The gene/protein map for NC_009620 is currently unavailable.

Definition Escherichia coli O157:H7 str. Sakai, complete genome.
Accession NC_002695
Length 5,498,450
Summary Detailed summary Map Image Text file for download

Legend

Hits against Virus and prophage DB
Hits against Bacterial DB or GenBank file
Region 1, total : 15 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 300052..300067  attL    GCACCATTTAAATCAA  N/A  Click
2 complement(300072..301046)  PHAGE_Entero_SfV: integrase; ECs0271; phage(gi19549014)  4e-178  Click
3 complement(300937..301182)  PHAGE_Entero_lambda: early gene regulator; ECs0272; phage(gi9626289)  3e-16  Click
4 complement(301422..301811)  PHAGE_Burkho_phiE202: gp9, Cpp15; ECs0273; phage(gi134288743)  4e-08  Click
5 complement(301939..302652)  PHAGE_Entero_HK106: prophage repressor; ECs0274; phage(gi428783326)  3e-133  Click
6 302753..302953  PHAGE_Entero_HK106: prophage antirepressor; ECs0275; phage(gi428783327)  3e-31  Click
7 303072..303365  PHAGE_Entero_lambda: cII protein; ECs0276; phage(gi9626294)  6e-49  Click
8 304628..305422  PHAGE_Entero_HK106: side tail fiber protein; ECs0280; phage(gi428783303)  9e-22  Click
9 305422..306015  PHAGE_Entero_HK106: tail fiber assembly protein; ECs0281; phage(gi428783304)  4e-64  Click
10 complement(305987..306430)  PHAGE_Entero_mEp213: tail fiber assembly protein; ECs0282; phage(gi428782612)  2e-25  Click
11 complement(306451..306861)  PHAGE_Erwini_ENT90: phage tail collar domain protein; ECs0283; phage(gi431810938)  3e-14  Click
12 306891..307445  PHAGE_Entero_2: DNA-invertase; ECs0284; phage(gi169936026)  8e-89  Click
13 complement(307503..308276)  PHAGE_Pseudo_OBP: putative homing nuclease; ECs0285; phage(gi371671534)  2e-38  Click
14 308737..308748  attL    TACAAAGCTGCC  N/A  Click
15 309100..309843  transcription regulator; ECs0287  N/A  Click
16 complement(309885..310238)  PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECs0288; phage(gi24111655)  1e-42  Click
17 310806..311987  PROPHAGE_Escher_CFT073: putative prophage integrase; ECs0289; phage(gi26250313)  6e-143  Click
18 317302..317313  attR    TACAAAGCTGCC  N/A  Click
19 323524..323539  attR    GCACCATTTAAATCAA  N/A  Click
Region 2, total : 46 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(892240..892458)  PHAGE_Entero_HK629: excisionase; ECs0801; phage(gi428782042)  2e-37  Click
2 complement(892498..892665)  PHAGE_Entero_HK630: hypothetical protein; ECs0802; phage(gi428782816)  7e-29  Click
3 892980..893510  hypothetical protein; ECs0804  N/A  Click
4 complement(893721..893942)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip097; ECs0805; phage(gi20065892)  4e-37  Click
5 complement(894041..894256)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECs0806; phage(gi20065893)  3e-34  Click
6 complement(894333..894524)  PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; ECs0807; phage(gi157165995)  1e-27  Click
7 complement(894497..894679)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; ECs0808; phage(gi20065896)  2e-28  Click
8 complement(894676..895356)  PHAGE_Stx2_c_1717: exonuclease; ECs0809; phage(gi209447136)  4e-132  Click
9 complement(895353..895997)  PHAGE_Stx2_c_I: Bet protein; ECs5398; phage(gi20065900)  3e-125  Click
10 896054..896236  PHAGE_Stx2_c_II: NinE protein; ECs0810; phage(gi302393150)  6e-30  Click
11 896233..896403  PHAGE_Entero_lambda: NinF protein; ECs0811; phage(gi9626302)  2e-27  Click
12 896393..897016  PHAGE_Entero_Sf6: gene 54 protein; ECs0812; phage(gi41057342)  2e-114  Click
13 897013..897678  PHAGE_Stx2_c_1717: NinI protein; ECs0813; phage(gi209447164)  3e-130  Click
14 complement(897890..898849)  outer membrane protein; ECs0814  N/A  Click
15 899324..900013  PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs0815; phage(gi169257244)  3e-81  Click
16 900224..900940  hypothetical protein; ECs0816  N/A  Click
17 901806..902021  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs0818; phage(gi209447171)  7e-35  Click
18 902021..902518  PHAGE_Entero_cdtI: lysin; ECs0819; phage(gi148609440)  1e-91  Click
19 902515..902982  PHAGE_Salmon_SPN9CC: endopeptidase; ECs0820; phage(gi389060532)  2e-78  Click
20 902970..903122  PHAGE_Entero_mEp460: hypothetical protein; ECs0822; phage(gi428782374)  1e-21  Click
21 903529..903807  hypothetical protein; ECs0823  N/A  Click
22 903797..904288  PHAGE_Entero_mEp460: terminase small subunit; ECs0824; phage(gi428782317)  5e-74  Click
23 904288..906390  PHAGE_Entero_cdtI: putative large terminase subunit; ECs0825; phage(gi148609384)  0.0  Click
24 906387..906599  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECs0826; phage(gi148609385)  9e-35  Click
25 906527..907651  PHAGE_Entero_cdtI: putative portal protein; ECs0827; phage(gi148609386)  0.0  Click
26 907851..908108  PHAGE_Entero_cdtI: putative portal protein; ECs0828; phage(gi148609386)  1e-45  Click
27 907957..910080  PHAGE_Entero_cdtI: putative protease/scaffold protein; ECs0829; phage(gi148609387)  0.0  Click
28 910122..910490  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECs0830; phage(gi148609388)  2e-54  Click
29 910483..910758  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECs0831; phage(gi148609389)  6e-39  Click
30 910770..911348  PHAGE_Entero_cdtI: putative tail component; ECs0832; phage(gi148609390)  2e-103  Click
31 911345..911746  PHAGE_Entero_cdtI: putative tail component; ECs0833; phage(gi148609391)  8e-73  Click
32 911757..912500  PHAGE_Entero_cdtI: putative major tail subunit; ECs0834; phage(gi148609392)  4e-137  Click
33 912561..912947  PHAGE_Entero_cdtI: putative tail component; ECs0835; phage(gi148609393)  5e-65  Click
34 912956..913285  PHAGE_Entero_cdtI: putative minor tail protein; ECs0836; phage(gi148609394)  5e-59  Click
35 913257..916322  PHAGE_Entero_cdtI: putative tail protein; ECs0837; phage(gi148609395)  0.0  Click
36 916322..916651  PHAGE_Entero_cdtI: putative minor tail protein; ECs0838; phage(gi148609396)  2e-61  Click
37 916661..917359  PHAGE_Entero_cdtI: putative minor tail protein; ECs0839; phage(gi148609397)  1e-135  Click
38 917509..918108  PHAGE_Entero_cdtI: putative tail protein; ECs0840; phage(gi148609398)  1e-117  Click
39 918006..918653  PHAGE_Entero_cdtI: putative tail component; ECs0841; phage(gi148609399)  8e-112  Click
40 918714..922127  PHAGE_Entero_cdtI: putative tail tip assembly protein; ECs0842; phage(gi148609400)  0.0  Click
41 922198..922797  PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECs0843; phage(gi148609401)  3e-104  Click
42 922857..924173  PHAGE_Entero_cdtI: putative tail fiber protein; ECs0844; phage(gi148609402)  0.0  Click
43 924136..924444  PHAGE_Stx2_c_II: putative tail fiber protein; ECs0845; phage(gi302393091)  8e-54  Click
44 924621..925601  PHAGE_Salmon_ST64B: hypothetical protein sb26; ECs0846; phage(gi23505470)  3e-90  Click
45 925662..926654  hypothetical protein; ECs0847  N/A  Click
46 927482..928363  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECs0848; phage(gi148609405)  7e-156  Click
Region 3, total : 27 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(1160230..1160889)  PHAGE_Camelp_virus: CMLV006; ECs1054; phage(gi18640240)  3e-12  Click
2 1161156..1161167  attL    AAGAAAAACAAA  N/A  Click
3 complement(1161297..1162316)  PHAGE_Salmon_ST64B: Integrase protein; ECs1055; phage(gi23505472)  2e-87  Click
4 complement(1162604..1165075)  PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECs1057; phage(gi23505474)  1e-55  Click
5 complement(1165169..1165360)  hypothetical protein; ECs1058  N/A  Click
6 complement(1165357..1165545)  cell division inhibition protein; ECs1059  N/A  Click
7 1165812..1166117  hypothetical protein; ECs1060  N/A  Click
8 1166119..1166304  hypothetical protein; ECs1061  N/A  Click
9 complement(1166491..1166880)  PHAGE_Escher_TL_2011c: hypothetical protein; ECs1063; phage(gi418487085)  3e-07  Click
10 complement(1167022..1167177)  PHAGE_Salico_CGphi29: hypothetical protein; ECs1065; phage(gi472340166)  2e-09  Click
11 complement(1167455..1167742)  hypothetical protein; ECs1067  N/A  Click
12 complement(1167742..1167933)  hypothetical protein; ECs1068  N/A  Click
13 complement(1167961..1168362)  PHAGE_Gifsy_2: putative bacteriophage regulatory protein; repressor; Lambda gpCI analog; ECs1069; phage(gi169257276)  2e-11  Click
14 1168471..1168743  PHAGE_Gifsy_2: putative bacteriophage regulatory protein; Lambda gpCro analog; ECs1070; phage(gi169257277)  2e-16  Click
15 1168727..1169152  PHAGE_Escher_HK639: cII; ECs1071; phage(gi356870652)  8e-06  Click
16 complement(1169359..1169814)  hypothetical protein; ECs1072  N/A  Click
17 1169893..1170984  PHAGE_Entero_phiP27: hypothetical protein P27p17; ECs1073; phage(gi18249881)  2e-29  Click
18 1170991..1171737  PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs1074; phage(gi169257280)  1e-75  Click
19 1171759..1172529  PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECs1075; phage(gi116222030)  1e-05  Click
20 1172545..1172958  hypothetical protein; ECs1076  N/A  Click
21 complement(1173310..1174083)  hypothetical protein; ECs1077  N/A  Click
22 1174631..1174843  PHAGE_Stx2_c_II: putative host killer protein; ECs1080; phage(gi302393105)  3e-27  Click
23 1175011..1175289  PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECs1081; phage(gi169257287)  6e-09  Click
24 1175291..1176340  PHAGE_Entero_mEp460: hypothetical protein; ECs1082; phage(gi428782365)  8e-112  Click
25 1176353..1176724  PHAGE_Escher_HK75: RusA-like protein; ECs1083; phage(gi356870726)  1e-36  Click
26 1176714..1177085  PHAGE_Entero_2008: antitermination protein Q; ECs1084; phage(gi209427762)  4e-54  Click
27 1177237..1178055  hypothetical protein; ECs1085  N/A  Click
28 1178342..1178581  PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs1086; phage(gi18249887)  2e-20  Click
29 1186416..1186427  attR    AAGAAAAACAAA  N/A  Click
Region 4, total : 38 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1180157..1182007  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1088; phage(gi209427766)  0.0  Click
2 1182183..1182509  PHAGE_Stx2_c_II: putative transposase; ECs1089; phage(gi302393161)  1e-58  Click
3 1182506..1183159  PHAGE_Stx2_c_1717: transposase; ECs1090; phage(gi209447179)  1e-62  Click
4 complement(1183364..1183678)  transcriptional regulator; ECs1091  N/A  Click
5 complement(1184144..1184611)  PHAGE_Entero_4795: putative endopeptidase Rz; ECs1093; phage(gi157166036)  1e-73  Click
6 complement(1184613..1184726)  hypothetical protein; ECs1094  N/A  Click
7 complement(1184947..1185480)  PHAGE_Entero_2008: putative endolysin; ECs1096; phage(gi209427769)  2e-99  Click
8 complement(1185513..1185707)  hypothetical protein; ECs1098  N/A  Click
9 1185676..1185912  PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECs1097; phage(gi116221998)  4e-13  Click
10 1185861..1186205  hypothetical protein; ECs1099  N/A  Click
11 complement(1186168..1186374)  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1100; phage(gi209447171)  3e-31  Click
12 1187125..1187400  hypothetical protein; ECs1101  N/A  Click
13 1187476..1187856  PHAGE_Stx2_c_1717: truncated transposase; ECs1102; phage(gi209447151)  9e-69  Click
14 1187853..1188200  PHAGE_Stx2_c_1717: transposase; ECs1103; phage(gi209447152)  2e-62  Click
15 1188250..1189788  PHAGE_Stx2_c_1717: transposase; ECs1104; phage(gi209447153)  0.0  Click
16 1190052..1191980  PHAGE_Entero_HK630: terminase large subunit A; ECs1106; phage(gi428782789)  0.0  Click
17 1191964..1192170  PHAGE_Entero_HK630: head-tail connector W; ECs5406; phage(gi428782790)  1e-11  Click
18 1192167..1193759  PHAGE_Entero_HK630: portal protein B; ECs1107; phage(gi428782791)  0.0  Click
