| Definition | Escherichia coli O157:H7 str. Sakai, complete genome. |
|---|---|
| Accession | NC_002695 |
| Length | 5,498,450 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 300052..300067 | attL GCACCATTTAAATCAA | N/A | Click |
| 2 | complement(300072..301046) | PHAGE_Entero_SfV: integrase; ECs0271; phage(gi19549014) | 4e-178 | Click |
| 3 | complement(300937..301182) | PHAGE_Entero_lambda: early gene regulator; ECs0272; phage(gi9626289) | 3e-16 | Click |
| 4 | complement(301422..301811) | PHAGE_Burkho_phiE202: gp9, Cpp15; ECs0273; phage(gi134288743) | 4e-08 | Click |
| 5 | complement(301939..302652) | PHAGE_Entero_HK106: prophage repressor; ECs0274; phage(gi428783326) | 3e-133 | Click |
| 6 | 302753..302953 | PHAGE_Entero_HK106: prophage antirepressor; ECs0275; phage(gi428783327) | 3e-31 | Click |
| 7 | 303072..303365 | PHAGE_Entero_lambda: cII protein; ECs0276; phage(gi9626294) | 6e-49 | Click |
| 8 | 304628..305422 | PHAGE_Entero_HK106: side tail fiber protein; ECs0280; phage(gi428783303) | 9e-22 | Click |
| 9 | 305422..306015 | PHAGE_Entero_HK106: tail fiber assembly protein; ECs0281; phage(gi428783304) | 4e-64 | Click |
| 10 | complement(305987..306430) | PHAGE_Entero_mEp213: tail fiber assembly protein; ECs0282; phage(gi428782612) | 2e-25 | Click |
| 11 | complement(306451..306861) | PHAGE_Erwini_ENT90: phage tail collar domain protein; ECs0283; phage(gi431810938) | 3e-14 | Click |
| 12 | 306891..307445 | PHAGE_Entero_2: DNA-invertase; ECs0284; phage(gi169936026) | 8e-89 | Click |
| 13 | complement(307503..308276) | PHAGE_Pseudo_OBP: putative homing nuclease; ECs0285; phage(gi371671534) | 2e-38 | Click |
| 14 | 308737..308748 | attL TACAAAGCTGCC | N/A | Click |
| 15 | 309100..309843 | transcription regulator; ECs0287 | N/A | Click |
| 16 | complement(309885..310238) | PROPHAGE_Shigel_301: insertion element IS2 transposase InsD; ECs0288; phage(gi24111655) | 1e-42 | Click |
| 17 | 310806..311987 | PROPHAGE_Escher_CFT073: putative prophage integrase; ECs0289; phage(gi26250313) | 6e-143 | Click |
| 18 | 317302..317313 | attR TACAAAGCTGCC | N/A | Click |
| 19 | 323524..323539 | attR GCACCATTTAAATCAA | N/A | Click |
Region 2, total : 46 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(892240..892458) | PHAGE_Entero_HK629: excisionase; ECs0801; phage(gi428782042) | 2e-37 | Click |
| 2 | complement(892498..892665) | PHAGE_Entero_HK630: hypothetical protein; ECs0802; phage(gi428782816) | 7e-29 | Click |
| 3 | 892980..893510 | hypothetical protein; ECs0804 | N/A | Click |
| 4 | complement(893721..893942) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip097; ECs0805; phage(gi20065892) | 4e-37 | Click |
| 5 | complement(894041..894256) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip098; ECs0806; phage(gi20065893) | 3e-34 | Click |
| 6 | complement(894333..894524) | PHAGE_Entero_4795: hypothetical protein PBV4795_ORF10; ECs0807; phage(gi157165995) | 1e-27 | Click |
| 7 | complement(894497..894679) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; ECs0808; phage(gi20065896) | 2e-28 | Click |
| 8 | complement(894676..895356) | PHAGE_Stx2_c_1717: exonuclease; ECs0809; phage(gi209447136) | 4e-132 | Click |
| 9 | complement(895353..895997) | PHAGE_Stx2_c_I: Bet protein; ECs5398; phage(gi20065900) | 3e-125 | Click |
| 10 | 896054..896236 | PHAGE_Stx2_c_II: NinE protein; ECs0810; phage(gi302393150) | 6e-30 | Click |
| 11 | 896233..896403 | PHAGE_Entero_lambda: NinF protein; ECs0811; phage(gi9626302) | 2e-27 | Click |
| 12 | 896393..897016 | PHAGE_Entero_Sf6: gene 54 protein; ECs0812; phage(gi41057342) | 2e-114 | Click |
| 13 | 897013..897678 | PHAGE_Stx2_c_1717: NinI protein; ECs0813; phage(gi209447164) | 3e-130 | Click |
| 14 | complement(897890..898849) | outer membrane protein; ECs0814 | N/A | Click |
| 15 | 899324..900013 | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs0815; phage(gi169257244) | 3e-81 | Click |
| 16 | 900224..900940 | hypothetical protein; ECs0816 | N/A | Click |
| 17 | 901806..902021 | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs0818; phage(gi209447171) | 7e-35 | Click |
| 18 | 902021..902518 | PHAGE_Entero_cdtI: lysin; ECs0819; phage(gi148609440) | 1e-91 | Click |
| 19 | 902515..902982 | PHAGE_Salmon_SPN9CC: endopeptidase; ECs0820; phage(gi389060532) | 2e-78 | Click |
| 20 | 902970..903122 | PHAGE_Entero_mEp460: hypothetical protein; ECs0822; phage(gi428782374) | 1e-21 | Click |
| 21 | 903529..903807 | hypothetical protein; ECs0823 | N/A | Click |
| 22 | 903797..904288 | PHAGE_Entero_mEp460: terminase small subunit; ECs0824; phage(gi428782317) | 5e-74 | Click |
| 23 | 904288..906390 | PHAGE_Entero_cdtI: putative large terminase subunit; ECs0825; phage(gi148609384) | 0.0 | Click |
| 24 | 906387..906599 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp03; ECs0826; phage(gi148609385) | 9e-35 | Click |
| 25 | 906527..907651 | PHAGE_Entero_cdtI: putative portal protein; ECs0827; phage(gi148609386) | 0.0 | Click |
| 26 | 907851..908108 | PHAGE_Entero_cdtI: putative portal protein; ECs0828; phage(gi148609386) | 1e-45 | Click |
| 27 | 907957..910080 | PHAGE_Entero_cdtI: putative protease/scaffold protein; ECs0829; phage(gi148609387) | 0.0 | Click |
| 28 | 910122..910490 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp06; ECs0830; phage(gi148609388) | 2e-54 | Click |
| 29 | 910483..910758 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp07; ECs0831; phage(gi148609389) | 6e-39 | Click |
| 30 | 910770..911348 | PHAGE_Entero_cdtI: putative tail component; ECs0832; phage(gi148609390) | 2e-103 | Click |
| 31 | 911345..911746 | PHAGE_Entero_cdtI: putative tail component; ECs0833; phage(gi148609391) | 8e-73 | Click |
| 32 | 911757..912500 | PHAGE_Entero_cdtI: putative major tail subunit; ECs0834; phage(gi148609392) | 4e-137 | Click |
| 33 | 912561..912947 | PHAGE_Entero_cdtI: putative tail component; ECs0835; phage(gi148609393) | 5e-65 | Click |
| 34 | 912956..913285 | PHAGE_Entero_cdtI: putative minor tail protein; ECs0836; phage(gi148609394) | 5e-59 | Click |
| 35 | 913257..916322 | PHAGE_Entero_cdtI: putative tail protein; ECs0837; phage(gi148609395) | 0.0 | Click |
| 36 | 916322..916651 | PHAGE_Entero_cdtI: putative minor tail protein; ECs0838; phage(gi148609396) | 2e-61 | Click |
