The gene/protein map for NC_000913 is currently unavailable.

Definition Streptococcus pyogenes M1 GAS chromosome, complete genome.
Accession NC_002737
Length 1,852,441
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 48 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 529591..529606  attL    CATGTACAACTATACT  N/A  Click
2 complement(529631..531046)  PHAGE_Lister_A118: putative integrase; SPy_0655; phage(gi16798814)  1e-45  Click
3 complement(531167..531532)  PHAGE_Strept_O1205: hypothetical protein O1205p02; SPy_0656; phage(gi23455850)  2e-17  Click
4 complement(531559..532320)  PHAGE_Lactob_Sha1: bifunctional S24 family peptidase/transcriptional regulator; SPy_0657; phage(gi418489831)  4e-30  Click
5 532504..532734  PHAGE_Lactoc_bIL286: repressor; SPy_0658; phage(gi13095748)  7e-21  Click
6 532803..532940  hypothetical protein; SPy_0659  N/A  Click
7 532942..533067  hypothetical protein; SPy_0660  N/A  Click
8 533064..533291  hypothetical protein; SPy_0661  N/A  Click
9 533291..534610  PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp13; SPy_0663; phage(gi56694881)  2e-160  Click
10 534625..535716  PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp14; SPy_0664; phage(gi56694882)  1e-103  Click
11 535756..536178  PHAGE_Strept_MM1: hypothetical protein MM1p17; SPy_0665; phage(gi15088759)  2e-40  Click
12 536180..536914  PHAGE_Strept_MM1: hypothetical protein MM1p18; SPy_0666; phage(gi15088760)  4e-79  Click
13 536936..537571  PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp15; SPy_0667; phage(gi56694883)  7e-31  Click
14 537571..539154  PHAGE_Bacill_BCJA1c: DEAD box family helicase; SPy_0669; phage(gi56694884)  0.0  Click
15 539164..539793  PHAGE_Clostr_phiCP26F: hypothetical protein; SPy_0670; phage(gi422933952)  3e-41  Click
16 539783..542056  PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp22; SPy_0671; phage(gi56694890)  0.0  Click
17 542334..542552  PHAGE_Strept_MM1: hypothetical protein MM1p19; SPy_0672; phage(gi15088761)  1e-19  Click
18 542545..542940  PHAGE_Bacill_BCJA1c: rus; SPy_0673; phage(gi56694892)  2e-46  Click
19 542937..543158  PHAGE_Bacill_BCJA1c: hypothetical protein BCBBV1cgp25; SPy_0674; phage(gi56694893)  5e-06  Click
20 543435..544070  PHAGE_Strept_2: hypothetical protein SpyM3_0951; SPy_0676; phage(gi28876235)  3e-113  Click
21 544343..544777  PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPy_0677; phage(gi16271798)  5e-57  Click
22 545087..546253  PHAGE_Temper_1: hypothetical protein phiNIH1.1_23; SPy_0679; phage(gi16271799)  1e-62  Click
23 546596..547072  PHAGE_Temper_1: hypothetical protein phiNIH1.1_26; SPy_0680; phage(gi16271802)  2e-53  Click
24 547155..548366  PHAGE_Temper_1: terminase large subunit; SPy_0681; phage(gi16271803)  0.0  Click
25 548380..549882  PHAGE_Temper_1: minor capsid protein; SPy_0682; phage(gi16271804)  0.0  Click
26 549887..551380  PHAGE_Temper_1: minor capsid protein; SPy_0683; phage(gi16271805)  0.0  Click
27 551380..551607  hypothetical protein; SPy_0684  N/A  Click
28 551694..551960  PHAGE_Temper_1: hypothetical protein phiNIH1.1_31; SPy_0685; phage(gi16271807)  2e-41  Click
29 552086..552700  PHAGE_Temper_1: hypothetical protein phiNIH1.1_32; SPy_0686; phage(gi16271808)  7e-110  Click