19 1193749..1195254  PHAGE_Entero_HK630: head maturation protease C; ECs1108; phage(gi428782792)  4e-108  Click
20 1195291..1195638  PHAGE_Entero_HK630: head decoration protein D; ECs1109; phage(gi428782794)  6e-25  Click
21 1195696..1195962  PHAGE_Entero_HK630: major head subunit E; ECs1110; phage(gi428782795)  2e-20  Click
22 1196079..1196684  PHAGE_Entero_HK630: major tail protein V; ECs1111; phage(gi428782800)  4e-87  Click
23 1196698..1197129  PHAGE_Entero_HK630: minor tail protein G; ECs1112; phage(gi428782801)  5e-45  Click
24 1197180..1197569  PHAGE_Entero_HK630: tail assembly protein GT; ECs1113; phage(gi428782802)  4e-43  Click
25 1197550..1200129  PHAGE_Entero_HK630: tail length tape measure protein H; ECs1114; phage(gi428782803)  0.0  Click
26 1200126..1200455  PHAGE_Entero_HK630: minor tail protein M; ECs1115; phage(gi428782804)  4e-48  Click
27 1200455..1201153  PHAGE_Entero_HK630: minor tail protein L; ECs1116; phage(gi428782805)  3e-103  Click
28 1201272..1201907  PHAGE_Entero_4795: putative tail fiber component; ECs1117; phage(gi157166055)  1e-122  Click
29 1201805..1202485  PHAGE_Stx2_c_1717: putative tail component; ECs1118; phage(gi209447195)  9e-126  Click
30 1202439..1202645  hypothetical protein; ECs1119  N/A  Click
31 complement(1202676..1203203)  PHAGE_Salmon_1: hypothetical bacteriophage protein; ECs1120; phage(gi169257202)  2e-60  Click
32 1203337..1206810  PHAGE_Entero_HK630: tail fiber J; ECs1121; phage(gi428782808)  0.0  Click
33 1206878..1207477  PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECs1122; phage(gi209447197)  9e-113  Click
34 1207536..1208855  PROPHAGE_Escher_Sakai: putative tail fiber protein; ECs1123; phage(gi15832195)  0.0  Click
35 1208857..1209126  PHAGE_Stx2_c_II: putative tail fiber protein; ECs1124; phage(gi302393091)  2e-43  Click
36 complement(1209251..1209820)  PHAGE_Emilia_86: hypothetical protein EhV364; ECs1126; phage(gi73852838)  7e-08  Click
37 1209796..1209978  hypothetical protein; ECs1125  N/A  Click
38 complement(1210459..1210641)  PHAGE_Entero_4795: putative avirulence protein; ECs1127; phage(gi157166069)  4e-24  Click
Region 5, total : 91 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1245903..1245914  attL    ACCGCCTGCTTT  N/A  Click
2 complement(1246040..1247350)  PHAGE_Stx2_c_II: integrase; ECs1160; phage(gi302393112)  0.0  Click
3 complement(1247403..1247687)  PHAGE_Stx2_c_II: excisionase; ECs1161; phage(gi302393113)  1e-51  Click
4 complement(1247773..1248084)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip084; ECs1162; phage(gi20065879)  8e-57  Click
5 complement(1248144..1248488)  PHAGE_Stx2_c_II: hypothetical protein Stx2IIp093; ECs1163; phage(gi302393115)  4e-51  Click
6 complement(1248421..1249044)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; ECs1164; phage(gi302393116)  2e-120  Click
7 complement(1249048..1249335)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECs1165; phage(gi302393117)  1e-51  Click
8 complement(1249337..1249555)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECs1166; phage(gi302393118)  1e-36  Click
9 complement(1249557..1249844)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECs1167; phage(gi302393119)  4e-39  Click
10 complement(1249774..1250241)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp37; ECs1168; phage(gi302393120)  6e-74  Click
11 complement(1250114..1250887)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp38; ECs1169; phage(gi302393121)  2e-146  Click
12 complement(1250884..1251105)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp39; ECs1170; phage(gi302393122)  2e-37  Click
13 complement(1251204..1251419)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECs1171; phage(gi302393124)  5e-35  Click
14 complement(1251496..1251687)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECs1172; phage(gi302393126)  2e-29  Click
15 complement(1251660..1251842)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp44; ECs1173; phage(gi302393127)  5e-30  Click
16 complement(1251839..1252519)  PHAGE_Stx2_c_II: exonuclease; ECs1174; phage(gi302393128)  2e-132  Click
17 complement(1252516..1253301)  PHAGE_Stx2_c_II: recombination protein Bet; ECs1175; phage(gi302393129)  3e-151  Click
18 complement(1253307..1253723)  PHAGE_Entero_HK630: host-nuclease inhibitor protein; ECs1176; phage(gi428782824)  3e-75  Click
19 complement(1253678..1253947)  PHAGE_Stx2_c_II: Kil protein; ECs1177; phage(gi302393131)  7e-45  Click
20 complement(1253790..1253954)  PHAGE_Stx2_c_II: CIII protein; ECs1178; phage(gi302393132)  1e-27  Click
21 complement(1254027..1254395)  PHAGE_Stx2_c_II: Ea10 protein; ECs1179; phage(gi302393133)  2e-68  Click
22 complement(1254578..1254829)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp52; ECs1180; phage(gi302393135)  2e-44  Click
23 complement(1254888..1255160)  PHAGE_Stx2_c_II: putative antitermination protein N; ECs1181; phage(gi302393136)  3e-45  Click
24 complement(1255138..1255320)  PHAGE_Entero_2008: hypothetical protein YYZ_gp22; ECs1182; phage(gi209427747)  4e-30  Click
25 1255617..1255778  PHAGE_Entero_2008: hypothetical protein YYZ_gp24; ECs1183; phage(gi209427749)  3e-25  Click
26 complement(1255889..1256410)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; ECs1184; phage(gi302393137)  4e-92  Click
27 complement(1256912..1257565)  PHAGE_Stx2_c_II: CI protein; ECs1185; phage(gi302393138)  6e-126  Click
28 1257683..1257898  PHAGE_Stx2_c_II: Cro protein; ECs1186; phage(gi302393139)  2e-36  Click
29 1258040..1258336  PHAGE_Stx2_c_II: CII protein; ECs1187; phage(gi302393140)  2e-50  Click
30 1258369..1258515  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp58; ECs1188; phage(gi302393141)  4e-22  Click
31 1258508..1259407  PHAGE_Stx1_converting: DNA replication protein O; ECs1189; phage(gi302861180)  1e-177  Click
32 1259382..1260833  PHAGE_Stx2_c_II: DNA replication protein P; ECs1190; phage(gi302393143)  0.0  Click
33 1260833..1261102  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; ECs1191; phage(gi302393144)  8e-47  Click
34 1261173..1261451  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECs1192; phage(gi302393145)  1e-51  Click
35 1261584..1261799  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp63; ECs1193; phage(gi302393146)  5e-35  Click
36 1261810..1262046  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp64; ECs1194; phage(gi302393147)  2e-42  Click
37 1262003..1262449  PHAGE_Stx2_c_II: NinB protein; ECs1195; phage(gi302393148)  8e-84  Click
38 1262446..1262973  PHAGE_Stx2_c_II: putative DNA N-6-adenine-methyltransferase; ECs1196; phage(gi302393149)  9e-102  Click
39 1262970..1263152  PHAGE_Stx2_c_II: NinE protein; ECs1197; phage(gi302393150)  3e-31  Click
40 1263427..1264161  PHAGE_Stx2_c_II: putative antirepressor-like protein; ECs1199; phage(gi302393152)  7e-142  Click
41 1264236..1264958  PHAGE_Stx2_c_II: Roi protein; ECs1200; phage(gi302393153)  5e-132  Click
42 1264958..1265563  PHAGE_Stx2_c_II: NinG protein; ECs1201; phage(gi302393154)  1e-118  Click
43 1265560..1265754  PHAGE_Stx2_c_II: NinH protein; ECs1202; phage(gi302393155)  2e-32  Click
44 1265747..1266181  PHAGE_Stx2_c_II: antitermination protein Q; ECs1203; phage(gi302393156)  8e-83  Click
45 1266430..1266582  PHAGE_Stx2_c_86: DNA modification methylase; ECs1204; phage(gi116222073)  1e-19  Click
46 1266623..1266698  tRNA  N/A  Click
47 1266708..1266784  tRNA  N/A  Click
48 1266798..1266874  tRNA  N/A  Click
49 1266965..1267924  PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECs1205; phage(gi302393157)  0.0  Click
50 1267936..1268205  PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECs1206; phage(gi302393158)  1e-46  Click
51 1268692..1270596  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp76; ECs1207; phage(gi302393159)  0.0  Click
52 complement(1270403..1271293)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECs1208; phage(gi302393160)  2e-173  Click
53 complement(1271290..1271616)  PHAGE_Stx2_c_II: putative transposase; ECs1209; phage(gi302393161)  1e-58  Click
54 1272078..1272257  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECs1210; phage(gi302393162)  2e-28  Click
55 1272298..1272570  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECs1211; phage(gi302393163)  1e-43  Click
56 1272647..1272862  PHAGE_Stx2_c_II: holin; ECs1212; phage(gi302393164)  2e-35  Click
57 1272867..1273400  PHAGE_Stx2_c_II: endolysin; ECs1213; phage(gi302393165)  1e-103  Click
58 1273671..1274240  PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECs1214; phage(gi302393166)  7e-107  Click
59 1274394..1274858  PHAGE_Stx2_c_II: endopeptidase Rz; ECs1215; phage(gi302393167)  6e-83  Click
60 complement(1274890..1275183)  PHAGE_Stx2_c_II: Bor protein precursor; ECs1217; phage(gi302393169)  2e-50  Click
61 1275291..1275536  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECs1218; phage(gi20065959)  4e-45  Click
62 1275592..1276398  PHAGE_Stx2_c_II: terminase, small subunit; ECs1219; phage(gi302393081)  3e-151  Click
63 1276379..1278085  PHAGE_Stx2_c_II: terminase, large subunit; ECs1220; phage(gi302393082)  0.0  Click
64 1278085..1280229  PHAGE_Stx2_c_II: portal protein; ECs1221; phage(gi302393083)  0.0  Click
65 1280387..1281394  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECs1222; phage(gi302393084)  0.0  Click
66 1281418..1282632  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ECs1223; phage(gi302393085)  0.0  Click
67 1282688..1283077  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ECs1224; phage(gi302393086)  2e-66  Click
68 1283127..1283588  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ECs1225; phage(gi302393087)  2e-82  Click
69 1283572..1284135  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ECs1226; phage(gi302393088)  2e-104  Click
70 1284135..1284785  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ECs1227; phage(gi302393089)  8e-123  Click
71 1284782..1286719  PHAGE_Stx2_c_II: putative tail fiber protein; ECs1228; phage(gi302393090)  0.0  Click
72 1286721..1286990  PHAGE_Stx2_c_II: putative tail fiber protein; ECs1229; phage(gi302393091)  4e-47  Click
73 1287076..1287318  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip029; ECs1230; phage(gi20065825)  3e-42  Click
74 complement(1287205..1287447)  outer membrane protein; ECs1231  N/A  Click
75 1287535..1289238  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ECs1232; phage(gi302393092)  0.0  Click
76 1289235..1290503  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ECs1233; phage(gi302393093)  0.0  Click
77 1290518..1290796  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ECs1234; phage(gi302393094)  8e-52  Click
78 1290802..1291419  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ECs1235; phage(gi302393095)  4e-122  Click
79 1291510..1292244  PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ECs1236; phage(gi302393096)  4e-140  Click
80 1292674..1293075  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ECs1237; phage(gi302393098)  3e-74  Click
81 1293169..1293825  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ECs1238; phage(gi302393099)  5e-122  Click
82 1293828..1294274  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ECs1239; phage(gi302393100)  2e-80  Click
83 1294284..1294535  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ECs1240; phage(gi302393101)  2e-40  Click
84 1294546..1295811  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ECs1241; phage(gi302393102)  0.0  Click
85 1295881..1304262  PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ECs1242; phage(gi302861144)  0.0  Click
86 1304548..1304733  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip069; ECs1243; phage(gi20065864)  2e-30  Click