| 37 | 916661..917359 | PHAGE_Entero_cdtI: putative minor tail protein; ECs0839; phage(gi148609397) | 1e-135 | Click |
| 38 | 917509..918108 | PHAGE_Entero_cdtI: putative tail protein; ECs0840; phage(gi148609398) | 1e-117 | Click |
| 39 | 918006..918653 | PHAGE_Entero_cdtI: putative tail component; ECs0841; phage(gi148609399) | 8e-112 | Click |
| 40 | 918714..922127 | PHAGE_Entero_cdtI: putative tail tip assembly protein; ECs0842; phage(gi148609400) | 0.0 | Click |
| 41 | 922198..922797 | PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECs0843; phage(gi148609401) | 3e-104 | Click |
| 42 | 922857..924173 | PHAGE_Entero_cdtI: putative tail fiber protein; ECs0844; phage(gi148609402) | 0.0 | Click |
| 43 | 924136..924444 | PHAGE_Stx2_c_II: putative tail fiber protein; ECs0845; phage(gi302393091) | 8e-54 | Click |
| 44 | 924621..925601 | PHAGE_Salmon_ST64B: hypothetical protein sb26; ECs0846; phage(gi23505470) | 3e-90 | Click |
| 45 | 925662..926654 | hypothetical protein; ECs0847 | N/A | Click |
| 46 | 927482..928363 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECs0848; phage(gi148609405) | 7e-156 | Click |
Region 3, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1160230..1160889) | PHAGE_Camelp_virus: CMLV006; ECs1054; phage(gi18640240) | 3e-12 | Click |
| 2 | 1161156..1161167 | attL AAGAAAAACAAA | N/A | Click |
| 3 | complement(1161297..1162316) | PHAGE_Salmon_ST64B: Integrase protein; ECs1055; phage(gi23505472) | 2e-87 | Click |
| 4 | complement(1162604..1165075) | PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECs1057; phage(gi23505474) | 1e-55 | Click |
| 5 | complement(1165169..1165360) | hypothetical protein; ECs1058 | N/A | Click |
| 6 | complement(1165357..1165545) | cell division inhibition protein; ECs1059 | N/A | Click |
| 7 | 1165812..1166117 | hypothetical protein; ECs1060 | N/A | Click |
| 8 | 1166119..1166304 | hypothetical protein; ECs1061 | N/A | Click |
| 9 | complement(1166491..1166880) | PHAGE_Escher_TL_2011c: hypothetical protein; ECs1063; phage(gi418487085) | 3e-07 | Click |
| 10 | complement(1167022..1167177) | PHAGE_Salico_CGphi29: hypothetical protein; ECs1065; phage(gi472340166) | 2e-09 | Click |
| 11 | complement(1167455..1167742) | hypothetical protein; ECs1067 | N/A | Click |
| 12 | complement(1167742..1167933) | hypothetical protein; ECs1068 | N/A | Click |
| 13 | complement(1167961..1168362) | PHAGE_Gifsy_2: putative bacteriophage regulatory protein; repressor; Lambda gpCI analog; ECs1069; phage(gi169257276) | 2e-11 | Click |
| 14 | 1168471..1168743 | PHAGE_Gifsy_2: putative bacteriophage regulatory protein; Lambda gpCro analog; ECs1070; phage(gi169257277) | 2e-16 | Click |
| 15 | 1168727..1169152 | PHAGE_Escher_HK639: cII; ECs1071; phage(gi356870652) | 8e-06 | Click |
| 16 | complement(1169359..1169814) | hypothetical protein; ECs1072 | N/A | Click |
| 17 | 1169893..1170984 | PHAGE_Entero_phiP27: hypothetical protein P27p17; ECs1073; phage(gi18249881) | 2e-29 | Click |
| 18 | 1170991..1171737 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs1074; phage(gi169257280) | 1e-75 | Click |
| 19 | 1171759..1172529 | PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECs1075; phage(gi116222030) | 1e-05 | Click |
| 20 | 1172545..1172958 | hypothetical protein; ECs1076 | N/A | Click |
| 21 | complement(1173310..1174083) | hypothetical protein; ECs1077 | N/A | Click |
| 22 | 1174631..1174843 | PHAGE_Stx2_c_II: putative host killer protein; ECs1080; phage(gi302393105) | 3e-27 | Click |
| 23 | 1175011..1175289 | PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECs1081; phage(gi169257287) | 6e-09 | Click |
| 24 | 1175291..1176340 | PHAGE_Entero_mEp460: hypothetical protein; ECs1082; phage(gi428782365) | 8e-112 | Click |
| 25 | 1176353..1176724 | PHAGE_Escher_HK75: RusA-like protein; ECs1083; phage(gi356870726) | 1e-36 | Click |
| 26 | 1176714..1177085 | PHAGE_Entero_2008: antitermination protein Q; ECs1084; phage(gi209427762) | 4e-54 | Click |
| 27 | 1177237..1178055 | hypothetical protein; ECs1085 | N/A | Click |
| 28 | 1178342..1178581 | PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs1086; phage(gi18249887) | 2e-20 | Click |
| 29 | 1186416..1186427 | attR AAGAAAAACAAA | N/A | Click |
Region 4, total : 38 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1180157..1182007 | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1088; phage(gi209427766) | 0.0 | Click |
| 2 | 1182183..1182509 | PHAGE_Stx2_c_II: putative transposase; ECs1089; phage(gi302393161) | 1e-58 | Click |
| 3 | 1182506..1183159 | PHAGE_Stx2_c_1717: transposase; ECs1090; phage(gi209447179) | 1e-62 | Click |
| 4 | complement(1183364..1183678) | transcriptional regulator; ECs1091 | N/A | Click |
| 5 | complement(1184144..1184611) | PHAGE_Entero_4795: putative endopeptidase Rz; ECs1093; phage(gi157166036) | 1e-73 | Click |
| 6 | complement(1184613..1184726) | hypothetical protein; ECs1094 | N/A | Click |
| 7 | complement(1184947..1185480) | PHAGE_Entero_2008: putative endolysin; ECs1096; phage(gi209427769) | 2e-99 | Click |
| 8 | complement(1185513..1185707) | hypothetical protein; ECs1098 | N/A | Click |
| 9 | 1185676..1185912 | PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp06; ECs1097; phage(gi116221998) | 4e-13 | Click |
| 10 | 1185861..1186205 | hypothetical protein; ECs1099 | N/A | Click |
| 11 | complement(1186168..1186374) | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1100; phage(gi209447171) | 3e-31 | Click |
| 12 | 1187125..1187400 | hypothetical protein; ECs1101 | N/A | Click |
| 13 | 1187476..1187856 | PHAGE_Stx2_c_1717: truncated transposase; ECs1102; phage(gi209447151) | 9e-69 | Click |
| 14 | 1187853..1188200 | PHAGE_Stx2_c_1717: transposase; ECs1103; phage(gi209447152) | 2e-62 | Click |
| 15 | 1188250..1189788 | PHAGE_Stx2_c_1717: transposase; ECs1104; phage(gi209447153) | 0.0 | Click |
| 16 | 1190052..1191980 | PHAGE_Entero_HK630: terminase large subunit A; ECs1106; phage(gi428782789) | 0.0 | Click |
| 17 | 1191964..1192170 | PHAGE_Entero_HK630: head-tail connector W; ECs5406; phage(gi428782790) | 1e-11 | Click |
| 18 | 1192167..1193759 | PHAGE_Entero_HK630: portal protein B; ECs1107; phage(gi428782791) | 0.0 | Click |
