962; phage(gi30043950) | 4e-49 | Click |
| 24 | complement(2103511..2104656) | PHAGE_Staphy_phiN315: hypothetical protein SA1774; SAV1963; phage(gi30043951) | 0.0 | Click |
| 25 | complement(2104680..2105417) | PHAGE_Staphy_phiN315: hypothetical protein, similar to scaffolding protein; SAV1964; phage(gi30043952) | 3e-134 | Click |
| 26 | complement(2105401..2106588) | PHAGE_Staphy_phiN315: hypothetical protein SA1776; SAV1965; phage(gi30043953) | 0.0 | Click |
| 27 | complement(2106604..2108265) | PHAGE_Staphy_phiN315: hypothetical protein SA1777; SAV1966; phage(gi30043954) | 0.0 | Click |
| 28 | complement(2108262..2108606) | PHAGE_Staphy_phiN315: hypothetical protein SA1778; SAV1967; phage(gi30043955) | 3e-60 | Click |
| 29 | complement(2108736..2109035) | PHAGE_Staphy_phiN315: hypothetical protein SA1779; SAV1968; phage(gi30043956) | 1e-55 | Click |
| 30 | complement(2109267..2109683) | PHAGE_Staphy_phiN315: hypothetical protein SA1780; SAV1969; phage(gi30043957) | 6e-79 | Click |
| 31 | complement(2109711..2109914) | PHAGE_Staphy_77: 77ORF071; SAV1970; phage(gi41189570) | 4e-32 | Click |
| 32 | complement(2109919..2110071) | PHAGE_Staphy_phiN315: hypothetical protein SAS062; SAV1971; phage(gi30043959) | 4e-14 | Click |
| 33 | complement(2110059..2110265) | PHAGE_Staphy_phiN315: hypothetical protein SA1782; SAV1972; phage(gi30043960) | 3e-31 | Click |
| 34 | complement(2110282..2110455) | PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp35; SAV1973; phage(gi122891749) | 5e-27 | Click |
| 35 | complement(2110492..2111061) | PHAGE_Staphy_3A: ORF020; SAV1974; phage(gi66395608) | 1e-93 | Click |
| 36 | complement(2111018..2111260) | hypothetical protein; SAV1975 | N/A | Click |
| 37 | complement(2111250..2111486) | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp30; SAV1976; phage(gi156603979) | 2e-21 | Click |
| 38 | complement(2111479..2111844) | PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp29; SAV1977; phage(gi119443681) | 7e-64 | Click |
| 39 | complement(2111859..2112101) | PHAGE_Staphy_12: PVL orf 51-like protein; SAV1978; phage(gi29028634) | 3e-42 | Click |
| 40 | complement(2112105..2112473) | PHAGE_Staphy_TEM123: PVL phage protein; SAV1979; phage(gi388570356) | 6e-65 | Click |
| 41 | complement(2112486..2112902) | PHAGE_Staphy_phiN315: hypothetical protein SA1789; SAV1980; phage(gi30043967) | 6e-61 | Click |
| 42 | complement(2112899..2113117) | PHAGE_Staphy_phiN315: hypothetical protein SA1790; SAV1981; phage(gi30043968) | 1e-37 | Click |
| 43 | complement(2113124..2114017) | PHAGE_Staphy_phiN315: hypothetical protein SA1791; SAV1982; phage(gi30043969) | 4e-174 | Click |
| 44 | complement(2114047..2114517) | PHAGE_Staphy_phiN315: single-strand DNA-binding protein; SAV1983; phage(gi30043970) | 5e-84 | Click |
| 45 | complement(2114518..2115003) | PHAGE_Staphy_phiN315: hypothetical protein SA1793; SAV1984; phage(gi30043971) | 1e-87 | Click |
| 46 | complement(2115216..2116136) | PHAGE_Staphy_phiN315: hypothetical protein SA1794; SAV1985; phage(gi30043972) | 4e-92 | Click |
| 47 | complement(2116138..2118081) | PHAGE_Staphy_phiN315: hypothetical protein SA1795; SAV1986; phage(gi30043973) | 0.0 | Click |
| 48 | complement(2118090..2118353) | PHAGE_Staphy_phiN315: hypothetical protein SA1796; SAV1987; phage(gi30043974) | 4e-46 | Click |
| 49 | complement(2118362..2118622) | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAV1988; phage(gi431810254) | 3e-42 | Click |
| 50 | complement(2118627..2118929) | PHAGE_Staphy_phiN315: hypothetical protein SA1798; SAV1989; phage(gi30043976) | 2e-30 | Click |
| 51 | complement(2119019..2119180) | PHAGE_Staphy_P954: hypothetical protein; SAV1990; phage(gi257136370) | 9e-22 | Click |
| 52 | complement(2119177..2119497) | PHAGE_Staphy_phiN315: hypothetical protein SA1799; SAV1991; phage(gi30043978) | 3e-54 | Click |
| 53 | 2119549..2120184 | PHAGE_Staphy_1: hypothetical protein SPTP3101_gp09; SAV1992; phage(gi156603898) | 3e-117 | Click |
| 54 | complement(2120370..2120567) | PHAGE_Staphy_phiN315: hypothetical protein SAS064; SAV1993; phage(gi30043980) | 1e-32 | Click |
| 55 | complement(2120583..2121338) | PHAGE_Staphy_phiN315: anti repressor; SAV1994; phage(gi30043981) | 9e-124 | Click |