87 complement(1304813..1305157)  PHAGE_Stx2_c_II: hypothetical protein Stx2IIp075; ECs1244; phage(gi302393104)  6e-59  Click
88 complement(1305277..1305489)  PHAGE_Stx2_c_II: putative host killer protein; ECs1245; phage(gi302393105)  4e-33  Click
89 complement(1305723..1306118)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp25; ECs1246; phage(gi302393106)  7e-72  Click
90 complement(1306118..1306777)  PHAGE_Stx2_c_II: hypothetical protein Stx2IIp080; ECs1247; phage(gi302393107)  2e-128  Click
91 complement(1306798..1307016)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp26; ECs1248; phage(gi302393108)  1e-37  Click
92 complement(1307003..1307287)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ECs1249; phage(gi302393109)  5e-50  Click
93 complement(1307284..1307505)  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp28; ECs1250; phage(gi302393110)  8e-38  Click
94 complement(1307553..1308182)  PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECs1251; phage(gi302393111)  6e-117  Click
95 complement(1309331..1310659)  PHAGE_Lactob_KC5a: putative minor tail protein; ECs1252; phage(gi90592623)  8e-06  Click
96 1316397..1316408  attR    ACCGCCTGCTTT  N/A  Click
Region 6, total : 61 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1538645..1539466  PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECs1498; phage(gi414087036)  4e-19  Click
2 complement(1539622..1540668)  spermidine/putrescine ABC transporter periplasmic substrate-binding protein; ECs1499  N/A  Click
3 complement(1540665..1541459)  spermidine/putrescine ABC transporter membrane protein; ECs1500  N/A  Click
4 1541510..1541524  attL    TTTATTCAATTTTTT  N/A  Click
5 complement(1541626..1542744)  PHAGE_Entero_mEp235: integrase; ECs1501; phage(gi428781836)  3e-52  Click
6 complement(1542713..1542982)  excisionase; ECs1502  N/A  Click
7 complement(1543044..1543481)  PHAGE_Entero_mEp460: putative exonuclease; ECs1503; phage(gi428782342)  1e-40  Click
8 1543524..1544081  PHAGE_Entero_HK630: HkaP protein; ECs1504; phage(gi428782827)  2e-12  Click
9 complement(1544196..1544426)  PHAGE_Salico_CGphi29: hypothetical protein; ECs1505; phage(gi472340166)  1e-09  Click
10 complement(1544664..1545140)  phage repressor; ECs1506  N/A  Click
11 1545265..1545588  PHAGE_Aggreg_S1249: phage protein; ECs1507; phage(gi273809591)  1e-13  Click
12 1545572..1545997  PHAGE_Pectob_ZF40: putative cII repressor; ECs1508; phage(gi422936652)  2e-05  Click
13 1546066..1547103  PHAGE_Escher_TL_2011b: hypothetical protein; ECs1509; phage(gi418487646)  4e-48  Click
14 1546964..1547557  PHAGE_Escher_HK639: replication protein 14; ECs1510; phage(gi356870655)  2e-31  Click
15 1547591..1548307  hypothetical protein; ECs1511  N/A  Click
16 1548304..1548621  hypothetical protein; ECs1512  N/A  Click
17 1548618..1548920  PHAGE_Klebsi_phiKO2: Gp58; ECs1513; phage(gi46402144)  1e-26  Click
18 1548910..1549227  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ECs1514; phage(gi302393109)  7e-45  Click
19 1549181..1549498  PHAGE_Salmon_E1: hypothetical protein VIP0051; ECs1515; phage(gi170676326)  9e-32  Click
20 1549485..1549922  PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECs1516; phage(gi209427735)  1e-08  Click
21 1549924..1550115  PHAGE_Salmon_ST160: hypothetical protein; ECs1517; phage(gi318065908)  5e-27  Click
22 1550118..1550705  PHAGE_Entero_mEp460: hypothetical protein; ECs1518; phage(gi428782343)  7e-40  Click
23 1551114..1551326  PHAGE_Stx2_c_II: putative host killer protein; ECs1520; phage(gi302393105)  2e-29  Click
24 1551494..1551772  PHAGE_Cronob_phiES15: hypothetical protein; ECs1521; phage(gi401817580)  1e-13  Click
25 1551774..1552823  PHAGE_Entero_mEp460: hypothetical protein; ECs1522; phage(gi428782365)  2e-109  Click
26 1552836..1553210  PHAGE_Escher_HK75: RusA-like protein; ECs1523; phage(gi356870726)  2e-34  Click
27 1553207..1554028  PHAGE_Entero_HK225: late gene regulator Q; ECs1524; phage(gi428782441)  7e-91  Click
28 complement(1554441..1554941)  hypothetical protein; ECs1526  N/A  Click
29 1554893..1555078  hypothetical protein; ECs1525  N/A  Click
30 1555107..1557044  PHAGE_Entero_4795: hypothetical protein YjhS; ECs1527; phage(gi157166028)  0.0  Click
31 1557192..1557374  PHAGE_Escher_P13374: hypothetical protein; ECs1528; phage(gi410491643)  3e-18  Click
32 1557412..1557681  PHAGE_Escher_P13374: hypothetical protein; ECs1529; phage(gi410491644)  1e-26  Click
33 1557757..1557972  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1530; phage(gi209447171)  2e-34  Click
34 1557977..1558321  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1531; phage(gi209427768)  1e-59  Click
35 1558372..1558905  PHAGE_Entero_2008: putative endolysin; ECs1532; phage(gi209427769)  4e-103  Click
36 1559176..1559745  PHAGE_Entero_2008: putative antirepressor; ECs1533; phage(gi209427770)  7e-107  Click
37 1559899..1560366  PHAGE_Entero_2008: putative endopeptidase; ECs1534; phage(gi209427771)  5e-63  Click
38 1560390..1560614  hypothetical protein; ECs1536  N/A  Click
39 1560611..1560829  PHAGE_Entero_Sakai: hypothetical protein VT2-Sap50; ECs1537; phage(gi9633444)  1e-12  Click
40 1560971..1561111  hypothetical protein; ECs1538  N/A  Click
41 complement(1561241..1561426)  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1539; phage(gi209427772)  9e-19  Click
42 1561468..1561833  PHAGE_Entero_2008: putative DNAse; ECs1540; phage(gi209427773)  4e-67  Click
43 complement(1561486..1561731)  hypothetical protein; ECs5417  N/A  Click
44 1562123..1562686  PHAGE_Entero_2008: putative phage terminase; ECs1541; phage(gi209427774)  1e-95  Click
45 1562683..1564344  PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1542; phage(gi209427775)  0.0  Click
46 1564408..1566345  PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1543; phage(gi209427776)  0.0  Click
47 1566390..1566611  PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5418; phage(gi209427801)  6e-38  Click
48 1566557..1569058  PHAGE_Entero_2008: putative portal protein; ECs1544; phage(gi209427777)  0.0  Click
49 1569138..1569464  PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1545; phage(gi209427778)  1e-54  Click
50 1569474..1569824  PHAGE_Entero_2008: putative head-tail adaptor; ECs1546; phage(gi209427779)  9e-61  Click
51 1569821..1570267  PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1547; phage(gi209427780)  2e-80  Click
52 1570264..1570608  PHAGE_Entero_2008: putative prophage structural protein; ECs1548; phage(gi209427781)  6e-60  Click
53 1570667..1571383  PHAGE_Entero_2008: putative tail protein; ECs1549; phage(gi209427782)  1e-124  Click
54 1571389..1571763  PHAGE_Entero_2008: putative tail assembly protein; ECs1550; phage(gi209427783)  2e-65  Click
55 1571787..1572068  PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1551; phage(gi209427784)  6e-47  Click
56 1575357..1575698  PHAGE_Entero_2008: putative minor tail protein; ECs1554; phage(gi209427786)  3e-63  Click
57 1575698..1576396  PHAGE_Entero_2008: putative tail protein; ECs1555; phage(gi209427787)  4e-131  Click
58 complement(1576413..1576667)  PHAGE_Salmon_ST160: Mnt; ECs1556; phage(gi318065963)  1e-07  Click
59 1577190..1578068  PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECs1557; phage(gi399498814)  2e-94  Click
60 1578122..1578859  PHAGE_Entero_2008: putative tail component K-like protein; ECs1558; phage(gi209427789)  3e-151  Click
61 1578757..1579041  PHAGE_Entero_2008: putative tail assembly protein; ECs1559; phage(gi209427790)  2e-30  Click
62 1579163..1581511  PHAGE_Staphy_vB_SauM_Romulus: pentapeptide repeat-containing protein; ECs1560; phage(gi472437873)  8e-07  Click
63 1591830..1591844  attR    TTTATTCAATTTTTT  N/A  Click
Region 7, total : 26 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1594704..1594724  attL    CGGTGTAGTTAATGGTGTAGT  N/A  Click
2 1594751..1595980  PHAGE_Salmon_vB_SosS_Oslo: integrase; ECs1574; phage(gi399528791)  3e-59  Click
3 1596345..1596533  PHAGE_Entero_P4: transcriptional regulator; ECs1575; phage(gi9627517)  3e-07  Click
4 1596591..1597334  hypothetical protein; ECs1576  N/A  Click
5 complement(1597034..1597165)  hypothetical protein; ECs5420  N/A  Click
6 1597360..1597557  Icd-like protein; ECs1577  N/A  Click
7 1597550..1597735  hypothetical protein; ECs1578  N/A  Click
8 1597735..1597926  PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; ECs1579; phage(gi169257169)  1e-09  Click
9 1597916..1598158  hypothetical protein; ECs1580  N/A  Click
10 1598164..1598463  hypothetical protein; ECs1581  N/A  Click
11 1598460..1599425  hypothetical protein; ECs1582  N/A  Click
12 1599501..1599722  hypothetical protein; ECs1583  N/A  Click
13 1599788..1600594  hypothetical protein; ECs1584  N/A  Click
14 complement(1600591..1600935)  hypothetical protein; ECs1585  N/A  Click
15 1600965..1601216  hypothetical protein; ECs1586  N/A  Click
16 1601213..1601623  PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECs1587; phage(gi115304283)  1e-09  Click
17 1601634..1601906  transcriptional activator; ECs1588  N/A  Click
18 1601953..1602255  hypothetical protein; ECs1589  N/A  Click
19 1602548..1603705  PHAGE_Salmon_ST64B: Major capsid protein precursor; ECs1590; phage(gi23505451)  2e-52  Click
20 1603745..1604317  PHAGE_Entero_1: prohead protease; ECs1591; phage(gi225626394)  5e-30  Click
21 1604319..1605530  PHAGE_Salmon_ST64B: Portal Protein; ECs1592; phage(gi23505449)  2e-43  Click
22 1605527..1605865  PHAGE_Entero_HK97: putative head-tail adaptor; ECs1593; phage(gi9634168)  3e-25  Click
23 1605862..1606158  PHAGE_Entero_SfV: hypothetical protein SfVp06; ECs1594; phage(gi19548996)  3e-07  Click
24 1606158..1606598  PHAGE_Bacill_phi105: hypothetical protein phi105_50; ECs1595; phage(gi22855043)  3e-23  Click
25 1606591..1606764  hypothetical protein; ECs1596  N/A  Click
26 1606888..1607244  PHAGE_Salmon_ST64B: terminase small subunit; ECs1597; phage(gi23505446)  5e-12  Click
27 1607228..1608889  PHAGE_Burkho_KS9: terminase gp2; ECs1598; phage(gi255033734)  6e-84  Click
28 1609934..1609954  attR    CGGTGTAGTTAATGGTGTAGT  N/A  Click
Region 8, total : 46 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1609996..1610007  attL    AATTAAATCAAT  N/A  Click
2 complement(1615552..1616013)  PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ECs1606; phage(gi34419395)  6e-05  Click
3 complement(1616023..1616646)  23S rRNA pseudouridine synthase E; ECs1607  N/A  Click
4 1616848..1618098  isocitrate dehydrogenase; ECs1608  N/A  Click
5 complement(1618212..1619354)  PHAGE_Entero_mEp235: integrase; ECs1609; phage(gi428781836)  5e-61  Click
6 complement(1619344..1619580)  excisionase; ECs1610  N/A  Click
7 1619684..1620508  PHAGE_Entero_lambda: DNA replication protein; ECs1611; phage(gi9626295)  2e-99  Click
8 1620505..1621206  PHAGE_Entero_lambda: DNA replication protein; ECs1612; phage(gi9626296)  4e-129  Click
9 1621203..1621505  PHAGE_Entero_lambda: ren exclusion protein; ECs1613; phage(gi9626297)  2e-43  Click
10 1621573..1621905  PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECs1614; phage(gi311992758)  1e-10  Click
11 1622083..1622094  attL    TAAAAATTAAAC  N/A  Click
12 1622150..1623676  PHAGE_Bacill_WBeta: putative site-specific recombinase; ECs1615; phage(gi85701406)  5e-09  Click
13 1624178..1624633  PHAGE_Cronob_phiES15: hypothetical protein; ECs1616; phage(gi401817579)  9e-59  Click
14 1624633..1624803  PHAGE_Escher_HK639: NinE; ECs1617; phage(gi356870663)  1e-14  Click
15 1624796..1625086  PHAGE_Entero_mEp237: hypothetical protein; ECs1618; phage(gi435439317)  3e-48  Click
16 1625083..1625445  PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECs1619; phage(gi435439318)  1e-61  Click