| 19 | 1193749..1195254 | PHAGE_Entero_HK630: head maturation protease C; ECs1108; phage(gi428782792) | 4e-108 | Click |
| 20 | 1195291..1195638 | PHAGE_Entero_HK630: head decoration protein D; ECs1109; phage(gi428782794) | 6e-25 | Click |
| 21 | 1195696..1195962 | PHAGE_Entero_HK630: major head subunit E; ECs1110; phage(gi428782795) | 2e-20 | Click |
| 22 | 1196079..1196684 | PHAGE_Entero_HK630: major tail protein V; ECs1111; phage(gi428782800) | 4e-87 | Click |
| 23 | 1196698..1197129 | PHAGE_Entero_HK630: minor tail protein G; ECs1112; phage(gi428782801) | 5e-45 | Click |
| 24 | 1197180..1197569 | PHAGE_Entero_HK630: tail assembly protein GT; ECs1113; phage(gi428782802) | 4e-43 | Click |
| 25 | 1197550..1200129 | PHAGE_Entero_HK630: tail length tape measure protein H; ECs1114; phage(gi428782803) | 0.0 | Click |
| 26 | 1200126..1200455 | PHAGE_Entero_HK630: minor tail protein M; ECs1115; phage(gi428782804) | 4e-48 | Click |
| 27 | 1200455..1201153 | PHAGE_Entero_HK630: minor tail protein L; ECs1116; phage(gi428782805) | 3e-103 | Click |
| 28 | 1201272..1201907 | PHAGE_Entero_4795: putative tail fiber component; ECs1117; phage(gi157166055) | 1e-122 | Click |
| 29 | 1201805..1202485 | PHAGE_Stx2_c_1717: putative tail component; ECs1118; phage(gi209447195) | 9e-126 | Click |
| 30 | 1202439..1202645 | hypothetical protein; ECs1119 | N/A | Click |
| 31 | complement(1202676..1203203) | PHAGE_Salmon_1: hypothetical bacteriophage protein; ECs1120; phage(gi169257202) | 2e-60 | Click |
| 32 | 1203337..1206810 | PHAGE_Entero_HK630: tail fiber J; ECs1121; phage(gi428782808) | 0.0 | Click |
| 33 | 1206878..1207477 | PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECs1122; phage(gi209447197) | 9e-113 | Click |
| 34 | 1207536..1208855 | PROPHAGE_Escher_Sakai: putative tail fiber protein; ECs1123; phage(gi15832195) | 0.0 | Click |
| 35 | 1208857..1209126 | PHAGE_Stx2_c_II: putative tail fiber protein; ECs1124; phage(gi302393091) | 2e-43 | Click |
| 36 | complement(1209251..1209820) | PHAGE_Emilia_86: hypothetical protein EhV364; ECs1126; phage(gi73852838) | 7e-08 | Click |
| 37 | 1209796..1209978 | hypothetical protein; ECs1125 | N/A | Click |
| 38 | complement(1210459..1210641) | PHAGE_Entero_4795: putative avirulence protein; ECs1127; phage(gi157166069) | 4e-24 | Click |
Region 5, total : 91 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1245903..1245914 | attL ACCGCCTGCTTT | N/A | Click |
| 2 | complement(1246040..1247350) | PHAGE_Stx2_c_II: integrase; ECs1160; phage(gi302393112) | 0.0 | Click |
| 3 | complement(1247403..1247687) | PHAGE_Stx2_c_II: excisionase; ECs1161; phage(gi302393113) | 1e-51 | Click |
| 4 | complement(1247773..1248084) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip084; ECs1162; phage(gi20065879) | 8e-57 | Click |
| 5 | complement(1248144..1248488) | PHAGE_Stx2_c_II: hypothetical protein Stx2IIp093; ECs1163; phage(gi302393115) | 4e-51 | Click |
| 6 | complement(1248421..1249044) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp33; ECs1164; phage(gi302393116) | 2e-120 | Click |
| 7 | complement(1249048..1249335) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp34; ECs1165; phage(gi302393117) | 1e-51 | Click |
| 8 | complement(1249337..1249555) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp35; ECs1166; phage(gi302393118) | 1e-36 | Click |
| 9 | complement(1249557..1249844) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp36; ECs1167; phage(gi302393119) | 4e-39 | Click |
| 10 | complement(1249774..1250241) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp37; ECs1168; phage(gi302393120) | 6e-74 | Click |
| 11 | complement(1250114..1250887) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp38; ECs1169; phage(gi302393121) | 2e-146 | Click |
| 12 | complement(1250884..1251105) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp39; ECs1170; phage(gi302393122) | 2e-37 | Click |
| 13 | complement(1251204..1251419) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp41; ECs1171; phage(gi302393124) | 5e-35 | Click |
| 14 | complement(1251496..1251687) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp43; ECs1172; phage(gi302393126) | 2e-29 | Click |
| 15 | complement(1251660..1251842) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp44; ECs1173; phage(gi302393127) | 5e-30 | Click |
| 16 | complement(1251839..1252519) | PHAGE_Stx2_c_II: exonuclease; ECs1174; phage(gi302393128) | 2e-132 | Click |
| 17 | complement(1252516..1253301) | PHAGE_Stx2_c_II: recombination protein Bet; ECs1175; phage(gi302393129) | 3e-151 | Click |
| 18 | complement(1253307..1253723) | PHAGE_Entero_HK630: host-nuclease inhibitor protein; ECs1176; phage(gi428782824) | 3e-75 | Click |
| 19 | complement(1253678..1253947) | PHAGE_Stx2_c_II: Kil protein; ECs1177; phage(gi302393131) | 7e-45 | Click |
| 20 | complement(1253790..1253954) | PHAGE_Stx2_c_II: CIII protein; ECs1178; phage(gi302393132) | 1e-27 | Click |
| 21 | complement(1254027..1254395) | PHAGE_Stx2_c_II: Ea10 protein; ECs1179; phage(gi302393133) | 2e-68 | Click |
| 22 | complement(1254578..1254829) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp52; ECs1180; phage(gi302393135) | 2e-44 | Click |
| 23 | complement(1254888..1255160) | PHAGE_Stx2_c_II: putative antitermination protein N; ECs1181; phage(gi302393136) | 3e-45 | Click |
| 24 | complement(1255138..1255320) | PHAGE_Entero_2008: hypothetical protein YYZ_gp22; ECs1182; phage(gi209427747) | 4e-30 | Click |
| 25 | 1255617..1255778 | PHAGE_Entero_2008: hypothetical protein YYZ_gp24; ECs1183; phage(gi209427749) | 3e-25 | Click |
| 26 | complement(1255889..1256410) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp54; ECs1184; phage(gi302393137) | 4e-92 | Click |
| 27 | complement(1256912..1257565) | PHAGE_Stx2_c_II: CI protein; ECs1185; phage(gi302393138) | 6e-126 | Click |
| 28 | 1257683..1257898 | PHAGE_Stx2_c_II: Cro protein; ECs1186; phage(gi302393139) | 2e-36 | Click |
| 29 | 1258040..1258336 | PHAGE_Stx2_c_II: CII protein; ECs1187; phage(gi302393140) | 2e-50 | Click |
| 30 | 1258369..1258515 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp58; ECs1188; phage(gi302393141) | 4e-22 | Click |