| 56 | 2121395..2121934 | PHAGE_Staphy_1: hypothetical protein SPTP3101_gp06; SAV1995; phage(gi156603895) | 2e-101 | Click |
| 57 | complement(2121958..2122218) | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp05; SAV1996; phage(gi156604022) | 5e-43 | Click |
| 58 | complement(2122232..2122474) | PHAGE_Staphy_phiETA: similar to phage O1205 ORF5; SAV1997; phage(gi17426235) | 2e-41 | Click |
| 59 | 2122626..2123354 | PHAGE_Staphy_phiN315: similar to repressor; SAV1998; phage(gi30043985) | 4e-87 | Click |
| 60 | 2123366..2124223 | PHAGE_Staphy_P954: hypothetical protein; SAV1999; phage(gi257136360) | 5e-129 | Click |
| 61 | 2124268..2124450 | PHAGE_Staphy_phiN315: hypothetical protein SA1807; SAV2000; phage(gi30043987) | 5e-29 | Click |
| 62 | 2124550..2125014 | PHAGE_Staphy_phiNM3: putative lipoprotein; SAV2001; phage(gi118725055) | 3e-83 | Click |
| 63 | 2124707..2124718 | attR AAGTTGCAACAC | N/A | Click |
| 64 | 2125073..2126110 | PHAGE_Staphy_phiN315: integrase; SAV2002; phage(gi30043990) | 0.0 | Click |
| 65 | 2126122..2126991 | truncated beta-hemolysin; SAV2003 | N/A | Click |
| 66 | complement(2127229..2128245) | PHAGE_Staphy_phiPV83: LukF-PV(P83) precursor; SAV2004; phage(gi9635737) | 2e-58 | Click |
| 67 | complement(2128267..2129322) | PHAGE_Staphy_phiPV83: LukM precursor; SAV2005; phage(gi9635736) | 3e-44 | Click |
Region 4, total : 24 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2124922..2124934 | attL ATTGAAGAGCTTT | N/A | Click |
| 2 | 2133592..2134314 | PHAGE_Staphy_phiNM3: enterotoxin type A precursor; SAV2008; phage(gi118725111) | 6e-30 | Click |
| 3 | complement(2134483..2135283) | PHAGE_Strept_2: streptococcal superantigen SSA; SAV2009; phage(gi28876204) | 2e-85 | Click |
| 4 | 2136070..2136630 | PHAGE_Staphy_71: ORF024; SAV2010; phage(gi66396064) | 5e-69 | Click |
| 5 | 2137509..2138213 | toxic shock syndrome toxin-1; SAV2011 | N/A | Click |
| 6 | complement(2138368..2138937) | PHAGE_Staphy_PT1028: ORF009; SAV2012; phage(gi66395173) | 2e-104 | Click |
| 7 | complement(2138934..2139146) | PHAGE_Staphy_PT1028: ORF014; SAV2013; phage(gi66395178) | 9e-35 | Click |
| 8 | complement(2139277..2139804) | PHAGE_Staphy_PT1028: ORF010; SAV2015; phage(gi66395174) | 5e-92 | Click |
| 9 | complement(2139855..2140073) | hypothetical protein; SAV2016 | N/A | Click |
| 10 | complement(2140091..2140669) | PHAGE_Campyl_CP30A: recombination endonuclease; SAV2017; phage(gi410493113) | 3e-05 | Click |
| 11 | complement(2140681..2141022) | PHAGE_Staphy_PT1028: ORF015; SAV2018; phage(gi66395179) | 7e-61 | Click |
| 12 | complement(2141470..2142111) | PHAGE_Staphy_PT1028: ORF008; SAV2019; phage(gi66395172) | 3e-113 | Click |
| 13 | complement(2142108..2142488) | PHAGE_Staphy_PT1028: ORF013; SAV2020; phage(gi66395177) | 5e-70 | Click |
| 14 | complement(2142798..2144507) | PHAGE_Staphy_PT1028: ORF001; SAV2021; phage(gi66395165) | 0.0 | Click |
| 15 | complement(2144521..2145390) | PHAGE_Staphy_PT1028: ORF003; SAV2022; phage(gi66395167) | 2e-165 | Click |
| 16 | complement(2145455..2145781) | PHAGE_Staphy_PT1028: ORF016; SAV2023; phage(gi66395180) | 9e-53 | Click |
| 17 | complement(2145784..2145993) | PHAGE_Staphy_PT1028: ORF021; SAV2024; phage(gi66395185) | 1e-32 | Click |
| 18 | complement(2146129..2146446) | hypothetical protein; SAV2025 | N/A | Click |
| 19 | complement(2146451..2146669) | PHAGE_Mycoba_Pacc40: gp43; SAV2026; phage(gi206600122) | 7e-05 | Click |
| 20 | 2146842..2147516 | PHAGE_Lactoc_lato: hypothetical protein P335p08; SAV2027; phage(gi30089869) | 2e-10 | Click |
| 21 | 2147412..2147424 | attR ATTGAAGAGCTTT | N/A | Click |
| 22 | 2147530..2148702 | PROPHAGE_Oceano_HTE831: integrase; SAV2028; phage(gi23097608) | 8e-42 | Click |
| 23 | complement(2148771..2150387) | PHAGE_Halocy_JM_2012: chaperonin GroEL; SAV2029; phage(gi389060206) | 6e-67 | Click |
| 24 | complement(2150463..2150747) | PHAGE_Bacill_36: GroES; SAV2030; phage(gi156564025) | 5e-16 | Click |
| 25 | 2150922..2151665 | hypothetical protein; SAV2031 | N/A | Click |
| 26 | complement(2151690..2152937) | PHAGE_Cafete_BV_PW1: hypothetical protein; SAV2032; phage(gi310831380) | 8e-23 | Click |