17 1625442..1625582  PHAGE_Entero_mEp237: hypothetical protein; ECs5421; phage(gi435439319)  4e-12  Click
18 1625579..1626268  PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs1620; phage(gi169257244)  4e-84  Click
19 1626578..1626895  PHAGE_Salmon_ST160: Gp13; ECs1621; phage(gi318065943)  5e-40  Click
20 1626882..1627358  PHAGE_Escher_HK75: lysozyme; ECs1622; phage(gi356870730)  6e-85  Click
21 1627355..1627816  PHAGE_Entero_lambda: cell lysis protein; ECs1623; phage(gi9626310)  3e-80  Click
22 1627575..1627757  PHAGE_Entero_lambda: Rz1 protein; ECs1624; phage(gi160338810)  2e-30  Click
23 complement(1627848..1628141)  PHAGE_Entero_lambda: Bor protein precursor; ECs1625; phage(gi19263395)  6e-50  Click
24 complement(1628433..1628885)  PHAGE_Entero_lambda: putative envelope protein; ECs1626; phage(gi19263396)  3e-83  Click
25 1629129..1629335  PHAGE_Entero_lambda: hypothetical protein lambdap79; ECs1627; phage(gi19263397)  1e-32  Click
26 complement(1629500..1629694)  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1628; phage(gi209427772)  6e-20  Click
27 1630083..1630628  PHAGE_Entero_lambda: DNA packaging protein; ECs1629; phage(gi9626244)  3e-96  Click
28 1630603..1632528  PHAGE_Entero_lambda: DNA packaging protein; ECs1630; phage(gi9626245)  0.0  Click
29 1632525..1632731  PHAGE_Entero_lambda: head-tail joining protein; ECs1631; phage(gi9626246)  1e-31  Click
30 1632728..1634329  PHAGE_Entero_lambda: capsid component; ECs1632; phage(gi9626247)  0.0  Click
31 1634310..1635629  PHAGE_Entero_lambda: capsid component; ECs1633; phage(gi9626248)  0.0  Click
32 1635639..1635971  PHAGE_Entero_lambda: head-DNA stabilization protein; ECs1634; phage(gi9626250)  7e-58  Click
33 1636027..1637052  PHAGE_Entero_lambda: capsid component; ECs1635; phage(gi9626251)  0.0  Click
34 1637094..1637492  PHAGE_Entero_lambda: DNA packaging protein; ECs1636; phage(gi9626252)  3e-67  Click
35 1637504..1637857  PHAGE_Entero_lambda: head-tail joining protein; ECs1637; phage(gi9626253)  8e-62  Click
36 1637869..1638447  PHAGE_Entero_lambda: tail component; ECs1638; phage(gi9626254)  6e-101  Click
37 1638444..1638839  PHAGE_Entero_lambda: tail component; ECs1639; phage(gi9626255)  2e-72  Click
38 1638847..1639587  PHAGE_Entero_lambda: tail component; ECs1640; phage(gi9626256)  3e-133  Click
39 1639603..1640025  PHAGE_Entero_lambda: tail component; ECs1641; phage(gi9626257)  2e-73  Click
40 1640007..1640441  PHAGE_Entero_lambda: tail component; ECs1642; phage(gi9626258)  2e-81  Click
41 1640434..1642983  PHAGE_Entero_lambda: tail component; ECs1643; phage(gi9626259)  0.0  Click
42 1642980..1643309  PHAGE_Entero_lambda: tail component; ECs1644; phage(gi9626260)  1e-56  Click
43 1643309..1644007  PHAGE_Entero_lambda: tail component; ECs1645; phage(gi9626261)  5e-134  Click
44 1644013..1644756  PHAGE_Entero_mEp460: tail fiber component; ECs1646; phage(gi428782332)  2e-149  Click
45 1644654..1645325  PHAGE_Entero_lambda: tail component; ECs1647; phage(gi9626263)  8e-121  Click
46 1645386..1648784  PHAGE_Entero_lambda: tail:host specificity protein; ECs1648; phage(gi9626264)  0.0  Click
47 1648851..1649450  PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECs1649; phage(gi148609401)  3e-112  Click
48 1649515..1652430  PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; ECs1650; phage(gi169257320)  2e-159  Click
49 1655790..1655801  attR    TAAAAATTAAAC  N/A  Click
50 1656529..1656540  attR    AATTAAATCAAT  N/A  Click
Region 9, total : 59 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 1743556..1743567  attL    TTAAATTATTGT  N/A  Click
2 complement(1757549..1758679)  PHAGE_Entero_mEp235: integrase; ECs1757; phage(gi428781836)  4e-56  Click
3 complement(1758657..1758905)  excisionase; ECs1758  N/A  Click
4 complement(1758970..1761441)  PHAGE_Entero_mEp460: putative exonuclease; ECs1759; phage(gi428782342)  3e-58  Click
5 complement(1761534..1761725)  hypothetical protein; ECs1760  N/A  Click
6 complement(1761722..1761910)  DicB; ECs1761  N/A  Click
7 1762384..1762617  hypothetical protein; ECs1762  N/A  Click
8 complement(1762595..1763002)  PHAGE_Escher_TL_2011c: hypothetical protein; ECs1763; phage(gi418487085)  5e-12  Click
9 complement(1763025..1763243)  hypothetical protein; ECs1764  N/A  Click
10 complement(1763316..1763615)  hypothetical protein; ECs5428  N/A  Click
11 complement(1763879..1764286)  PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECs1765; phage(gi401817574)  1e-32  Click
12 1764363..1764590  PHAGE_Pectob_ZF40: putative cro anti-repressor; ECs1766; phage(gi422936651)  3e-09  Click
13 1764574..1765125  hypothetical protein; ECs1767  N/A  Click
14 1765097..1766137  PHAGE_Escher_TL_2011b: hypothetical protein; ECs1768; phage(gi418487646)  3e-43  Click
15 1765926..1766591  PHAGE_Escher_HK639: replication protein 14; ECs1769; phage(gi356870655)  7e-32  Click
16 1768219..1768977  colonization factor; ECs1772  N/A  Click
17 1769256..1769468  PHAGE_Stx2_c_II: putative host killer protein; ECs1773; phage(gi302393105)  2e-22  Click
18 1769689..1769946  hypothetical protein; ECs1774  N/A  Click
19 1770016..1770294  PHAGE_Cronob_phiES15: hypothetical protein; ECs1775; phage(gi401817580)  2e-13  Click
20 1770296..1771342  PHAGE_Entero_mEp460: hypothetical protein; ECs1776; phage(gi428782365)  2e-109  Click
21 1771355..1771714  PHAGE_Escher_HK75: RusA-like protein; ECs1777; phage(gi356870726)  6e-36  Click
22 1771723..1772253  hypothetical protein; ECs1778  N/A  Click
23 1772372..1772692  PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs1779; phage(gi18249887)  1e-29  Click
24 1772843..1773901  PHAGE_Entero_phiP27: putative DNA methylase; ECs1780; phage(gi18249888)  0.0  Click
25 1773942..1774017  tRNA  N/A  Click
26 1774098..1774174  tRNA  N/A  Click
27 1774698..1776551  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1781; phage(gi209427766)  0.0  Click
28 1776701..1776916  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1782; phage(gi209447171)  7e-35  Click
29 1776921..1777265  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1783; phage(gi209427768)  9e-61  Click
30 1777316..1777849  PHAGE_Entero_2008: putative endolysin; ECs1784; phage(gi209427769)  4e-104  Click
31 1778120..1778689  PHAGE_Entero_2008: putative antirepressor; ECs1785; phage(gi209427770)  7e-107  Click
32 1778843..1779310  PHAGE_Entero_2008: putative endopeptidase; ECs1786; phage(gi209427771)  1e-82  Click
33 complement(1779673..1779900)  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1788; phage(gi209427772)  5e-38  Click
34 1779942..1780307  PHAGE_Entero_2008: putative DNAse; ECs1789; phage(gi209427773)  4e-67  Click
35 complement(1779960..1780205)  hypothetical protein; ECs5431  N/A  Click
36 1780597..1781160  PHAGE_Entero_2008: putative phage terminase; ECs1791; phage(gi209427774)  1e-95  Click
37 1781157..1782818  PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1792; phage(gi209427775)  0.0  Click
38 1782882..1784819  PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1793; phage(gi209427776)  0.0  Click
39 1785031..1787610  PHAGE_Entero_2008: putative portal protein; ECs1795; phage(gi209427777)  0.0  Click
40 1787613..1787939  PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1796; phage(gi209427778)  3e-55  Click
41 1787949..1788299  PHAGE_Entero_2008: putative head-tail adaptor; ECs1797; phage(gi209427779)  8e-62  Click
42 1788296..1788742  PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1798; phage(gi209427780)  6e-79  Click
43 1788739..1789083  PHAGE_Entero_2008: putative prophage structural protein; ECs1799; phage(gi209427781)  6e-60  Click
44 1789013..1789858  PHAGE_Entero_2008: putative tail protein; ECs1800; phage(gi209427782)  8e-130  Click
45 1789864..1790238  PHAGE_Entero_2008: putative tail assembly protein; ECs1801; phage(gi209427783)  2e-65  Click
46 1790262..1790543  PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1802; phage(gi209427784)  6e-47  Click
47 1790596..1793676  PHAGE_Entero_2008: putative tail protein; ECs1803; phage(gi209427785)  0.0  Click
48 1793669..1794010  PHAGE_Entero_2008: putative minor tail protein; ECs1804; phage(gi209427786)  4e-64  Click
49 1794010..1794447  PHAGE_Entero_2008: putative tail protein; ECs1805; phage(gi209427787)  2e-64  Click
50 1794635..1798111  PHAGE_Entero_2008: phage-related tail protein; ECs1806; phage(gi209427791)  0.0  Click
51 1798179..1798778  PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs1807; phage(gi209427792)  1e-94  Click
52 1798930..1800243  PHAGE_Entero_2008: putative tail protein; ECs1808; phage(gi209427793)  0.0  Click
53 1800245..1800514  PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs1809; phage(gi209427794)  1e-43  Click
54 complement(1801541..1802866)  PHAGE_Entero_4795: NleA4795 protein; ECs1812; phage(gi157166068)  0.0  Click
55 1803080..1803091  attR    TTAAATTATTGT  N/A  Click
56 1803169..1803180  attL    TTTTAATGAAAA  N/A  Click
57 complement(1803527..1804219)  PHAGE_Entero_mEp235: integrase; ECs1813; phage(gi428781836)  4e-113  Click
58 1804693..1805604  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECs1814; phage(gi148609405)  2e-146  Click
59 1805670..1806239  hypothetical protein; ECs1815  N/A  Click
60 complement(1807205..1808743)  PHAGE_Stx2_c_1717: transposase; ECs1818; phage(gi209447153)  0.0  Click
61 complement(1808793..1809140)  PHAGE_Stx2_c_1717: transposase; ECs1819; phage(gi209447152)  2e-62  Click
62 complement(1809137..1809517)  PHAGE_Stx2_c_1717: truncated transposase; ECs1820; phage(gi209447151)  9e-69  Click
63 complement(1809857..1810135)  hypothetical protein; ECs1821  N/A  Click
64 complement(1810846..1811493)  PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs1824; phage(gi209427795)  9e-29  Click
65 1811656..1811667  attR    TTTTAATGAAAA  N/A  Click
Region 10, total : 68 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 complement(1920485..1921420)  PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ECs1928; phage(gi155370502)  3e-08  Click
2 1921441..1921452  attL    AAATGGGGCAAA  N/A  Click
3 complement(1921472..1922707)  PHAGE_Entero_2008: putative integrase; ECs1929; phage(gi209427727)  3e-90  Click
4 complement(1922709..1922924)  hypothetical protein; ECs1930  N/A  Click
5 complement(1923024..1923212)  hypothetical protein; ECs1931  N/A  Click
6 complement(1923250..1923399)  restriction alleviation and modification protein; ECs1932  N/A  Click
7 complement(1923455..1924264)  PHAGE_Entero_epsilon15: RecT; ECs1933; phage(gi30387413)  1e-80  Click
8 complement(1924257..1926857)  PHAGE_Erwini_phiEt88: exodeoxyribonuclease; ECs1934; phage(gi327198600)  8e-83  Click
9 complement(1926959..1927234)  hypothetical protein; ECs1935  N/A  Click
10 complement(1927309..1927485)  PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; ECs5433; phage(gi169257260)  4e-06  Click
11 complement(1927479..1927712)  PHAGE_Escher_P13374: host killing protein; ECs1936; phage(gi410491620)  8e-06  Click
12 1928142..1928630  PHAGE_Entero_lambda: Superinfection exclusion protein B; ECs1937; phage(gi19263394)  1e-07  Click
13 complement(1928627..1928782)  PHAGE_Salico_CGphi29: hypothetical protein; ECs1939; phage(gi472340166)  7e-10  Click
14 complement(1928793..1928972)  hypothetical protein; ECs1940  N/A  Click
15 complement(1929215..1929526)  PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECs1941; phage(gi401817574)  4e-11  Click
16 1929714..1929968  PHAGE_Escher_HK75: regulatory protein cro; ECs1942; phage(gi356870715)  5e-19  Click
17 1929965..1930387  PHAGE_Entero_mEp237: CII protein; ECs1943; phage(gi435439306)  1e-08  Click
18 1930465..1931253  PHAGE_Escher_TL_2011b: hypothetical protein; ECs1944; phage(gi418487646)  5e-44  Click