| 31 | 1258508..1259407 | PHAGE_Stx1_converting: DNA replication protein O; ECs1189; phage(gi302861180) | 1e-177 | Click |
| 32 | 1259382..1260833 | PHAGE_Stx2_c_II: DNA replication protein P; ECs1190; phage(gi302393143) | 0.0 | Click |
| 33 | 1260833..1261102 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp61; ECs1191; phage(gi302393144) | 8e-47 | Click |
| 34 | 1261173..1261451 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp62; ECs1192; phage(gi302393145) | 1e-51 | Click |
| 35 | 1261584..1261799 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp63; ECs1193; phage(gi302393146) | 5e-35 | Click |
| 36 | 1261810..1262046 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp64; ECs1194; phage(gi302393147) | 2e-42 | Click |
| 37 | 1262003..1262449 | PHAGE_Stx2_c_II: NinB protein; ECs1195; phage(gi302393148) | 8e-84 | Click |
| 38 | 1262446..1262973 | PHAGE_Stx2_c_II: putative DNA N-6-adenine-methyltransferase; ECs1196; phage(gi302393149) | 9e-102 | Click |
| 39 | 1262970..1263152 | PHAGE_Stx2_c_II: NinE protein; ECs1197; phage(gi302393150) | 3e-31 | Click |
| 40 | 1263427..1264161 | PHAGE_Stx2_c_II: putative antirepressor-like protein; ECs1199; phage(gi302393152) | 7e-142 | Click |
| 41 | 1264236..1264958 | PHAGE_Stx2_c_II: Roi protein; ECs1200; phage(gi302393153) | 5e-132 | Click |
| 42 | 1264958..1265563 | PHAGE_Stx2_c_II: NinG protein; ECs1201; phage(gi302393154) | 1e-118 | Click |
| 43 | 1265560..1265754 | PHAGE_Stx2_c_II: NinH protein; ECs1202; phage(gi302393155) | 2e-32 | Click |
| 44 | 1265747..1266181 | PHAGE_Stx2_c_II: antitermination protein Q; ECs1203; phage(gi302393156) | 8e-83 | Click |
| 45 | 1266430..1266582 | PHAGE_Stx2_c_86: DNA modification methylase; ECs1204; phage(gi116222073) | 1e-19 | Click |
| 46 | 1266623..1266698 | tRNA | N/A | Click |
| 47 | 1266708..1266784 | tRNA | N/A | Click |
| 48 | 1266798..1266874 | tRNA | N/A | Click |
| 49 | 1266965..1267924 | PHAGE_Stx2_c_II: Shiga toxin 2 subunit A; ECs1205; phage(gi302393157) | 0.0 | Click |
| 50 | 1267936..1268205 | PHAGE_Stx2_c_II: Shiga toxin 2 subunit B; ECs1206; phage(gi302393158) | 1e-46 | Click |
| 51 | 1268692..1270596 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp76; ECs1207; phage(gi302393159) | 0.0 | Click |
| 52 | complement(1270403..1271293) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp77; ECs1208; phage(gi302393160) | 2e-173 | Click |
| 53 | complement(1271290..1271616) | PHAGE_Stx2_c_II: putative transposase; ECs1209; phage(gi302393161) | 1e-58 | Click |
| 54 | 1272078..1272257 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp79; ECs1210; phage(gi302393162) | 2e-28 | Click |
| 55 | 1272298..1272570 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp80; ECs1211; phage(gi302393163) | 1e-43 | Click |
| 56 | 1272647..1272862 | PHAGE_Stx2_c_II: holin; ECs1212; phage(gi302393164) | 2e-35 | Click |
| 57 | 1272867..1273400 | PHAGE_Stx2_c_II: endolysin; ECs1213; phage(gi302393165) | 1e-103 | Click |
| 58 | 1273671..1274240 | PHAGE_Stx2_c_II: putative antirepressor protein Ant; ECs1214; phage(gi302393166) | 7e-107 | Click |
| 59 | 1274394..1274858 | PHAGE_Stx2_c_II: endopeptidase Rz; ECs1215; phage(gi302393167) | 6e-83 | Click |
| 60 | complement(1274890..1275183) | PHAGE_Stx2_c_II: Bor protein precursor; ECs1217; phage(gi302393169) | 2e-50 | Click |
| 61 | 1275291..1275536 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip164; ECs1218; phage(gi20065959) | 4e-45 | Click |
| 62 | 1275592..1276398 | PHAGE_Stx2_c_II: terminase, small subunit; ECs1219; phage(gi302393081) | 3e-151 | Click |
| 63 | 1276379..1278085 | PHAGE_Stx2_c_II: terminase, large subunit; ECs1220; phage(gi302393082) | 0.0 | Click |
| 64 | 1278085..1280229 | PHAGE_Stx2_c_II: portal protein; ECs1221; phage(gi302393083) | 0.0 | Click |
| 65 | 1280387..1281394 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp04; ECs1222; phage(gi302393084) | 0.0 | Click |
| 66 | 1281418..1282632 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp05; ECs1223; phage(gi302393085) | 0.0 | Click |
| 67 | 1282688..1283077 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp06; ECs1224; phage(gi302393086) | 2e-66 | Click |
| 68 | 1283127..1283588 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp07; ECs1225; phage(gi302393087) | 2e-82 | Click |
| 69 | 1283572..1284135 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp08; ECs1226; phage(gi302393088) | 2e-104 | Click |
| 70 | 1284135..1284785 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp09; ECs1227; phage(gi302393089) | 8e-123 | Click |
| 71 | 1284782..1286719 | PHAGE_Stx2_c_II: putative tail fiber protein; ECs1228; phage(gi302393090) | 0.0 | Click |
| 72 | 1286721..1286990 | PHAGE_Stx2_c_II: putative tail fiber protein; ECs1229; phage(gi302393091) | 4e-47 | Click |
| 73 | 1287076..1287318 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip029; ECs1230; phage(gi20065825) | 3e-42 | Click |
| 74 | complement(1287205..1287447) | outer membrane protein; ECs1231 | N/A | Click |
| 75 | 1287535..1289238 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp12; ECs1232; phage(gi302393092) | 0.0 | Click |
| 76 | 1289235..1290503 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp13; ECs1233; phage(gi302393093) | 0.0 | Click |
| 77 | 1290518..1290796 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp14; ECs1234; phage(gi302393094) | 8e-52 | Click |
| 78 | 1290802..1291419 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp15; ECs1235; phage(gi302393095) | 4e-122 | Click |
| 79 | 1291510..1292244 | PHAGE_Stx2_c_II: outer membrane protein Lom precursor; ECs1236; phage(gi302393096) | 4e-140 | Click |
| 80 | 1292674..1293075 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp18; ECs1237; phage(gi302393098) | 3e-74 | Click |
| 81 | 1293169..1293825 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp19; ECs1238; phage(gi302393099) | 5e-122 | Click |
| 82 | 1293828..1294274 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp20; ECs1239; phage(gi302393100) | 2e-80 | Click |
| 83 | 1294284..1294535 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp21; ECs1240; phage(gi302393101) | 2e-40 | Click |