30 552704..553522  PHAGE_Temper_1: major capsid protein; SPy_0688; phage(gi16271809)  3e-150  Click
31 553576..553992  PHAGE_Temper_1: hypothetical protein phiNIH1.1_34; SPy_0689; phage(gi16271810)  4e-58  Click
32 553982..554314  PHAGE_Temper_1: minor capsid protein; SPy_0690; phage(gi16271811)  2e-60  Click
33 554314..554670  PHAGE_Temper_1: minor capsid protein; SPy_0691; phage(gi16271812)  4e-65  Click
34 554667..555065  PHAGE_Temper_1: minor capsid protein; SPy_0693; phage(gi16271813)  2e-72  Click
35 555065..555460  PHAGE_Temper_1: tail protein; SPy_0694; phage(gi16271814)  1e-71  Click
36 555589..556023  PHAGE_Temper_1: hypothetical protein phiNIH1.1_39; SPy_0695; phage(gi16271815)  3e-76  Click
37 556027..556608  PHAGE_Temper_1: hypothetical protein phiNIH1.1_40; SPy_0696; phage(gi16271816)  6e-108  Click
38 556598..559858  PHAGE_Temper_1: tail protein; SPy_0697; phage(gi16271817)  0.0  Click
39 559855..560571  PHAGE_Temper_1: hypothetical protein phiNIH1.1_42; SPy_0698; phage(gi16271818)  3e-137  Click
40 560568..562712  PHAGE_Temper_1: hypothetical protein phiNIH1.1_43; SPy_0700; phage(gi16271819)  0.0  Click
41 562709..563722  PHAGE_Temper_1: hyaluronidase; SPy_0701; phage(gi16271820)  0.0  Click
42 563737..565623  PHAGE_Temper_1: hypothetical protein phiNIH1.1_45; SPy_0702; phage(gi16271821)  0.0  Click
43 565635..566066  PHAGE_Temper_1: hypothetical protein phiNIH1.1_46; SPy_0703; phage(gi16271822)  2e-69  Click
44 566069..566686  PHAGE_Temper_1: hypothetical protein phiNIH1.1_47; SPy_0705; phage(gi16271823)  1e-98  Click
45 566696..566971  PHAGE_Strept_2: hypothetical protein SpyM3_0924; SPy_0706; phage(gi28876208)  2e-45  Click
46 566968..567195  PHAGE_Strept_2: putative holin; SPy_0707; phage(gi28876207)  4e-35  Click
47 567311..568513  PHAGE_Temper_1: cell wall hydrolase; SPy_0710; phage(gi16271826)  0.0  Click
48 complement(568581..569288)  PHAGE_Temper_1: SpeL; SPy_0711; phage(gi16271829)  3e-13  Click
49 complement(569399..570157)  PHAGE_Strept_3: putative mitogenic factor; SPy_0712; phage(gi28876265)  2e-08  Click
50 570494..570509  attR    CATGTACAACTATACT  N/A  Click
Region 2, total : 60 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 775802..776671  PHAGE_Escher_phAPEC8: putative glucose-1-phosphate thymidylyltransferase; SPy_0933; phage(gi448260372)  4e-102  Click
2 776671..777264  PHAGE_Sphing_PAU: gp186; SPy_0935; phage(gi435844689)  2e-08  Click
3 777508..778548  PHAGE_Escher_phAPEC8: putative dTDP-glucose 4,6-dehydratase; SPy_0936; phage(gi448260373)  8e-69  Click
4 778526..778576  attL    AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG  N/A  Click
5 complement(778642..779781)  PHAGE_Strept_SMP: integrase; SPy_0937; phage(gi119953753)  4e-123  Click
6 complement(780035..780844)  PHAGE_Staphy_PT1028: ORF005; SPy_0938; phage(gi66395169)  1e-25  Click
7 complement(780857..781603)  PHAGE_Strept_PH15: putative transcriptional repressor; SPy_0939; phage(gi190151419)  8e-56  Click
8 781793..781951  PHAGE_Strept_2: hypothetical protein SpyM3_0976; SPy_0940; phage(gi28876260)  7e-19  Click
9 complement(782130..782969)  PHAGE_Staphy_phiPVL108: hypothetical protein SABPV108_gp21; SPy_0942; phage(gi119443673)  7e-17  Click
10 783029..783169  hypothetical protein; SPy_0943  N/A  Click