19 1931260..1932006  PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs1945; phage(gi169257280)  3e-76  Click
20 1931978..1932790  hypothetical protein; ECs1946  N/A  Click
21 1932806..1933228  hypothetical protein; ECs1948  N/A  Click
22 1933334..1933546  hypothetical protein; ECs1949  N/A  Click
23 1933798..1934061  PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ECs1950; phage(gi399498823)  3e-23  Click
24 1934072..1934233  PHAGE_Salmon_c341: Truncated P22 EaA protein; ECs1951; phage(gi255252704)  1e-15  Click
25 1934312..1934557  PHAGE_Salmon_ST64B: hypothetical protein sb32; ECs1952; phage(gi23505476)  1e-08  Click
26 1934989..1936140  PHAGE_Ostreo_2: putative cytosine-specific methyltransferase; ECs1953; phage(gi314055145)  7e-27  Click
27 complement(1936108..1937097)  hypothetical protein; ECs1954  N/A  Click
28 complement(1937097..1938488)  hypothetical protein; ECs1955  N/A  Click
29 1938988..1939587  PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; ECs1956; phage(gi169257286)  6e-55  Click
30 1939587..1939877  PHAGE_Erwini_phiEt88: hypothetical protein; ECs1957; phage(gi327198620)  2e-34  Click
31 1939874..1940428  PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECs1958; phage(gi399528832)  7e-07  Click
32 1940568..1940643  tRNA  N/A  Click
33 1940651..1940730  tRNA  N/A  Click
34 1940744..1940820  tRNA  N/A  Click
35 1940990..1941421  PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs1959; phage(gi431810338)  3e-30  Click
36 1941418..1941585  PHAGE_Entero_P1: TciB; ECs1960; phage(gi46401695)  1e-08  Click
37 1941996..1943849  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1961; phage(gi209427766)  0.0  Click
38 1943999..1944214  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1962; phage(gi209447171)  1e-33  Click
39 1944219..1944563  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1963; phage(gi209427768)  1e-56  Click
40 1944614..1945147  PHAGE_Entero_2008: putative endolysin; ECs1964; phage(gi209427769)  4e-104  Click
41 1945418..1945987  PHAGE_Entero_2008: putative antirepressor; ECs1965; phage(gi209427770)  7e-107  Click
42 1946141..1946608  PHAGE_Entero_2008: putative endopeptidase; ECs1966; phage(gi209427771)  1e-82  Click
43 complement(1946971..1947198)  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1967; phage(gi209427772)  5e-38  Click
44 1947240..1947605  PHAGE_Entero_2008: putative DNAse; ECs1968; phage(gi209427773)  4e-67  Click
45 complement(1947258..1947503)  hypothetical protein; ECs5437  N/A  Click
46 1947895..1948458  PHAGE_Entero_2008: putative phage terminase; ECs1970; phage(gi209427774)  1e-95  Click
47 1948455..1950116  PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1971; phage(gi209427775)  0.0  Click
48 1950180..1952117  PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1972; phage(gi209427776)  0.0  Click
49 1952162..1952383  PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5438; phage(gi209427801)  2e-36  Click
50 1952329..1953693  PHAGE_Entero_2008: putative portal protein; ECs1974; phage(gi209427777)  0.0  Click
51 1953690..1954913  PHAGE_Entero_2008: putative portal protein; ECs1975; phage(gi209427777)  0.0  Click
52 1954910..1955236  PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1976; phage(gi209427778)  9e-56  Click
53 1955246..1955596  PHAGE_Entero_2008: putative head-tail adaptor; ECs1977; phage(gi209427779)  2e-61  Click
54 1955593..1956039  PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1978; phage(gi209427780)  6e-79  Click
55 1956036..1956380  PHAGE_Entero_2008: putative prophage structural protein; ECs1979; phage(gi209427781)  3e-59  Click
56 1956449..1957165  PHAGE_Entero_2008: putative tail protein; ECs1980; phage(gi209427782)  2e-122  Click
57 1957171..1957545  PHAGE_Entero_2008: putative tail assembly protein; ECs1981; phage(gi209427783)  6e-65  Click
58 1957569..1957850  PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1982; phage(gi209427784)  6e-47  Click
59 1957902..1960982  PHAGE_Entero_2008: putative tail protein; ECs1983; phage(gi209427785)  0.0  Click
60 1960975..1961316  PHAGE_Entero_2008: putative minor tail protein; ECs1984; phage(gi209427786)  1e-63  Click
61 1961316..1962014  PHAGE_Entero_2008: putative tail protein; ECs1985; phage(gi209427787)  1e-126  Click
62 1962025..1962768  PHAGE_Entero_2008: putative tail component K-like protein; ECs1986; phage(gi209427789)  2e-140  Click
63 1962666..1963346  PHAGE_Entero_2008: putative tail assembly protein; ECs1987; phage(gi209427790)  2e-120  Click
64 1963300..1963506  hypothetical protein; ECs1988  N/A  Click
65 complement(1963537..1964064)  PHAGE_Salmon_1: hypothetical bacteriophage protein; ECs1989; phage(gi169257202)  3e-61  Click
66 1964198..1967695  PHAGE_Entero_2008: phage-related tail protein; ECs1990; phage(gi209427791)  0.0  Click
67 1967766..1968365  PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs1991; phage(gi209427792)  6e-112  Click
68 1968658..1969743  PHAGE_Entero_2008: putative tail protein; ECs1992; phage(gi209427793)  3e-158  Click
69 1969673..1970014  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip028; ECs1993; phage(gi20065824)  3e-58  Click
70 1970127..1970702  PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs1994; phage(gi209427796)  6e-20  Click
71 1970775..1971404  PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs1995; phage(gi209427795)  5e-79  Click
72 1971486..1972127  PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs1996; phage(gi209427796)  2e-119  Click
73 1972367..1972378  attR    AAATGGGGCAAA  N/A  Click
Region 11, total : 133 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2155111..2155314  PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECs2150; phage(gi410491512)  1e-13  Click
2 complement(2155350..2156810)  PHAGE_Microm_MpV1: hypothetical protein; ECs2151; phage(gi313768442)  4e-41  Click
3 complement(2156899..2158182)  PHAGE_Burkho_phi1026b: gp59; ECs2152; phage(gi38707949)  2e-33  Click
4 2158314..2158556  PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2153; phage(gi209427797)  1e-29  Click
5 complement(2158718..2159359)  PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs2154; phage(gi209427796)  7e-117  Click
6 complement(2159441..2160070)  PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2155; phage(gi209427795)  4e-79  Click
7 complement(2160143..2160718)  PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs2156; phage(gi209427796)  8e-20  Click
8 complement(2160832..2161101)  PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs2157; phage(gi209427794)  5e-45  Click
9 complement(2161515..2162324)  PHAGE_Entero_2008: putative tail protein; ECs2159; phage(gi209427793)  4e-122  Click
10 complement(2162389..2162988)  PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2160; phage(gi209427792)  2e-114  Click
11 complement(2163056..2166535)  PHAGE_Entero_2008: phage-related tail protein; ECs2161; phage(gi209427791)  0.0  Click
12 2166004..2166015  attL    TAAAGGGCCGGG  N/A  Click
13 complement(2166776..2167453)  PHAGE_Entero_2008: putative tail assembly protein; ECs2162; phage(gi209427790)  2e-117  Click
14 complement(2167351..2168034)  PHAGE_Entero_2008: putative tail component K-like protein; ECs2163; phage(gi209427789)  4e-104  Click
15 complement(2167863..2168093)  PHAGE_Entero_2008: putative tail component K-like protein; ECs5445; phage(gi209427789)  5e-28  Click
16 complement(2168104..2168802)  PHAGE_Entero_2008: putative tail protein; ECs2164; phage(gi209427787)  5e-130  Click
17 complement(2168802..2169131)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2165; phage(gi15832202)  4e-60  Click
18 complement(2169128..2171740)  PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECs2166; phage(gi15832203)  0.0  Click
19 complement(2171721..2172134)  PHAGE_Entero_HK630: tail assembly protein GT; ECs2167; phage(gi428782802)  3e-46  Click
20 complement(2172161..2172583)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2168; phage(gi15832205)  7e-74  Click
21 complement(2172597..2173349)  PHAGE_Entero_HK630: major tail protein V; ECs2169; phage(gi428782800)  1e-112  Click
22 complement(2173357..2173752)  PHAGE_Entero_HK630: minor tail protein U; ECs2170; phage(gi428782799)  6e-59  Click
23 complement(2173749..2174282)  PHAGE_Entero_HK630: minor tail protein Z; ECs2171; phage(gi428782798)  2e-65  Click
24 complement(2174297..2174650)  PHAGE_Entero_HK630: head-tail connector Fii; ECs2172; phage(gi428782797)  2e-58  Click
25 complement(2174662..2175060)  PHAGE_Entero_HK225: head assembly protein Fi; ECs2173; phage(gi428782384)  7e-21  Click
26 complement(2175102..2176127)  PHAGE_Entero_HK630: major head subunit E; ECs2174; phage(gi428782795)  0.0  Click
27 complement(2176183..2176515)  PHAGE_Entero_HK630: head decoration protein D; ECs2175; phage(gi428782794)  7e-58  Click
28 complement(2176525..2177844)  PHAGE_Entero_HK630: head maturation protease C; ECs2176; phage(gi428782792)  0.0  Click
29 complement(2177825..2179426)  PHAGE_Entero_HK630: portal protein B; ECs2177; phage(gi428782791)  0.0  Click
30 complement(2179423..2179629)  PHAGE_Entero_HK630: head-tail connector W; ECs2178; phage(gi428782790)  1e-31  Click
31 complement(2179626..2181551)  PHAGE_Entero_HK630: terminase large subunit A; ECs2179; phage(gi428782789)  0.0  Click
32 complement(2181526..2182071)  PHAGE_Entero_HK630: terminase small subunit nu1; ECs2180; phage(gi428782788)  2e-81  Click
33 2182458..2182682  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs2181; phage(gi209427772)  3e-19  Click
34 complement(2182764..2183078)  transcriptional regulator; ECs2182  N/A  Click
35 complement(2183542..2184000)  PHAGE_Stx2_c_I: endopeptidase; ECs2184; phage(gi20065955)  3e-64  Click
36 complement(2184158..2184727)  PHAGE_Entero_2008: putative antirepressor; ECs2185; phage(gi209427770)  2e-106  Click
37 complement(2184998..2185531)  PHAGE_Entero_2008: putative endolysin; ECs2186; phage(gi209427769)  4e-103  Click
38 complement(2185582..2185926)  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2187; phage(gi209427768)  9e-61  Click
39 complement(2185931..2186137)  PHAGE_Entero_2008: lysis protein; ECs2188; phage(gi209427767)  6e-33  Click
40 2186145..2186306  hypothetical protein; ECs5446  N/A  Click
41 complement(2186628..2188436)  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2189; phage(gi209427766)  0.0  Click
42 complement(2188914..2189345)  PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2190; phage(gi431810338)  1e-28  Click
43 complement(2189515..2189591)  tRNA  N/A  Click
44 complement(2189605..2189684)  tRNA  N/A  Click
45 complement(2189692..2189767)  tRNA  N/A  Click
46 complement(2189796..2190383)  transcriptional regulator; ECs2191  N/A  Click
47 complement(2190645..2190842)  PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs2192; phage(gi18249887)  7e-29  Click
48 complement(2191067..2191621)  PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECs2193; phage(gi399528832)  1e-06  Click
49 complement(2191684..2191989)  PHAGE_Escher_HK75: RusA-like protein; ECs2194; phage(gi356870726)  2e-32  Click
50 complement(2192002..2193084)  PHAGE_Entero_mEp460: hypothetical protein; ECs2195; phage(gi428782365)  6e-112  Click
51 complement(2193053..2193325)  PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECs2196; phage(gi169257287)  5e-14  Click
52 complement(2193447..2193791)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ECs2197; phage(gi20065865)  8e-59  Click
53 complement(2193911..2194123)  PHAGE_Stx2_c_II: putative host killer protein; ECs2198; phage(gi302393105)  4e-33  Click
54 complement(2194357..2194914)  PHAGE_Escher_TL_2011c: hypothetical protein; ECs2199; phage(gi418487081)  6e-28  Click