| 84 | 1294546..1295811 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp22; ECs1241; phage(gi302393102) | 0.0 | Click |
| 85 | 1295881..1304262 | PHAGE_Stx1_converting: hypothetical protein Stx1_gp23; ECs1242; phage(gi302861144) | 0.0 | Click |
| 86 | 1304548..1304733 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip069; ECs1243; phage(gi20065864) | 2e-30 | Click |
| 87 | complement(1304813..1305157) | PHAGE_Stx2_c_II: hypothetical protein Stx2IIp075; ECs1244; phage(gi302393104) | 6e-59 | Click |
| 88 | complement(1305277..1305489) | PHAGE_Stx2_c_II: putative host killer protein; ECs1245; phage(gi302393105) | 4e-33 | Click |
| 89 | complement(1305723..1306118) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp25; ECs1246; phage(gi302393106) | 7e-72 | Click |
| 90 | complement(1306118..1306777) | PHAGE_Stx2_c_II: hypothetical protein Stx2IIp080; ECs1247; phage(gi302393107) | 2e-128 | Click |
| 91 | complement(1306798..1307016) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp26; ECs1248; phage(gi302393108) | 1e-37 | Click |
| 92 | complement(1307003..1307287) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ECs1249; phage(gi302393109) | 5e-50 | Click |
| 93 | complement(1307284..1307505) | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp28; ECs1250; phage(gi302393110) | 8e-38 | Click |
| 94 | complement(1307553..1308182) | PHAGE_Stx2_c_II: putative antirepressor protein AntB; ECs1251; phage(gi302393111) | 6e-117 | Click |
| 95 | complement(1309331..1310659) | PHAGE_Lactob_KC5a: putative minor tail protein; ECs1252; phage(gi90592623) | 8e-06 | Click |
| 96 | 1316397..1316408 | attR ACCGCCTGCTTT | N/A | Click |
Region 6, total : 61 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1538645..1539466 | PHAGE_Cronob_vB_CsaM_GAP32: putative Sir2-like protein; ECs1498; phage(gi414087036) | 4e-19 | Click |
| 2 | complement(1539622..1540668) | spermidine/putrescine ABC transporter periplasmic substrate-binding protein; ECs1499 | N/A | Click |
| 3 | complement(1540665..1541459) | spermidine/putrescine ABC transporter membrane protein; ECs1500 | N/A | Click |
| 4 | 1541510..1541524 | attL TTTATTCAATTTTTT | N/A | Click |
| 5 | complement(1541626..1542744) | PHAGE_Entero_mEp235: integrase; ECs1501; phage(gi428781836) | 3e-52 | Click |
| 6 | complement(1542713..1542982) | excisionase; ECs1502 | N/A | Click |
| 7 | complement(1543044..1543481) | PHAGE_Entero_mEp460: putative exonuclease; ECs1503; phage(gi428782342) | 1e-40 | Click |
| 8 | 1543524..1544081 | PHAGE_Entero_HK630: HkaP protein; ECs1504; phage(gi428782827) | 2e-12 | Click |
| 9 | complement(1544196..1544426) | PHAGE_Salico_CGphi29: hypothetical protein; ECs1505; phage(gi472340166) | 1e-09 | Click |
| 10 | complement(1544664..1545140) | phage repressor; ECs1506 | N/A | Click |
| 11 | 1545265..1545588 | PHAGE_Aggreg_S1249: phage protein; ECs1507; phage(gi273809591) | 1e-13 | Click |
| 12 | 1545572..1545997 | PHAGE_Pectob_ZF40: putative cII repressor; ECs1508; phage(gi422936652) | 2e-05 | Click |
| 13 | 1546066..1547103 | PHAGE_Escher_TL_2011b: hypothetical protein; ECs1509; phage(gi418487646) | 4e-48 | Click |
| 14 | 1546964..1547557 | PHAGE_Escher_HK639: replication protein 14; ECs1510; phage(gi356870655) | 2e-31 | Click |
| 15 | 1547591..1548307 | hypothetical protein; ECs1511 | N/A | Click |
| 16 | 1548304..1548621 | hypothetical protein; ECs1512 | N/A | Click |
| 17 | 1548618..1548920 | PHAGE_Klebsi_phiKO2: Gp58; ECs1513; phage(gi46402144) | 1e-26 | Click |
| 18 | 1548910..1549227 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp27; ECs1514; phage(gi302393109) | 7e-45 | Click |
| 19 | 1549181..1549498 | PHAGE_Salmon_E1: hypothetical protein VIP0051; ECs1515; phage(gi170676326) | 9e-32 | Click |
| 20 | 1549485..1549922 | PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECs1516; phage(gi209427735) | 1e-08 | Click |
| 21 | 1549924..1550115 | PHAGE_Salmon_ST160: hypothetical protein; ECs1517; phage(gi318065908) | 5e-27 | Click |
| 22 | 1550118..1550705 | PHAGE_Entero_mEp460: hypothetical protein; ECs1518; phage(gi428782343) | 7e-40 | Click |
| 23 | 1551114..1551326 | PHAGE_Stx2_c_II: putative host killer protein; ECs1520; phage(gi302393105) | 2e-29 | Click |
| 24 | 1551494..1551772 | PHAGE_Cronob_phiES15: hypothetical protein; ECs1521; phage(gi401817580) | 1e-13 | Click |
| 25 | 1551774..1552823 | PHAGE_Entero_mEp460: hypothetical protein; ECs1522; phage(gi428782365) | 2e-109 | Click |
| 26 | 1552836..1553210 | PHAGE_Escher_HK75: RusA-like protein; ECs1523; phage(gi356870726) | 2e-34 | Click |
| 27 | 1553207..1554028 | PHAGE_Entero_HK225: late gene regulator Q; ECs1524; phage(gi428782441) | 7e-91 | Click |
| 28 | complement(1554441..1554941) | hypothetical protein; ECs1526 | N/A | Click |
| 29 | 1554893..1555078 | hypothetical protein; ECs1525 | N/A | Click |
| 30 | 1555107..1557044 | PHAGE_Entero_4795: hypothetical protein YjhS; ECs1527; phage(gi157166028) | 0.0 | Click |
| 31 | 1557192..1557374 | PHAGE_Escher_P13374: hypothetical protein; ECs1528; phage(gi410491643) | 3e-18 | Click |
| 32 | 1557412..1557681 | PHAGE_Escher_P13374: hypothetical protein; ECs1529; phage(gi410491644) | 1e-26 | Click |
| 33 | 1557757..1557972 | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1530; phage(gi209447171) | 2e-34 | Click |
| 34 | 1557977..1558321 | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1531; phage(gi209427768) | 1e-59 | Click |
| 35 | 1558372..1558905 | PHAGE_Entero_2008: putative endolysin; ECs1532; phage(gi209427769) | 4e-103 | Click |
| 36 | 1559176..1559745 | PHAGE_Entero_2008: putative antirepressor; ECs1533; phage(gi209427770) | 7e-107 | Click |
| 37 | 1559899..1560366 | PHAGE_Entero_2008: putative endopeptidase; ECs1534; phage(gi209427771) | 5e-63 | Click |
| 38 | 1560390..1560614 | hypothetical protein; ECs1536 | N/A | Click |
| 39 | 1560611..1560829 | PHAGE_Entero_Sakai: hypothetical protein VT2-Sap50; ECs1537; phage(gi9633444) | 1e-12 | Click |
| 40 | 1560971..1561111 | hypothetical protein; ECs1538 | N/A | Click |
| 41 | complement(1561241..1561426) | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1539; phage(gi209427772) | 9e-19 | Click |
| 42 | 1561468..1561833 | PHAGE_Entero_2008: putative DNAse; ECs1540; phage(gi209427773) | 4e-67 | Click |