11 complement(783087..783314)  hypothetical protein; SPy_0944  N/A  Click
12 783388..783594  hypothetical protein; SPy_0945  N/A  Click
13 783634..784362  PHAGE_Temper_1: antirepressor; SPy_0946; phage(gi16271781)  3e-115  Click
14 784394..784660  hypothetical protein; SPy_0947  N/A  Click
15 complement(784595..785401)  hypothetical protein; SPy_0948  N/A  Click
16 complement(785543..785779)  PHAGE_Strept_2: hypothetical protein SpyM3_0968; SPy_0949; phage(gi28876252)  7e-34  Click
17 786231..786416  PHAGE_Temper_1: hypothetical protein phiNIH1.1_07; SPy_0952; phage(gi16271783)  5e-25  Click
18 786899..787285  PHAGE_Temper_1: hypothetical protein phiNIH1.1_08; SPy_0953; phage(gi16271784)  4e-38  Click
19 787266..787499  PHAGE_Temper_1: hypothetical protein phiNIH1.1_09; SPy_0954; phage(gi16271785)  3e-38  Click
20 787645..787851  PHAGE_Strept_3: hypothetical protein SpyM3_1137; SPy_0956; phage(gi28876307)  8e-31  Click
21 787907..788236  PHAGE_Strept_3: hypothetical protein SpyM3_1136; SPy_0957; phage(gi28876306)  3e-25  Click
22 788239..789030  PHAGE_Lister_B054: gp50; SPy_0958; phage(gi157325334)  1e-41  Click
23 789040..789705  PHAGE_Strept_M102: hypothetical protein M102_gp28; SPy_0959; phage(gi242345599)  2e-63  Click
24 789709..790068  PHAGE_Strept_M102: hypothetical protein M102_gp28; SPy_0960; phage(gi242345599)  1e-14  Click
25 790264..790602  PHAGE_Strept_3: hypothetical protein SpyM3_1129; SPy_0961; phage(gi28876299)  5e-11  Click
26 790599..791111  PHAGE_Strept_1: hypothetical protein EJ-1p24; SPy_0962; phage(gi39653698)  3e-66  Click
27 791288..791533  PHAGE_Temper_1: hypothetical protein phiNIH1.1_19; SPy_0963; phage(gi16271795)  4e-23  Click
28 791585..792046  PHAGE_Temper_1: hypothetical protein phiNIH1.1_21; SPy_0965; phage(gi16271797)  2e-46  Click
29 792496..792936  PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPy_0967; phage(gi16271798)  1e-80  Click
30 793251..794165  hypothetical protein; SPy_0968  N/A  Click
31 794184..794645  hypothetical protein; SPy_0970  N/A  Click
32 794673..795155  PHAGE_Staphy_phiETA2: small terminase; SPy_0971; phage(gi122891755)  7e-20  Click
33 795133..796422  PHAGE_Strept_SMP: terminase large subunit; SPy_0972; phage(gi119953777)  0.0  Click
34 797917..799542  PHAGE_Strept_2972: head protein; SPy_0975; phage(gi66391765)  3e-61  Click
35 799533..799712  hypothetical protein; SPy_0976  N/A  Click
36 799772..800041  PHAGE_Temper_1: hypothetical protein phiNIH1.1_31; SPy_0977; phage(gi16271807)  1e-29  Click
37 800131..800301  hypothetical protein; SPy_0978  N/A  Click
38 800430..800678  hypothetical protein; SPy_0979  N/A  Click
39 800680..801426  PHAGE_Lactoc_bIL309: anti-repressor; SPy_0980; phage(gi13095813)  3e-60  Click
40 801538..802071  PHAGE_Staphy_IPLA88: putative scaffold protein; SPy_0981; phage(gi215401211)  4e-21  Click
41 802081..802461  PHAGE_Strept_2: capsid; SPy_0982; phage(gi273809733)  1e-11  Click
42 802464..803513  PHAGE_Strept_2: capsid; SPy_0984; phage(gi273809734)  7e-110  Click
43 803525..803791  PHAGE_Bacill_1: hypothetical protein BV1_gp22; SPy_0985; phage(gi155042937)  1e-06  Click
44 803803..804156  PHAGE_Strept_Sfi11: gp113; SPy_0986; phage(gi9635017)  1e-25  Click