55 complement(2194916..2195134)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ECs2200; phage(gi20065885)  3e-24  Click
56 complement(2195262..2195573)  PHAGE_Entero_mEp213: hypothetical protein; ECs2201; phage(gi428782634)  9e-21  Click
57 complement(2195566..2195793)  PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECs2202; phage(gi169257161)  2e-16  Click
58 complement(2195790..2196071)  hypothetical protein; ECs2203  N/A  Click
59 complement(2196104..2196838)  hypothetical protein; ECs2204  N/A  Click
60 complement(2196854..2197516)  PHAGE_Escher_HK639: replication protein 14; ECs2205; phage(gi356870655)  9e-29  Click
61 complement(2197308..2198351)  PHAGE_Escher_TL_2011b: hypothetical protein; ECs2206; phage(gi418487646)  3e-48  Click
62 complement(2198420..2198845)  PHAGE_Escher_HK639: cII; ECs2207; phage(gi356870652)  2e-05  Click
63 complement(2198829..2199071)  PHAGE_Pectob_ZF40: putative cro anti-repressor; ECs2208; phage(gi422936651)  5e-09  Click
64 2199277..2199801  PHAGE_Pectob_ZF40: putative cI repressor; ECs2209; phage(gi422936650)  2e-14  Click
65 2200013..2200246  PHAGE_Salico_CGphi29: hypothetical protein; ECs2210; phage(gi472340166)  5e-09  Click
66 2200258..2200896  PHAGE_Escher_TL_2011c: hypothetical protein; ECs2211; phage(gi418487085)  6e-09  Click
67 complement(2200897..2201106)  hypothetical protein; ECs2212  N/A  Click
68 complement(2201155..2201415)  hypothetical protein; ECs2213  N/A  Click
69 2201671..2201859  cell division inhibitor; ECs2214  N/A  Click
70 2201856..2202044  hypothetical protein; ECs2215  N/A  Click
71 2202137..2203381  PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECs2216; phage(gi169257272)  7e-92  Click
72 2203363..2203914  PHAGE_Entero_2008: putative integrase; ECs2217; phage(gi209427727)  2e-61  Click
73 2204020..2204274  PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2218; phage(gi209427797)  2e-11  Click
74 complement(2204277..2205167)  PROPHAGE_Escher_Sakai: putative transposase; ECs2219; phage(gi15834498)  2e-173  Click
75 complement(2205164..2205490)  PHAGE_Stx2_c_II: putative transposase; ECs2220; phage(gi302393161)  1e-58  Click
76 complement(2205697..2206566)  PROPHAGE_Escher_CFT073: transposase; ECs2221; phage(gi26246249)  1e-126  Click
77 2206610..2206990  PHAGE_Stx2_c_1717: truncated transposase; ECs2222; phage(gi209447151)  9e-69  Click
78 2206987..2207334  PHAGE_Stx2_c_1717: transposase; ECs2223; phage(gi209447152)  2e-62  Click
79 2207384..2208922  PHAGE_Stx2_c_1717: transposase; ECs2224; phage(gi209447153)  0.0  Click
80 complement(2209505..2209876)  PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2226; phage(gi209427795)  3e-18  Click
81 complement(2210140..2210487)  PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp79; ECs2227; phage(gi209447202)  2e-50  Click
82 complement(2210866..2211375)  PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2229; phage(gi209427795)  3e-21  Click
83 complement(2211555..2211824)  PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs2230; phage(gi209427794)  5e-45  Click
84 complement(2211826..2213049)  PHAGE_Entero_2008: putative tail protein; ECs2231; phage(gi209427793)  0.0  Click
85 complement(2213114..2213713)  PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2232; phage(gi209427792)  2e-114  Click
86 complement(2217597..2218277)  PHAGE_Entero_2008: putative tail assembly protein; ECs2236; phage(gi209427790)  1e-120  Click
87 complement(2218175..2218849)  PHAGE_Entero_2008: putative tail component K-like protein; ECs2237; phage(gi209427789)  2e-127  Click
88 complement(2218929..2219627)  PHAGE_Entero_2008: putative tail protein; ECs2238; phage(gi209427787)  1e-128  Click
89 complement(2219627..2219968)  PHAGE_Entero_2008: putative minor tail protein; ECs2239; phage(gi209427786)  4e-64  Click
90 complement(2219961..2223203)  PHAGE_Entero_2008: putative tail protein; ECs2240; phage(gi209427785)  0.0  Click
91 complement(2223251..2223532)  PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs2241; phage(gi209427784)  1e-47  Click
92 complement(2223556..2223930)  PHAGE_Entero_2008: putative tail assembly protein; ECs2242; phage(gi209427783)  4e-67  Click
93 complement(2223945..2224661)  PHAGE_Entero_2008: putative tail protein; ECs2243; phage(gi209427782)  1e-131  Click
94 complement(2224727..2225071)  PHAGE_Entero_2008: putative prophage structural protein; ECs2244; phage(gi209427781)  6e-60  Click
95 complement(2225068..2225514)  PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs2245; phage(gi209427780)  6e-79  Click
96 complement(2225511..2225861)  PHAGE_Entero_2008: putative head-tail adaptor; ECs2246; phage(gi209427779)  8e-62  Click
97 complement(2225871..2226197)  PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs2247; phage(gi209427778)  3e-55  Click
98 complement(2226200..2228779)  PHAGE_Entero_2008: putative portal protein; ECs2248; phage(gi209427777)  0.0  Click
99 complement(2228725..2228946)  PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5451; phage(gi209427801)  2e-36  Click
100 complement(2228991..2230928)  PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs2250; phage(gi209427776)  0.0  Click
101 complement(2230992..2232653)  PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs2251; phage(gi209427775)  0.0  Click
102 complement(2232650..2233213)  PHAGE_Entero_2008: putative phage terminase; ECs2252; phage(gi209427774)  1e-95  Click
103 complement(2233397..2233540)  hypothetical protein; ECs2253  N/A  Click
104 complement(2233503..2233868)  PHAGE_Entero_2008: putative DNAse; ECs2254; phage(gi209427773)  4e-67  Click
105 2233910..2234137  PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs2255; phage(gi209427772)  5e-38  Click
106 complement(2234500..2234967)  PHAGE_Entero_2008: putative endopeptidase; ECs2257; phage(gi209427771)  1e-82  Click
107 complement(2235121..2235690)  PHAGE_Entero_2008: putative antirepressor; ECs2258; phage(gi209427770)  7e-107  Click
108 complement(2235961..2236494)  PHAGE_Entero_2008: putative endolysin; ECs2259; phage(gi209427769)  4e-104  Click
109 complement(2236545..2236889)  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2260; phage(gi209427768)  9e-61  Click
110 complement(2236894..2237100)  PHAGE_Entero_2008: lysis protein; ECs2261; phage(gi209427767)  6e-33  Click
111 2237108..2237254  hypothetical protein; ECs5452  N/A  Click
112 complement(2237549..2239399)  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2262; phage(gi209427766)  0.0  Click
113 complement(2239448..2239576)  hypothetical protein; ECs2263  N/A  Click
114 complement(2239721..2239987)  hypothetical protein; ECs2264  N/A  Click
115 complement(2239878..2240306)  PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2265; phage(gi431810338)  3e-26  Click
116 complement(2240486..2240562)  tRNA  N/A  Click
117 complement(2240576..2240652)  tRNA  N/A  Click
118 complement(2240660..2240735)  tRNA  N/A  Click
119 2240727..2240738  attR    TAAAGGGCCGGG  N/A  Click
120 complement(2240946..2241635)  PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs2267; phage(gi169257244)  1e-80  Click
121 complement(2241632..2241991)  PHAGE_Escher_HK75: RusA-like protein; ECs2268; phage(gi356870726)  1e-38  Click
122 complement(2242004..2243053)  PHAGE_Entero_mEp460: hypothetical protein; ECs2269; phage(gi428782365)  4e-110  Click
123 complement(2243501..2243713)  PHAGE_Stx2_c_II: putative host killer protein; ECs5456; phage(gi302393105)  2e-29  Click
124 2243758..2243913  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip072; ECs2270; phage(gi20065867)  7e-11  Click
125 complement(2243902..2244006)  hypothetical protein; ECs2271  N/A  Click
126 complement(2244122..2244706)  PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ECs2272; phage(gi148609417)  2e-14  Click
127 complement(2244763..2245158)  hypothetical protein; ECs2273  N/A  Click
128 complement(2245174..2245842)  PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECs2274; phage(gi116222030)  1e-05  Click
129 complement(2245764..2245943)  hypothetical protein; ECs5457  N/A  Click
130 complement(2245969..2246709)  PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs2275; phage(gi169257280)  8e-77  Click
131 complement(2246716..2247627)  PHAGE_Entero_phiP27: hypothetical protein P27p17; ECs2276; phage(gi18249881)  6e-27  Click
132 complement(2247701..2248126)  PHAGE_Entero_mEp237: CII protein; ECs2277; phage(gi435439306)  3e-05  Click
133 complement(2248123..2248425)  PHAGE_Entero_c_1: prophage antirepressor; ECs2278; phage(gi428781783)  5e-08  Click
134 2248460..2248894  hypothetical protein; ECs2279  N/A  Click
135 2248879..2249106  hypothetical protein; ECs2280  N/A  Click
136 2249108..2249386  hypothetical protein; ECs2281  N/A  Click
137 2249591..2249755  hypothetical protein; ECs2282  N/A  Click
138 2249682..2250038  hypothetical protein; ECs2283  N/A  Click
139 2250110..2250328  hypothetical protein; ECs5458  N/A  Click
140 2250897..2251085  inhibitor of cell division; ECs2284  N/A  Click
141 2251082..2251273  hypothetical protein; ECs2285  N/A  Click
142 2251366..2253837  PHAGE_Entero_mEp460: putative exonuclease; ECs2286; phage(gi428782342)  4e-58  Click
Region 12, total : 50 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2668007..2668037  attL    TGGCGGAGAGAGGGGGATTTGAACCCCCGGT  N/A  Click
2 complement(2676725..2677402)  PROPHAGE_Escher_Sakai: putative tail assembly protein; ECs2721; phage(gi15832199)  7e-126  Click
3 complement(2677300..2677869)  PROPHAGE_Escher_Sakai: putative tail assembly protein; ECs2722; phage(gi15832200)  8e-116  Click
4 complement(2678054..2678752)  PHAGE_Entero_HK630: minor tail protein L; ECs2723; phage(gi428782805)  4e-104  Click
5 complement(2678752..2679081)  PHAGE_Entero_HK630: minor tail protein M; ECs2724; phage(gi428782804)  5e-46  Click
6 complement(2681637..2681942)  PHAGE_Entero_HK630: tail assembly protein GT; ECs2727; phage(gi428782802)  8e-28  Click
7 complement(2682077..2682508)  PHAGE_Entero_HK630: minor tail protein G; ECs2728; phage(gi428782801)  5e-45  Click
8 complement(2682522..2683184)  PHAGE_Entero_HK630: major tail protein V; ECs2729; phage(gi428782800)  5e-97  Click
9 complement(2683244..2683510)  PHAGE_Entero_HK630: major head subunit E; ECs2730; phage(gi428782795)  2e-20  Click
10 complement(2683568..2683915)  PHAGE_Entero_HK630: head decoration protein D; ECs2731; phage(gi428782794)  6e-25  Click
11 complement(2683952..2685457)  PHAGE_Entero_HK630: head maturation protease C; ECs2732; phage(gi428782792)  4e-108  Click
12 complement(2685447..2687039)  PHAGE_Entero_HK630: portal protein B; ECs2733; phage(gi428782791)  0.0  Click
13 complement(2687036..2687242)  PHAGE_Entero_HK630: head-tail connector W; ECs2734; phage(gi428782790)  1e-11  Click
14 complement(2687226..2689154)  PHAGE_Entero_HK630: terminase large subunit A; ECs2735; phage(gi428782789)  0.0  Click
15 complement(2689126..2689635)  PHAGE_Entero_HK630: terminase small subunit nu1; ECs2736; phage(gi428782788)  8e-18  Click
16 complement(2690336..2690650)  transcriptional regulator; ECs2737  N/A  Click
17 complement(2690892..2691032)  hypothetical protein; ECs5470  N/A  Click
18 complement(2691115..2691582)  PHAGE_Entero_4795: putative endopeptidase Rz; ECs2739; phage(gi157166036)  6e-69  Click
19 complement(2691734..2691916)  hypothetical protein; ECs2740  N/A  Click
20 complement(2692072..2692605)  PHAGE_Entero_4795: putative R protein; ECs2741; phage(gi157166033)  9e-100  Click
21 complement(2692656..2693000)  PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2742; phage(gi209427768)  6e-60  Click
22 complement(2693005..2693211)  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs2743; phage(gi209447171)  1e-32  Click