| 43 | complement(1561486..1561731) | hypothetical protein; ECs5417 | N/A | Click |
| 44 | 1562123..1562686 | PHAGE_Entero_2008: putative phage terminase; ECs1541; phage(gi209427774) | 1e-95 | Click |
| 45 | 1562683..1564344 | PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1542; phage(gi209427775) | 0.0 | Click |
| 46 | 1564408..1566345 | PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1543; phage(gi209427776) | 0.0 | Click |
| 47 | 1566390..1566611 | PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5418; phage(gi209427801) | 6e-38 | Click |
| 48 | 1566557..1569058 | PHAGE_Entero_2008: putative portal protein; ECs1544; phage(gi209427777) | 0.0 | Click |
| 49 | 1569138..1569464 | PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1545; phage(gi209427778) | 1e-54 | Click |
| 50 | 1569474..1569824 | PHAGE_Entero_2008: putative head-tail adaptor; ECs1546; phage(gi209427779) | 9e-61 | Click |
| 51 | 1569821..1570267 | PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1547; phage(gi209427780) | 2e-80 | Click |
| 52 | 1570264..1570608 | PHAGE_Entero_2008: putative prophage structural protein; ECs1548; phage(gi209427781) | 6e-60 | Click |
| 53 | 1570667..1571383 | PHAGE_Entero_2008: putative tail protein; ECs1549; phage(gi209427782) | 1e-124 | Click |
| 54 | 1571389..1571763 | PHAGE_Entero_2008: putative tail assembly protein; ECs1550; phage(gi209427783) | 2e-65 | Click |
| 55 | 1571787..1572068 | PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1551; phage(gi209427784) | 6e-47 | Click |
| 56 | 1575357..1575698 | PHAGE_Entero_2008: putative minor tail protein; ECs1554; phage(gi209427786) | 3e-63 | Click |
| 57 | 1575698..1576396 | PHAGE_Entero_2008: putative tail protein; ECs1555; phage(gi209427787) | 4e-131 | Click |
| 58 | complement(1576413..1576667) | PHAGE_Salmon_ST160: Mnt; ECs1556; phage(gi318065963) | 1e-07 | Click |
| 59 | 1577190..1578068 | PHAGE_Salmon_vB_SemP_Emek: antirepressor; ECs1557; phage(gi399498814) | 2e-94 | Click |
| 60 | 1578122..1578859 | PHAGE_Entero_2008: putative tail component K-like protein; ECs1558; phage(gi209427789) | 3e-151 | Click |
| 61 | 1578757..1579041 | PHAGE_Entero_2008: putative tail assembly protein; ECs1559; phage(gi209427790) | 2e-30 | Click |
| 62 | 1579163..1581511 | PHAGE_Staphy_vB_SauM_Romulus: pentapeptide repeat-containing protein; ECs1560; phage(gi472437873) | 8e-07 | Click |
| 63 | 1591830..1591844 | attR TTTATTCAATTTTTT | N/A | Click |
Region 7, total : 26 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1594704..1594724 | attL CGGTGTAGTTAATGGTGTAGT | N/A | Click |
| 2 | 1594751..1595980 | PHAGE_Salmon_vB_SosS_Oslo: integrase; ECs1574; phage(gi399528791) | 3e-59 | Click |
| 3 | 1596345..1596533 | PHAGE_Entero_P4: transcriptional regulator; ECs1575; phage(gi9627517) | 3e-07 | Click |
| 4 | 1596591..1597334 | hypothetical protein; ECs1576 | N/A | Click |
| 5 | complement(1597034..1597165) | hypothetical protein; ECs5420 | N/A | Click |
| 6 | 1597360..1597557 | Icd-like protein; ECs1577 | N/A | Click |
| 7 | 1597550..1597735 | hypothetical protein; ECs1578 | N/A | Click |
| 8 | 1597735..1597926 | PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; ECs1579; phage(gi169257169) | 1e-09 | Click |
| 9 | 1597916..1598158 | hypothetical protein; ECs1580 | N/A | Click |
| 10 | 1598164..1598463 | hypothetical protein; ECs1581 | N/A | Click |
| 11 | 1598460..1599425 | hypothetical protein; ECs1582 | N/A | Click |
| 12 | 1599501..1599722 | hypothetical protein; ECs1583 | N/A | Click |
| 13 | 1599788..1600594 | hypothetical protein; ECs1584 | N/A | Click |
| 14 | complement(1600591..1600935) | hypothetical protein; ECs1585 | N/A | Click |
| 15 | 1600965..1601216 | hypothetical protein; ECs1586 | N/A | Click |
| 16 | 1601213..1601623 | PHAGE_Lactoc_Q54: hypothetical protein Q54_gp12; ECs1587; phage(gi115304283) | 1e-09 | Click |
| 17 | 1601634..1601906 | transcriptional activator; ECs1588 | N/A | Click |
| 18 | 1601953..1602255 | hypothetical protein; ECs1589 | N/A | Click |
| 19 | 1602548..1603705 | PHAGE_Salmon_ST64B: Major capsid protein precursor; ECs1590; phage(gi23505451) | 2e-52 | Click |
| 20 | 1603745..1604317 | PHAGE_Entero_1: prohead protease; ECs1591; phage(gi225626394) | 5e-30 | Click |
| 21 | 1604319..1605530 | PHAGE_Salmon_ST64B: Portal Protein; ECs1592; phage(gi23505449) | 2e-43 | Click |
| 22 | 1605527..1605865 | PHAGE_Entero_HK97: putative head-tail adaptor; ECs1593; phage(gi9634168) | 3e-25 | Click |
| 23 | 1605862..1606158 | PHAGE_Entero_SfV: hypothetical protein SfVp06; ECs1594; phage(gi19548996) | 3e-07 | Click |
| 24 | 1606158..1606598 | PHAGE_Bacill_phi105: hypothetical protein phi105_50; ECs1595; phage(gi22855043) | 3e-23 | Click |
| 25 | 1606591..1606764 | hypothetical protein; ECs1596 | N/A | Click |
| 26 | 1606888..1607244 | PHAGE_Salmon_ST64B: terminase small subunit; ECs1597; phage(gi23505446) | 5e-12 | Click |
| 27 | 1607228..1608889 | PHAGE_Burkho_KS9: terminase gp2; ECs1598; phage(gi255033734) | 6e-84 | Click |
| 28 | 1609934..1609954 | attR CGGTGTAGTTAATGGTGTAGT | N/A | Click |
Region 8, total : 46 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1609996..1610007 | attL AATTAAATCAAT | N/A | Click |
| 2 | complement(1615552..1616013) | PHAGE_Vibrio_KVP40: NMN adenylyl tranferase; ECs1606; phage(gi34419395) | 6e-05 | Click |
| 3 | complement(1616023..1616646) | 23S rRNA pseudouridine synthase E; ECs1607 | N/A | Click |
| 4 | 1616848..1618098 | isocitrate dehydrogenase; ECs1608 | N/A | Click |
| 5 | complement(1618212..1619354) | PHAGE_Entero_mEp235: integrase; ECs1609; phage(gi428781836) | 5e-61 | Click |
| 6 | complement(1619344..1619580) | excisionase; ECs1610 | N/A | Click |
| 7 | 1619684..1620508 | PHAGE_Entero_lambda: DNA replication protein; ECs1611; phage(gi9626295) | 2e-99 | Click |
| 8 | 1620505..1621206 | PHAGE_Entero_lambda: DNA replication protein; ECs1612; phage(gi9626296) | 4e-129 | Click |
| 9 | 1621203..1621505 | PHAGE_Entero_lambda: ren exclusion protein; ECs1613; phage(gi9626297) | 2e-43 | Click |
| 10 | 1621573..1621905 | PHAGE_Acinet_Acj61: putative quaternary ammonium compound-resistance protein qacE; ECs1614; phage(gi311992758) | 1e-10 | Click |