45 804153..804461  PHAGE_Lactoc_Tuc2009: hypothetical protein Tuc2009_40; SPy_0987; phage(gi13487841)  1e-10  Click
46 804442..804807  PHAGE_Entero_phiEf11: phage protein HK97; SPy_0988; phage(gi282598738)  6e-20  Click
47 804804..805193  PHAGE_Lactoc_Tuc2009: major structural protein 2; SPy_0989; phage(gi13487843)  6e-47  Click
48 805290..805856  PHAGE_Entero_phiEf11: phage major tail protein; SPy_0991; phage(gi282598708)  2e-42  Click
49 805916..806269  PHAGE_Entero_phiEf11: putative phage protein; SPy_0992; phage(gi282598743)  9e-24  Click
50 806311..806640  PHAGE_Entero_phiEf11: putative phage protein; SPy_0993; phage(gi282598753)  4e-11  Click
51 806655..810290  PHAGE_Strept_Sfi11: putative minor tail protein; SPy_0994; phage(gi9635024)  0.0  Click
52 810323..811102  PHAGE_Strept_1: putative tail protein; SPy_0995; phage(gi28876188)  2e-68  Click
53 811099..813147  PHAGE_Temper_1: hypothetical protein phiNIH1.1_43; SPy_0996; phage(gi16271819)  6e-110  Click
54 813147..814265  PHAGE_Temper_1: hyaluronidase; SPy_0997; phage(gi16271820)  2e-134  Click
55 814278..816188  PHAGE_Temper_1: hypothetical protein phiNIH1.1_45; SPy_0998; phage(gi16271821)  0.0  Click
56 816202..816363  hypothetical protein; SPy_0999  N/A  Click
57 816366..816977  PHAGE_Temper_1: hypothetical protein phiNIH1.1_47; SPy_1001; phage(gi16271823)  3e-103  Click
58 816988..817284  PHAGE_Temper_1: hypothetical protein phiNIH1.1_48; SPy_1002; phage(gi16271824)  7e-50  Click
59 817578..818912  PHAGE_Strept_M102: hypothetical protein M102_gp19; SPy_1006; phage(gi242345590)  1e-69  Click
60 819186..819863  PHAGE_Staphy_phiN315: enterotoxin P; SPy_1007; phage(gi30043936)  2e-28  Click
61 819889..820599  PHAGE_Staphy_phiNM3: enterotoxin type A precursor; SPy_1008; phage(gi118725111)  8e-18  Click
62 820960..821010  attR    AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAACG  N/A  Click
Region 3, total : 50 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1182568..1182579  attL    AACTAACAAAAA  N/A  Click
2 complement(1186921..1188783)  PHAGE_Parame_AR158: hypothetical protein AR158_C785L; SPy_1434; phage(gi157953975)  1e-30  Click
3 1189728..1190534  PHAGE_Strept_3: putative mitogenic factor; SPy_1436; phage(gi28876265)  9e-06  Click
4 1190754..1191239  hypothetical protein; SPy_1437  N/A  Click
5 complement(1191309..1192514)  PHAGE_Strept_2: putative cell wall hydrolase; SPy_1438; phage(gi28876206)  0.0  Click
6 complement(1192630..1192857)  PHAGE_Strept_6: putative holin; SPy_1440; phage(gi28876443)  4e-35  Click
7 complement(1192854..1193129)  PHAGE_Strept_2: hypothetical protein SpyM3_0924; SPy_1441; phage(gi28876208)  2e-45  Click
8 complement(1193139..1193756)  PHAGE_Strept_2: hypothetical protein SpyM3_0925; SPy_1442; phage(gi28876209)  1e-109  Click
9 complement(1193759..1194190)  PHAGE_Temper_1: hypothetical protein phiNIH1.1_46; SPy_1443; phage(gi16271822)  5e-75  Click
10 complement(1194202..1195986)  PHAGE_Strept_3: hypothetical protein SpyM3_1100; SPy_1444; phage(gi28876270)  0.0  Click
11 complement(1196001..1197113)  PHAGE_Strept_3: hyaluronoglucosaminidase; SPy_1445; phage(gi28876271)  0.0  Click
12 complement(1197113..1199071)  PHAGE_Strept_3: putative platelet-binding protein; SPy_1446; phage(gi28876272)  0.0  Click