23 2693531..2693857  PHAGE_Stx2_c_II: putative transposase; ECs2744; phage(gi302393161)  1e-58  Click
24 2693854..2694744  PROPHAGE_Escher_Sakai: putative transposase; ECs2745; phage(gi15834498)  2e-173  Click
25 complement(2694826..2696676)  PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2746; phage(gi209427766)  0.0  Click
26 complement(2696990..2697157)  PHAGE_Entero_P1: TciB; ECs2748; phage(gi46401695)  3e-08  Click
27 complement(2697154..2697582)  PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2749; phage(gi431810338)  2e-26  Click
28 complement(2697756..2697832)  tRNA  N/A  Click
29 complement(2697846..2697922)  tRNA  N/A  Click
30 complement(2697930..2698005)  tRNA  N/A  Click
31 complement(2698216..2698905)  PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs2750; phage(gi169257244)  9e-80  Click
32 complement(2698902..2699261)  PHAGE_Escher_HK75: RusA-like protein; ECs2751; phage(gi356870726)  1e-37  Click
33 complement(2699274..2700323)  PHAGE_Entero_mEp460: hypothetical protein; ECs2752; phage(gi428782365)  4e-111  Click
34 complement(2700325..2700603)  PHAGE_Cronob_phiES15: hypothetical protein; ECs2753; phage(gi401817580)  1e-13  Click
35 complement(2700771..2700983)  PHAGE_Stx2_c_II: putative host killer protein; ECs2754; phage(gi302393105)  4e-27  Click
36 complement(2701170..2701274)  hypothetical protein; ECs2755  N/A  Click
37 complement(2701384..2701947)  PHAGE_Entero_mEp460: hypothetical protein; ECs2756; phage(gi428782343)  5e-41  Click
38 complement(2702074..2702385)  PHAGE_Entero_mEp213: hypothetical protein; ECs2757; phage(gi428782634)  2e-24  Click
39 complement(2702382..2702570)  hypothetical protein; ECs2758  N/A  Click
40 complement(2702567..2702923)  PHAGE_Entero_HK629: hypothetical protein; ECs2759; phage(gi428782046)  9e-16  Click
41 complement(2702920..2703144)  PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECs2760; phage(gi169257161)  4e-15  Click
42 complement(2703166..2703864)  hypothetical protein; ECs2761  N/A  Click
43 complement(2703899..2704561)  PHAGE_Escher_HK639: replication protein 14; ECs2762; phage(gi356870655)  1e-30  Click
44 complement(2704353..2705390)  PHAGE_Escher_TL_2011b: hypothetical protein; ECs2763; phage(gi418487646)  1e-46  Click
45 complement(2705459..2705884)  PHAGE_Pectob_ZF40: putative cII repressor; ECs2764; phage(gi422936652)  4e-06  Click
46 complement(2705881..2706108)  PHAGE_Entero_mEp390: prophage anti-repressor; ECs2765; phage(gi428782702)  5e-08  Click
47 2706203..2706850  PHAGE_Entero_mEp390: prophage repressor; ECs2766; phage(gi428782701)  2e-25  Click
48 2707125..2707277  PHAGE_Salico_CGphi29: hypothetical protein; ECs2767; phage(gi472340166)  1e-08  Click
49 2707758..2707946  cell division inhibition protein; ECs2768  N/A  Click
50 2707943..2708131  hypothetical protein; ECs2769  N/A  Click
51 2708227..2710425  PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECs2770; phage(gi23505474)  2e-20  Click
52 2710379..2710699  PHAGE_Entero_mEp460: putative exonuclease; ECs2771; phage(gi428782342)  3e-30  Click
53 2710758..2710961  hypothetical protein; ECs2772  N/A  Click
54 2710961..2711983  PHAGE_Salmon_ST64B: Integrase protein; ECs2773; phage(gi23505472)  2e-102  Click
55 2712036..2712066  attR    TGGCGGAGAGAGGGGGATTTGAACCCCCGGT  N/A  Click
Region 13, total : 81 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 2888774..2891011  PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp76; ECs2931; phage(gi302393159)  5e-44  Click
2 complement(2890818..2891708)  PROPHAGE_Escher_Sakai: putative transposase; ECs2932; phage(gi15834498)  2e-173  Click
3 complement(2891705..2892031)  PROPHAGE_Escher_Sakai: putative transposase; ECs2933; phage(gi15832212)  3e-58  Click
4 2892203..2892676  hypothetical protein; ECs2934  N/A  Click
5 2892298..2892309  attL    ATCGAAGAAATT  N/A  Click
6 complement(2892718..2893188)  hypothetical protein; ECs2935  N/A  Click
7 complement(2893235..2893954)  two-component response-regulatory protein YehT; ECs2936  N/A  Click
8 complement(2893951..2895636)  PHAGE_Entero_2008: putative 2-component sensor protein YehU; ECs2937; phage(gi209427798)  0.0  Click
9 2896151..2896399  PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2939; phage(gi209427797)  3e-40  Click
10 complement(2896767..2897075)  PHAGE_Stx2_c_II: putative tail fiber protein; ECs2940; phage(gi302393091)  2e-51  Click
11 complement(2897038..2898351)  PHAGE_Entero_2008: putative tail protein; ECs2941; phage(gi209427793)  0.0  Click
12 complement(2898416..2899015)  PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2942; phage(gi209427792)  1e-97  Click
13 complement(2902796..2903473)  PHAGE_Entero_2008: putative tail assembly protein; ECs2945; phage(gi209427790)  2e-117  Click
14 complement(2903371..2904114)  PHAGE_Entero_2008: putative tail component K-like protein; ECs2946; phage(gi209427789)  6e-139  Click
15 complement(2904125..2904823)  PHAGE_Entero_2008: putative tail protein; ECs2947; phage(gi209427787)  7e-129  Click
16 complement(2904823..2905152)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2948; phage(gi15832202)  4e-60  Click
17 complement(2905149..2907794)  PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECs2949; phage(gi15832203)  0.0  Click
18 complement(2907838..2908146)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2950; phage(gi15832204)  2e-57  Click
19 complement(2908173..2908595)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2951; phage(gi15832205)  2e-76  Click
20 complement(2908609..2909361)  PHAGE_Entero_HK630: major tail protein V; ECs2952; phage(gi428782800)  1e-112  Click
21 complement(2909369..2909767)  PROPHAGE_Escher_Sakai: putative minor tail protein U; ECs2953; phage(gi15832207)  1e-72  Click
22 complement(2909780..2910403)  PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2954; phage(gi15832208)  6e-112  Click
23 complement(2910406..2910687)  PHAGE_Entero_mEp460: hypothetical protein; ECs2955; phage(gi428782323)  6e-22  Click
24 complement(2910680..2911006)  PHAGE_Entero_mEp213: hypothetical protein; ECs2956; phage(gi428782595)  1e-32  Click
25 complement(2911094..2912110)  PHAGE_Entero_mEp213: head maturation protease; ECs2957; phage(gi428782594)  1e-162  Click
26 2912256..2912582  PROPHAGE_Escher_Sakai: putative transposase; ECs2958; phage(gi15832212)  3e-58  Click
27 2912579..2913469  PROPHAGE_Escher_Sakai: putative transposase; ECs2959; phage(gi15834498)  2e-173  Click
28 complement(2913472..2914578)  PHAGE_Entero_mEp213: head maturation protease; ECs2960; phage(gi428782594)  7e-122  Click
29 complement(2914376..2915878)  PROPHAGE_Escher_Sakai: putative portal protein; ECs2961; phage(gi15832215)  0.0  Click
30 complement(2915878..2916114)  PHAGE_Entero_mEp460: hypothetical protein; ECs2962; phage(gi428782319)  3e-23  Click
31 complement(2916087..2918210)  PROPHAGE_Escher_Sakai: putative terminase large subunit; ECs2963; phage(gi15832217)  0.0  Click
32 complement(2918207..2918683)  PHAGE_Salmon_1: bacteriophage terminase, small subunit; ECs2964; phage(gi169257184)  3e-47  Click
33 2918740..2918988  hypothetical protein; ECs5480  N/A  Click
34 complement(2919138..2919605)  PHAGE_Entero_2008: putative endopeptidase; ECs2966; phage(gi209427771)  1e-82  Click
35 complement(2919759..2920328)  PHAGE_Entero_2008: putative antirepressor; ECs2967; phage(gi209427770)  7e-107  Click
36 complement(2920599..2921132)  PHAGE_Stx2_c_II: endolysin; ECs2968; phage(gi302393165)  1e-103  Click
37 complement(2921137..2921352)  PHAGE_Stx2_c_II: holin; ECs2969; phage(gi302393164)  2e-35  Click
38 complement(2921430..2921675)  PHAGE_Escher_P13374: hypothetical protein; ECs2970; phage(gi410491644)  6e-39  Click
39 complement(2921716..2921895)  PHAGE_Escher_P13374: hypothetical protein; ECs2971; phage(gi410491643)  2e-28  Click
40 complement(2922033..2923979)  PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECs2972; phage(gi302861197)  0.0  Click
41 complement(2924490..2924759)  PHAGE_Entero_2008: Shiga toxin 1 subunit B; ECs2973; phage(gi209427764)  4e-46  Click
42 complement(2924769..2925716)  PHAGE_Entero_2008: Shiga toxin 1 subunit A; ECs2974; phage(gi209427763)  1e-176  Click
43 complement(2926223..2926657)  PHAGE_Stx1_converting: antitermination protein Q; ECs2975; phage(gi302861194)  2e-83  Click
44 complement(2926650..2926844)  PHAGE_Stx2_c_II: NinH protein; ECs2976; phage(gi302393155)  2e-32  Click
45 complement(2926841..2927446)  PHAGE_Stx1_converting: NinG protein; ECs2977; phage(gi302861192)  1e-118  Click
46 complement(2927439..2927648)  PHAGE_Entero_mEp234: NinF protein; ECs2978; phage(gi428782303)  1e-29  Click
47 complement(2927608..2928009)  PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECs2979; phage(gi302861190)  3e-76  Click
48 complement(2928012..2928188)  PHAGE_Entero_mEp234: NinE protein; ECs2980; phage(gi428782301)  4e-30  Click
49 complement(2928185..2928712)  PHAGE_Entero_2008: putative DNA N-6-adenine-methyltransferase; ECs2981; phage(gi209427758)  1e-101  Click
50 complement(2928709..2929155)  PHAGE_Entero_2008: putative recombination protein; ECs2982; phage(gi209427757)  4e-83  Click
51 complement(2929112..2929537)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ECs2983; phage(gi20065926)  1e-81  Click
52 complement(2929707..2929985)  PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECs2984; phage(gi209427755)  2e-51  Click
53 complement(2930056..2930346)  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECs2985; phage(gi20065923)  2e-49  Click
54 complement(2930343..2931044)  PHAGE_Entero_4795: putative replication protein P; ECs2986; phage(gi157166012)  1e-131  Click
55 complement(2931041..2931979)  PHAGE_Entero_4795: putative replication protein O; ECs2987; phage(gi157166011)  0.0  Click
56 complement(2932012..2932308)  PHAGE_Entero_mEpX1: CII protein; ECs2988; phage(gi428781917)  7e-48  Click
57 complement(2932423..2932641)  PHAGE_Entero_mEpX1: prophage antirepressor; ECs2989; phage(gi428781916)  3e-36  Click
58 2932759..2933397  PHAGE_Entero_mEpX1: prophage repressor; ECs2990; phage(gi428781915)  4e-121  Click
59 2933520..2933801  PHAGE_Entero_HK544: hypothetical protein; ECs2991; phage(gi428783256)  1e-47  Click
60 2933808..2934359  PHAGE_Entero_HK544: hypothetical protein; ECs2992; phage(gi428783255)  1e-95  Click
61 2934872..2935144  PHAGE_Entero_HK629: transcription antitermination protein N; ECs2993; phage(gi428782056)  7e-45  Click
62 complement(2935161..2935742)  PHAGE_Entero_HK140: superinfection exclusion protein; ECs2995; phage(gi428781984)  4e-109  Click
63 2936003..2936371  PHAGE_Stx2_c_I: Ea10 protein; ECs2996; phage(gi20065907)  5e-68  Click
64 2936444..2936608  PHAGE_Entero_HK630: CIII protein; ECs2997; phage(gi428782826)  1e-27  Click
65 2936451..2936720  PHAGE_Stx2_c_86: putative host killing protein Kil; ECs2998; phage(gi116222047)  6e-44  Click
66 2937098..2937883  PHAGE_Stx2_c_I: Bet protein; ECs3001; phage(gi20065900)  2e-151  Click
67 2937880..2938557  PHAGE_Entero_2008: putative exonuclease; ECs3002; phage(gi209427739)  2e-131  Click
68 2938551..2938739  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; ECs3003; phage(gi20065896)  5e-31  Click
69 2938712..2938903  PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECs3004; phage(gi20065894)  2e-29  Click
70 2938914..2939195  PHAGE_Entero_2008: hypothetical protein YYZ_gp11; ECs3005; phage(gi209427737)  7e-50  Click
71 2939294..2939515  PHAGE_Entero_2008: hypothetical protein YYZ_gp10; ECs3006; phage(gi209427736)  2e-37  Click
72 2939512..2940459  PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECs3007; phage(gi209427735)  0.0  Click