| 11 | 1622083..1622094 | attL TAAAAATTAAAC | N/A | Click |
| 12 | 1622150..1623676 | PHAGE_Bacill_WBeta: putative site-specific recombinase; ECs1615; phage(gi85701406) | 5e-09 | Click |
| 13 | 1624178..1624633 | PHAGE_Cronob_phiES15: hypothetical protein; ECs1616; phage(gi401817579) | 9e-59 | Click |
| 14 | 1624633..1624803 | PHAGE_Escher_HK639: NinE; ECs1617; phage(gi356870663) | 1e-14 | Click |
| 15 | 1624796..1625086 | PHAGE_Entero_mEp237: hypothetical protein; ECs1618; phage(gi435439317) | 3e-48 | Click |
| 16 | 1625083..1625445 | PHAGE_Entero_mEp237: Holliday junction resolvase RusA; ECs1619; phage(gi435439318) | 1e-61 | Click |
| 17 | 1625442..1625582 | PHAGE_Entero_mEp237: hypothetical protein; ECs5421; phage(gi435439319) | 4e-12 | Click |
| 18 | 1625579..1626268 | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs1620; phage(gi169257244) | 4e-84 | Click |
| 19 | 1626578..1626895 | PHAGE_Salmon_ST160: Gp13; ECs1621; phage(gi318065943) | 5e-40 | Click |
| 20 | 1626882..1627358 | PHAGE_Escher_HK75: lysozyme; ECs1622; phage(gi356870730) | 6e-85 | Click |
| 21 | 1627355..1627816 | PHAGE_Entero_lambda: cell lysis protein; ECs1623; phage(gi9626310) | 3e-80 | Click |
| 22 | 1627575..1627757 | PHAGE_Entero_lambda: Rz1 protein; ECs1624; phage(gi160338810) | 2e-30 | Click |
| 23 | complement(1627848..1628141) | PHAGE_Entero_lambda: Bor protein precursor; ECs1625; phage(gi19263395) | 6e-50 | Click |
| 24 | complement(1628433..1628885) | PHAGE_Entero_lambda: putative envelope protein; ECs1626; phage(gi19263396) | 3e-83 | Click |
| 25 | 1629129..1629335 | PHAGE_Entero_lambda: hypothetical protein lambdap79; ECs1627; phage(gi19263397) | 1e-32 | Click |
| 26 | complement(1629500..1629694) | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1628; phage(gi209427772) | 6e-20 | Click |
| 27 | 1630083..1630628 | PHAGE_Entero_lambda: DNA packaging protein; ECs1629; phage(gi9626244) | 3e-96 | Click |
| 28 | 1630603..1632528 | PHAGE_Entero_lambda: DNA packaging protein; ECs1630; phage(gi9626245) | 0.0 | Click |
| 29 | 1632525..1632731 | PHAGE_Entero_lambda: head-tail joining protein; ECs1631; phage(gi9626246) | 1e-31 | Click |
| 30 | 1632728..1634329 | PHAGE_Entero_lambda: capsid component; ECs1632; phage(gi9626247) | 0.0 | Click |
| 31 | 1634310..1635629 | PHAGE_Entero_lambda: capsid component; ECs1633; phage(gi9626248) | 0.0 | Click |
| 32 | 1635639..1635971 | PHAGE_Entero_lambda: head-DNA stabilization protein; ECs1634; phage(gi9626250) | 7e-58 | Click |
| 33 | 1636027..1637052 | PHAGE_Entero_lambda: capsid component; ECs1635; phage(gi9626251) | 0.0 | Click |
| 34 | 1637094..1637492 | PHAGE_Entero_lambda: DNA packaging protein; ECs1636; phage(gi9626252) | 3e-67 | Click |
| 35 | 1637504..1637857 | PHAGE_Entero_lambda: head-tail joining protein; ECs1637; phage(gi9626253) | 8e-62 | Click |
| 36 | 1637869..1638447 | PHAGE_Entero_lambda: tail component; ECs1638; phage(gi9626254) | 6e-101 | Click |
| 37 | 1638444..1638839 | PHAGE_Entero_lambda: tail component; ECs1639; phage(gi9626255) | 2e-72 | Click |
| 38 | 1638847..1639587 | PHAGE_Entero_lambda: tail component; ECs1640; phage(gi9626256) | 3e-133 | Click |
| 39 | 1639603..1640025 | PHAGE_Entero_lambda: tail component; ECs1641; phage(gi9626257) | 2e-73 | Click |
| 40 | 1640007..1640441 | PHAGE_Entero_lambda: tail component; ECs1642; phage(gi9626258) | 2e-81 | Click |
| 41 | 1640434..1642983 | PHAGE_Entero_lambda: tail component; ECs1643; phage(gi9626259) | 0.0 | Click |
| 42 | 1642980..1643309 | PHAGE_Entero_lambda: tail component; ECs1644; phage(gi9626260) | 1e-56 | Click |
| 43 | 1643309..1644007 | PHAGE_Entero_lambda: tail component; ECs1645; phage(gi9626261) | 5e-134 | Click |
| 44 | 1644013..1644756 | PHAGE_Entero_mEp460: tail fiber component; ECs1646; phage(gi428782332) | 2e-149 | Click |
| 45 | 1644654..1645325 | PHAGE_Entero_lambda: tail component; ECs1647; phage(gi9626263) | 8e-121 | Click |
| 46 | 1645386..1648784 | PHAGE_Entero_lambda: tail:host specificity protein; ECs1648; phage(gi9626264) | 0.0 | Click |
| 47 | 1648851..1649450 | PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECs1649; phage(gi148609401) | 3e-112 | Click |
| 48 | 1649515..1652430 | PHAGE_Gifsy_2: bacteriophage side tail fiber protein; Lambda gpStf (gpN) homolog; ECs1650; phage(gi169257320) | 2e-159 | Click |
| 49 | 1655790..1655801 | attR TAAAAATTAAAC | N/A | Click |
| 50 | 1656529..1656540 | attR AATTAAATCAAT | N/A | Click |
Region 9, total : 59 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1743556..1743567 | attL TTAAATTATTGT | N/A | Click |
| 2 | complement(1757549..1758679) | PHAGE_Entero_mEp235: integrase; ECs1757; phage(gi428781836) | 4e-56 | Click |
| 3 | complement(1758657..1758905) | excisionase; ECs1758 | N/A | Click |
| 4 | complement(1758970..1761441) | PHAGE_Entero_mEp460: putative exonuclease; ECs1759; phage(gi428782342) | 3e-58 | Click |
| 5 | complement(1761534..1761725) | hypothetical protein; ECs1760 | N/A | Click |
| 6 | complement(1761722..1761910) | DicB; ECs1761 | N/A | Click |
| 7 | 1762384..1762617 | hypothetical protein; ECs1762 | N/A | Click |
| 8 | complement(1762595..1763002) | PHAGE_Escher_TL_2011c: hypothetical protein; ECs1763; phage(gi418487085) | 5e-12 | Click |
| 9 | complement(1763025..1763243) | hypothetical protein; ECs1764 | N/A | Click |
| 10 | complement(1763316..1763615) | hypothetical protein; ECs5428 | N/A | Click |
| 11 | complement(1763879..1764286) | PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECs1765; phage(gi401817574) | 1e-32 | Click |
| 12 | 1764363..1764590 | PHAGE_Pectob_ZF40: putative cro anti-repressor; ECs1766; phage(gi422936651) | 3e-09 | Click |
| 13 | 1764574..1765125 | hypothetical protein; ECs1767 | N/A | Click |
| 14 | 1765097..1766137 | PHAGE_Escher_TL_2011b: hypothetical protein; ECs1768; phage(gi418487646) | 3e-43 | Click |
| 15 | 1765926..1766591 | PHAGE_Escher_HK639: replication protein 14; ECs1769; phage(gi356870655) | 7e-32 | Click |
| 16 | 1768219..1768977 | colonization factor; ECs1772 | N/A | Click |
| 17 | 1769256..1769468 | PHAGE_Stx2_c_II: putative host killer protein; ECs1773; phage(gi302393105) | 2e-22 | Click |
| 18 | 1769689..1769946 | hypothetical protein; ECs1774 | N/A | Click |