13 complement(1199068..1199763)  PHAGE_Strept_3: hypothetical protein SpyM3_1103; SPy_1447; phage(gi28876273)  7e-121  Click
14 complement(1199760..1202117)  PHAGE_Strept_3: putative human platelet-binding protein; SPy_1448; phage(gi28876274)  0.0  Click
15 complement(1202117..1202488)  PHAGE_Strept_3: hypothetical protein SpyM3_1105; SPy_1449; phage(gi28876275)  8e-65  Click
16 complement(1202503..1202766)  PHAGE_Strept_3: hypothetical protein SpyM3_1106; SPy_1450; phage(gi28876276)  1e-42  Click
17 complement(1202777..1203370)  PHAGE_Strept_3: putative structural protein; SPy_1451; phage(gi28876277)  4e-100  Click
18 complement(1203382..1203717)  PHAGE_Strept_3: hypothetical protein SpyM3_1108; SPy_1452; phage(gi28876278)  3e-59  Click
19 complement(1203718..1203954)  PHAGE_Strept_3: hypothetical protein SpyM3_1109; SPy_1453; phage(gi28876279)  1e-36  Click
20 complement(1203947..1204276)  PHAGE_Strept_3: hypothetical protein SpyM3_1110; SPy_1454; phage(gi28876280)  1e-41  Click
21 complement(1204245..1204667)  PHAGE_Strept_3: hypothetical protein SpyM3_1111; SPy_1455; phage(gi28876281)  5e-72  Click
22 complement(1204677..1204877)  PHAGE_Strept_3: hypothetical protein SpyM3_1112; SPy_1456; phage(gi28876282)  4e-32  Click
23 complement(1204877..1205788)  PHAGE_Strept_3: putative structural protein; SPy_1457; phage(gi28876283)  2e-171  Click
24 complement(1205813..1206274)  PHAGE_Strept_3: hypothetical protein SpyM3_1114; SPy_1459; phage(gi28876284)  3e-81  Click
25 complement(1206355..1207770)  PHAGE_Strept_3: putative terminase; SPy_1460; phage(gi28876285)  0.0  Click
26 complement(1207880..1208146)  PHAGE_Strept_3: hypothetical protein SpyM3_1117; SPy_1461; phage(gi28876287)  2e-35  Click
27 complement(1208139..1208399)  PHAGE_Strept_3: hypothetical protein SpyM3_1118; SPy_1462; phage(gi28876288)  3e-23  Click
28 complement(1208368..1208592)  PHAGE_Strept_3: hypothetical protein SpyM3_1119; SPy_1463; phage(gi28876289)  1e-38  Click
29 complement(1208598..1210091)  PHAGE_Strept_3: hypothetical protein SpyM3_1120; SPy_1464; phage(gi28876290)  0.0  Click
30 complement(1210084..1211352)  PHAGE_Strept_3: putative structural protein; SPy_1465; phage(gi28876291)  0.0  Click
31 complement(1211349..1211705)  PHAGE_Strept_3: hypothetical protein SpyM3_1122; SPy_1466; phage(gi28876292)  4e-64  Click
32 complement(1211854..1212198)  PHAGE_Strept_3: hypothetical protein SpyM3_1123; SPy_1468; phage(gi28876293)  3e-59  Click
33 complement(1212307..1212726)  PHAGE_Strept_3: hypothetical protein SpyM3_1124; SPy_1469; phage(gi28876294)  7e-71  Click
34 complement(1212994..1213629)  PHAGE_Strept_2: hypothetical protein SpyM3_0951; SPy_1470; phage(gi28876235)  3e-113  Click
35 complement(1213631..1213900)  PHAGE_Strept_6: hypothetical protein SpyM3_1438; SPy_1471; phage(gi28876468)  4e-36  Click
36 complement(1213984..1214496)  PHAGE_Strept_3: hypothetical protein SpyM3_1128; SPy_1473; phage(gi28876298)  2e-58  Click
37 complement(1214493..1214906)  PHAGE_Strept_3: hypothetical protein SpyM3_1129; SPy_1474; phage(gi28876299)  1e-12  Click
38 complement(1215011..1215808)  PHAGE_Strept_3: hypothetical protein SpyM3_1132; SPy_1475; phage(gi28876302)  1e-144  Click