73 2940687..2940974  PHAGE_Entero_2008: hypothetical protein YYZ_gp07; ECs5481; phage(gi209427733)  2e-55  Click
74 2940971..2941327  PHAGE_Entero_2008: hypothetical protein YYZ_gp06; ECs3009; phage(gi209427732)  4e-65  Click
75 2941324..2941686  PHAGE_Entero_2008: hypothetical protein YYZ_gp05; ECs3010; phage(gi209427731)  7e-74  Click
76 2941774..2942016  PHAGE_Entero_2008: hypothetical protein YYZ_gp04; ECs3011; phage(gi209427730)  2e-40  Click
77 2942020..2942154  PHAGE_Entero_2008: hypothetical protein YYZ_gp03; ECs5482; phage(gi209427729)  3e-23  Click
78 2942173..2942427  PHAGE_Entero_2008: putative excisionase; ECs3012; phage(gi209427728)  4e-46  Click
79 2942359..2942370  attR    ATCGAAGAAATT  N/A  Click
80 2942461..2943747  PHAGE_Entero_2008: putative integrase; ECs3013; phage(gi209427727)  0.0  Click
81 2943822..2944469  transcriptional regulator; ECs3014  N/A  Click
82 complement(2944617..2945348)  transport system permease protein; ECs3015  N/A  Click
83 complement(2945353..2946279)  PHAGE_Plankt_PaV_LD: ABC transporter; ECs3016; phage(gi371496158)  4e-25  Click
Region 14, total : 27 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 3476233..3476481  PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; ECs3483; phage(gi148609412)  3e-41  Click
2 complement(3476983..3477573)  chaperone-like protein; ECs3485  N/A  Click
3 3477756..3478406  PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECs3486; phage(gi209447201)  4e-26  Click
4 3478485..3479543  hypothetical protein; ECs3487  N/A  Click
5 3479657..3479669  attL    ACACCAACAAAAA  N/A  Click
6 complement(3479673..3480095)  PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECs3488; phage(gi209447201)  5e-21  Click
7 complement(3480256..3480645)  PHAGE_Entero_4795: hypothetical protein PBV4795_ORF76; ECs3489; phage(gi157166061)  2e-68  Click
8 3480743..3481069  PHAGE_Stx2_c_1717: putative transposase; ECs3490; phage(gi209447180)  1e-58  Click
9 3481066..3481956  PROPHAGE_Escher_Sakai: putative transposase; ECs3491; phage(gi15834498)  2e-173  Click
10 complement(3481763..3482260)  PHAGE_Stx2_c_1717: transposase; ECs3492; phage(gi209447153)  8e-46  Click
11 complement(3482457..3482804)  PHAGE_Stx2_c_1717: transposase; ECs3493; phage(gi209447152)  2e-62  Click
12 complement(3482801..3483181)  PHAGE_Stx2_c_1717: truncated transposase; ECs3494; phage(gi209447151)  9e-69  Click
13 complement(3483538..3483882)  PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECs3496; phage(gi157166032)  3e-60  Click
14 complement(3483887..3484102)  PHAGE_Stx2_c_1717: holin protein S-like protein; ECs3497; phage(gi209447171)  7e-35  Click
15 complement(3484252..3486105)  PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECs3498; phage(gi209447169)  0.0  Click
16 3486346..3486675  hypothetical protein; ECs3499  N/A  Click
17 complement(3486766..3487482)  hypothetical protein; ECs3500  N/A  Click
18 complement(3487762..3488385)  PHAGE_Entero_mEpX1: late gene regulator Q; ECs3501; phage(gi428781929)  7e-116  Click
19 complement(3488382..3489047)  PHAGE_Stx2_c_1717: NinI protein; ECs3502; phage(gi209447164)  3e-130  Click
20 complement(3489044..3489655)  PHAGE_Stx2_c_1717: NinG protein; ECs3503; phage(gi209447163)  5e-101  Click
21 complement(3489630..3490196)  PHAGE_Xantho_Xp10: endonuclease of the HNH family with predicted DNA-binding module at C-terminus; ECs3504; phage(gi32128470)  2e-35  Click
22 3491224..3491619  lipoprotein; ECs3506  N/A  Click
23 complement(3491695..3492963)  PHAGE_Cafete_BV_PW1: hypothetical protein; ECs3507; phage(gi310831380)  6e-29  Click
24 complement(3493359..3493772)  hypothetical protein; ECs3508  N/A  Click
25 complement(3493870..3494268)  hypothetical protein; ECs3509  N/A  Click
26 complement(3494269..3495900)  hypothetical protein; ECs3510  N/A  Click
27 complement(3495897..3497210)  hypothetical protein; ECs3511  N/A  Click
28 complement(3497212..3498417)  PHAGE_Temper_1: integrase-like protein; ECs3512; phage(gi16271777)  8e-07  Click
29 3500189..3500201  attR    ACACCAACAAAAA  N/A  Click
Region 15, total : 19 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 4580800..4580811  attL    ACTTCAAATCCA  N/A  Click
2 4581059..4582240  PROPHAGE_Escher_Sakai: putative integrase; ECs4534; phage(gi15833788)  0.0  Click
3 4582339..4582689  PHAGE_Stx2_c_1717: putative transposase; ECs4535; phage(gi209447180)  4e-05  Click
4 4582702..4582884  hypothetical protein; ECs4536  N/A  Click
5 4582902..4583555  PHAGE_Entero_Sf6: putative transposase OrfB; ECs4537; phage(gi41057343)  3e-79  Click
6 4583573..4583716  hypothetical protein; ECs4538  N/A  Click
7 4583806..4584180  hypothetical protein; ECs4539  N/A  Click
8 4584177..4584668  hypothetical protein; ECs4540  N/A  Click
9 4584680..4584877  hypothetical protein; ECs4541  N/A  Click
10 4584962..4585303  hypothetical protein; ECs4542  N/A  Click
11 4586059..4586460  PHAGE_Stx2_c_1717: truncated transposase; ECs4545; phage(gi209447151)  8e-73  Click
12 4586457..4586804  PHAGE_Stx2_c_1717: transposase; ECs4546; phage(gi209447152)  2e-62  Click
13 4586854..4588392  PHAGE_Stx2_c_1717: transposase; ECs4547; phage(gi209447153)  0.0  Click
14 4588589..4588822  hypothetical protein; ECs4548  N/A  Click
15 complement(4589257..4590003)  PHAGE_Suid_h_1: large tegument protein; ECs4550; phage(gi51557505)  2e-08  Click
16 complement(4590088..4590366)  hypothetical protein; ECs4551  N/A  Click
17 complement(4590372..4590593)  EscF; ECs4552  N/A  Click
18 complement(4590629..4591036)  hypothetical protein; ECs4553  N/A  Click
19 complement(4591043..4591981)  PHAGE_Lactob_1: putative tail fibre protein; ECs4554; phage(gi226377752)  1e-07  Click
20 complement(4592002..4593126)  PHAGE_Strept_Sfi11: putative minor tail protein; ECs4555; phage(gi9635024)  3e-05  Click
21 4601341..4601352  attR    ACTTCAAATCCA  N/A  Click
Region 16, total : 60 CDS
# CDS_POSITION BLAST_HIT E-VALUE SEQUENCE
1 5041814..5042062  PHAGE_Entero_Mu: DNA binding protein ner; ECs4944; phage(gi9633495)  2e-06  Click
2 5042064..5044154  PROPHAGE_Escher_Sakai: phage transposase; ECs4945; phage(gi15834199)  0.0  Click
3 5044225..5045157  PHAGE_Entero_Mu: DNA transposition protein; ECs4946; phage(gi9633513)  1e-72  Click
4 5045160..5045381  hypothetical protein; ECs4947  N/A  Click
5 5045394..5045648  hypothetical protein; ECs4948  N/A  Click
6 5045650..5045931  PHAGE_Pseudo_MP38: host nuclease inhibitor protein; ECs4949; phage(gi215479937)  7e-11  Click
7 5045928..5046200  hypothetical protein; ECs4950  N/A  Click
8 5046205..5046498  hypothetical protein; ECs4951  N/A  Click
9 5046510..5047040  PHAGE_Entero_Mu: Gam; ECs4952; phage(gi9633500)  4e-52  Click
10 5047138..5047680  hypothetical protein; ECs4953  N/A  Click
11 5047684..5048217  PHAGE_Entero_Mu: hypothetical protein Mup11; ECs4954; phage(gi9633501)  1e-68  Click
12 5048217..5048732  PHAGE_Entero_Mu: hypothetical protein Mup12; ECs4955; phage(gi9633502)  2e-45  Click
13 5048997..5049287  hypothetical protein; ECs4956  N/A  Click
14 5049284..5049469  hypothetical protein; ECs5580  N/A  Click
15 5049466..5049840  hypothetical protein; ECs4957  N/A  Click
16 5049833..5050030  PHAGE_Pseudo_JG024: hypothetical protein; ECs4958; phage(gi418486984)  3e-05  Click
17 5050020..5050316  hypothetical protein; ECs4959  N/A  Click
18 5050313..5050822  PHAGE_Entero_Mu: hypothetical protein Mup16; ECs4960; phage(gi9633506)  4e-29  Click
19 5050892..5051317  PHAGE_Entero_Mu: putative transcription regulator; ECs4961; phage(gi9633511)  2e-22  Click
20 5051389..5051889  PHAGE_Xantho_CP1: hypothetical protein; ECs4962; phage(gi431811023)  5e-28  Click
21 5052108..5052554  PHAGE_Entero_SfV: putative Rz1 lytic protein; ECs4964; phage(gi19549039)  9e-14  Click
22 5052564..5052791  PHAGE_Vibrio_VP882: conjugative transfer protein; ECs4965; phage(gi126010902)  2e-05  Click
23 5052772..5053080  PHAGE_Entero_Mu: hypothetical protein Mup25; ECs4966; phage(gi9633516)  1e-09  Click
24 5053077..5053367  PHAGE_Entero_Mu: hypothetical protein Mup26; ECs4967; phage(gi9633517)  3e-26  Click
25 5053370..5053951  PHAGE_Entero_Mu: hypothetical protein Mup27; ECs4968; phage(gi9633518)  6e-55  Click
26 5053951..5055615  PHAGE_Entero_Mu: putative portal protein; ECs4969; phage(gi9633519)  0.0  Click
27 5055678..5057204  PHAGE_Entero_Mu: hypothetical protein Mup29; ECs4970; phage(gi9633520)  5e-162  Click
28 5057188..5058513  PHAGE_Entero_Mu: virion morphogenesis late F orf; ECs4971; phage(gi9633521)  1e-156  Click
29 5058632..5059105  PHAGE_Entero_Mu: putative virion morphogenesis protein; ECs4972; phage(gi9633522)  4e-40  Click
30 5059282..5060406  PHAGE_Entero_Mu: putative protease protein; ECs4973; phage(gi9633523)  4e-81  Click
31 5060406..5061353  PHAGE_Entero_Mu: major head subunit; ECs4974; phage(gi9633525)  5e-123  Click
32 5061397..5061783  PHAGE_Entero_Mu: hypothetical protein Mup35; ECs4975; phage(gi9633526)  4e-06  Click
33 5061780..5062199  PHAGE_Entero_Mu: hypothetical protein Mup36; ECs4976; phage(gi9633527)  2e-28  Click
34 5062196..5062756  PHAGE_Entero_Mu: hypothetical protein Mup37; ECs4977; phage(gi9633528)  4e-34  Click
35 5062757..5063002  PHAGE_Entero_Mu: hypothetical protein Mup38; ECs4978; phage(gi9633529)  3e-09  Click
36 5062999..5064501  PHAGE_Entero_Mu: major tail subunit; ECs4979; phage(gi9633530)  7e-139  Click
37 5064510..5064875  PHAGE_Entero_Mu: hypothetical protein Mup40; ECs4980; phage(gi9633531)  4e-27  Click
38 5064890..5065366  PHAGE_Entero_Mu: hypothetical protein Mup41; ECs4981; phage(gi9633532)  3e-24  Click
39 5065493..5067568  PHAGE_Entero_Mu: putative tape measure protein; ECs4982; phage(gi9633533)  7e-103  Click
40 5067534..5068904  PHAGE_Entero_Mu: putative DNA circulation protein; ECs4983; phage(gi9633534)  2e-71  Click
41 5068888..5070012  PHAGE_Entero_Mu: putative tail protein; ECs4984; phage(gi9633535)  2e-92  Click
42 5070002..5070616  PHAGE_Entero_Mu: putative baseplate assembly protein; ECs4985; phage(gi9633536)  2e-53  Click
43 5070609..5071046  PHAGE_Entero_Mu: hypothetical protein Mup46; ECs4986; phage(gi9633537)  1e-40  Click
44 5071043..5072128  PHAGE_Entero_Mu: hypothetical protein Mup47; ECs4987; phage(gi9633538)  2e-100  Click
45 5072119..5072679  PHAGE_Entero_Mu: hypothetical protein Mup48; ECs4988; phage(gi9633539)  1e-44  Click
46 5072679..5073590  PHAGE_Entero_Mu: tail fiber; ECs4989; phage(gi9633540)  2e-39  Click
47 complement(5073625..5074146)  PHAGE_Entero_Mu: tail fiber assembly protein; ECs4990; phage(gi19584573)  6e-18  Click
48 complement(5074226..5074429)  PHAGE_Entero_Mu: tail fiber; ECs4991; phage(gi9633540)  8e-06  Click
49 5074651..5075211  PHAGE_Entero_Mu: Gin; ECs4992; phage(gi9633542)  8e-78  Click
50 5075311..5077350  PHAGE_Entero_4795: hypothetical protein YjhS; ECs4993; phage(gi157166028)  0.0  Click
51 5077497..5077679  PHAGE_Escher_P13374: hypothetical protein; ECs4994; phage(gi410491643)  2e-12  Click
52 5077715..5077960  PHAGE_Escher_TL_2011c: hypothetical protein; ECs4995; phage(gi418487098)  3e-07  Click
53 complement(5077999..5078310)  hypothetical protein; ECs4996  N/A  Click
54 5078578..5078778  PHAGE_Entero_Mu: Com; ECs4997; phage(gi9633543)  4e-08  Click
55 complement(5078681..5078917)  hypothetical protein; ECs5581  N/A  Click
56 5078732..5079469  PHAGE_Entero_Mu: Mom; ECs4998; phage(gi9633544)  9e-106  Click
57 complement(5079801..5080598)  sorbose-permease PTS system IIC component; ECs5000  N/A  Click
58 complement(5080664..5081158)  sorbose-permease PTS system IIB component; ECs5001  N/A  Click
59 complement(5081158..5081565)  sorbose-permease PTS system IIA component; ECs5002  N/A  Click
60 complement(5081575..5082381)  PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; ECs5003; phage(gi116326757)  6e-12  Click