39 complement(1215801..1216001)  PHAGE_Strept_3: hypothetical protein SpyM3_1133; SPy_1476; phage(gi28876303)  2e-32  Click
40 complement(1215998..1216987)  PHAGE_Strept_3: putative recombinase; SPy_1477; phage(gi28876304)  3e-101  Click
41 complement(1216987..1217319)  PHAGE_Strept_3: hypothetical protein SpyM3_1136; SPy_1478; phage(gi28876306)  3e-25  Click
42 complement(1217375..1217581)  PHAGE_Strept_3: hypothetical protein SpyM3_1137; SPy_1479; phage(gi28876307)  7e-32  Click
43 complement(1217727..1217960)  PHAGE_Strept_3: hypothetical protein SpyM3_1138; SPy_1481; phage(gi28876308)  4e-40  Click
44 complement(1217941..1218327)  PHAGE_Strept_3: hypothetical protein SpyM3_1139; SPy_1482; phage(gi28876309)  2e-71  Click
45 complement(1218816..1219001)  PHAGE_Strept_3: hypothetical protein SpyM3_1140; SPy_1483; phage(gi28876310)  3e-28  Click
46 complement(1219003..1219314)  PHAGE_Strept_3: putative excisionase; SPy_1484; phage(gi28876311)  3e-57  Click
47 complement(1219584..1219796)  PHAGE_Strept_3: putative Cro-like repressor protein; SPy_1485; phage(gi28876312)  2e-33  Click
48 1219998..1220753  PHAGE_Strept_3: putative cI-like repressor; SPy_1486; phage(gi28876313)  1e-141  Click
49 1220765..1221283  PHAGE_Strept_3: hypothetical protein SpyM3_1144; SPy_1487; phage(gi28876314)  2e-96  Click
50 1221278..1221289  attR    AACTAACAAAAA  N/A  Click
51 1221407..1222549  PHAGE_Strept_3: putative integrase; SPy_1488; phage(gi28876315)  0.0  Click
52 complement(1222637..1222912)  PHAGE_Bacill_36: DNA-binding HU protein; SPy_1489; phage(gi156564019)  3e-29  Click
Region 4, total : 17 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1773437..1773449  attL    TTTGTGGACTTTT  N/A  Click
2 complement(1773458..1774603)  PHAGE_Lactoc_bIL310: integrase; SPy_2122; phage(gi13095863)  5e-70  Click
3 complement(1775862..1776629)  PHAGE_Strept_PH15: putative transcriptional repressor; SPy_2125; phage(gi190151419)  7e-53  Click
4 1776783..1776989  PHAGE_Lactoc_bIL310: hypothetical protein bIL310p18; SPy_2126; phage(gi13095879)  4e-05  Click
5 1777023..1777790  PHAGE_Strept_PH10: hypothetical protein PH10_gp08; SPy_2127; phage(gi238821325)  7e-10  Click
6 1777800..1778423  PHAGE_Mycoba_Brujita: gp36; SPy_2128; phage(gi206599580)  1e-13  Click
7 1778423..1778692  hypothetical protein; SPy_2129  N/A  Click
8 1778948..1779289  hypothetical protein; SPy_2130  N/A  Click
9 1779276..1779497  hypothetical protein; SPy_2131  N/A  Click
10 1779500..1779691  hypothetical protein; SPy_2132  N/A  Click
11 1779703..1780032  PHAGE_Strept_M102: hypothetical protein M102_gp29; SPy_2133; phage(gi242345600)  1e-05  Click
12 1780035..1780307  PHAGE_Lactoc_bIL310: hypothetical protein bIL310p19; SPy_2134; phage(gi13095880)  1e-05  Click
13 1780308..1781165  PHAGE_Staphy_PT1028: ORF003; SPy_2135; phage(gi66395167)  9e-10  Click
14 1781134..1782822  PHAGE_Lactoc_bIL310: helicase; SPy_2136; phage(gi13095886)  3e-60  Click
15 1783562..1783972  hypothetical protein; SPy_2140  N/A  Click
16 1784046..1784534  hypothetical protein; SPy_2142  N/A  Click
17 1784938..1785300  hypothetical protein; SPy_2144  N/A  Click
18 1785275..1785658  PHAGE_Temper_1: hypothetical protein phiNIH1.1_22; SPy_2145; phage(gi16271798)  2e-17  Click
19 1786762..1786774  attR    TTTGTGGACTTTT  N/A  Click