| 19 | 1770016..1770294 | PHAGE_Cronob_phiES15: hypothetical protein; ECs1775; phage(gi401817580) | 2e-13 | Click |
| 20 | 1770296..1771342 | PHAGE_Entero_mEp460: hypothetical protein; ECs1776; phage(gi428782365) | 2e-109 | Click |
| 21 | 1771355..1771714 | PHAGE_Escher_HK75: RusA-like protein; ECs1777; phage(gi356870726) | 6e-36 | Click |
| 22 | 1771723..1772253 | hypothetical protein; ECs1778 | N/A | Click |
| 23 | 1772372..1772692 | PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs1779; phage(gi18249887) | 1e-29 | Click |
| 24 | 1772843..1773901 | PHAGE_Entero_phiP27: putative DNA methylase; ECs1780; phage(gi18249888) | 0.0 | Click |
| 25 | 1773942..1774017 | tRNA | N/A | Click |
| 26 | 1774098..1774174 | tRNA | N/A | Click |
| 27 | 1774698..1776551 | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1781; phage(gi209427766) | 0.0 | Click |
| 28 | 1776701..1776916 | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1782; phage(gi209447171) | 7e-35 | Click |
| 29 | 1776921..1777265 | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1783; phage(gi209427768) | 9e-61 | Click |
| 30 | 1777316..1777849 | PHAGE_Entero_2008: putative endolysin; ECs1784; phage(gi209427769) | 4e-104 | Click |
| 31 | 1778120..1778689 | PHAGE_Entero_2008: putative antirepressor; ECs1785; phage(gi209427770) | 7e-107 | Click |
| 32 | 1778843..1779310 | PHAGE_Entero_2008: putative endopeptidase; ECs1786; phage(gi209427771) | 1e-82 | Click |
| 33 | complement(1779673..1779900) | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1788; phage(gi209427772) | 5e-38 | Click |
| 34 | 1779942..1780307 | PHAGE_Entero_2008: putative DNAse; ECs1789; phage(gi209427773) | 4e-67 | Click |
| 35 | complement(1779960..1780205) | hypothetical protein; ECs5431 | N/A | Click |
| 36 | 1780597..1781160 | PHAGE_Entero_2008: putative phage terminase; ECs1791; phage(gi209427774) | 1e-95 | Click |
| 37 | 1781157..1782818 | PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1792; phage(gi209427775) | 0.0 | Click |
| 38 | 1782882..1784819 | PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1793; phage(gi209427776) | 0.0 | Click |
| 39 | 1785031..1787610 | PHAGE_Entero_2008: putative portal protein; ECs1795; phage(gi209427777) | 0.0 | Click |
| 40 | 1787613..1787939 | PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1796; phage(gi209427778) | 3e-55 | Click |
| 41 | 1787949..1788299 | PHAGE_Entero_2008: putative head-tail adaptor; ECs1797; phage(gi209427779) | 8e-62 | Click |
| 42 | 1788296..1788742 | PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1798; phage(gi209427780) | 6e-79 | Click |
| 43 | 1788739..1789083 | PHAGE_Entero_2008: putative prophage structural protein; ECs1799; phage(gi209427781) | 6e-60 | Click |
| 44 | 1789013..1789858 | PHAGE_Entero_2008: putative tail protein; ECs1800; phage(gi209427782) | 8e-130 | Click |
| 45 | 1789864..1790238 | PHAGE_Entero_2008: putative tail assembly protein; ECs1801; phage(gi209427783) | 2e-65 | Click |
| 46 | 1790262..1790543 | PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1802; phage(gi209427784) | 6e-47 | Click |
| 47 | 1790596..1793676 | PHAGE_Entero_2008: putative tail protein; ECs1803; phage(gi209427785) | 0.0 | Click |
| 48 | 1793669..1794010 | PHAGE_Entero_2008: putative minor tail protein; ECs1804; phage(gi209427786) | 4e-64 | Click |
| 49 | 1794010..1794447 | PHAGE_Entero_2008: putative tail protein; ECs1805; phage(gi209427787) | 2e-64 | Click |
| 50 | 1794635..1798111 | PHAGE_Entero_2008: phage-related tail protein; ECs1806; phage(gi209427791) | 0.0 | Click |
| 51 | 1798179..1798778 | PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs1807; phage(gi209427792) | 1e-94 | Click |
| 52 | 1798930..1800243 | PHAGE_Entero_2008: putative tail protein; ECs1808; phage(gi209427793) | 0.0 | Click |
| 53 | 1800245..1800514 | PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs1809; phage(gi209427794) | 1e-43 | Click |
| 54 | complement(1801541..1802866) | PHAGE_Entero_4795: NleA4795 protein; ECs1812; phage(gi157166068) | 0.0 | Click |
| 55 | 1803080..1803091 | attR TTAAATTATTGT | N/A | Click |
| 56 | 1803169..1803180 | attL TTTTAATGAAAA | N/A | Click |
| 57 | complement(1803527..1804219) | PHAGE_Entero_mEp235: integrase; ECs1813; phage(gi428781836) | 4e-113 | Click |
| 58 | 1804693..1805604 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp23; ECs1814; phage(gi148609405) | 2e-146 | Click |
| 59 | 1805670..1806239 | hypothetical protein; ECs1815 | N/A | Click |
| 60 | complement(1807205..1808743) | PHAGE_Stx2_c_1717: transposase; ECs1818; phage(gi209447153) | 0.0 | Click |
| 61 | complement(1808793..1809140) | PHAGE_Stx2_c_1717: transposase; ECs1819; phage(gi209447152) | 2e-62 | Click |
| 62 | complement(1809137..1809517) | PHAGE_Stx2_c_1717: truncated transposase; ECs1820; phage(gi209447151) | 9e-69 | Click |
| 63 | complement(1809857..1810135) | hypothetical protein; ECs1821 | N/A | Click |
| 64 | complement(1810846..1811493) | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs1824; phage(gi209427795) | 9e-29 | Click |
| 65 | 1811656..1811667 | attR TTTTAATGAAAA | N/A | Click |
Region 10, total : 68 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1920485..1921420) | PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ECs1928; phage(gi155370502) | 3e-08 | Click |
| 2 | 1921441..1921452 | attL AAATGGGGCAAA | N/A | Click |
| 3 | complement(1921472..1922707) | PHAGE_Entero_2008: putative integrase; ECs1929; phage(gi209427727) | 3e-90 | Click |
| 4 | complement(1922709..1922924) | hypothetical protein; ECs1930 | N/A | Click |
| 5 | complement(1923024..1923212) | hypothetical protein; ECs1931 | N/A | Click |
| 6 | complement(1923250..1923399) | restriction alleviation and modification protein; ECs1932 | N/A | Click |
| 7 | complement(1923455..1924264) | PHAGE_Entero_epsilon15: RecT; ECs1933; phage(gi30387413) | 1e-80 | Click |
| 8 | complement(1924257..1926857) | PHAGE_Erwini_phiEt88: exodeoxyribonuclease; ECs1934; phage(gi327198600) | 8e-83 | Click |
| 9 | complement(1926959..1927234) | hypothetical protein; ECs1935 | N/A | Click |
| 10 | complement(1927309..1927485) | PHAGE_Gifsy_1: hypothetical protein STM2630.Gifsy1; ECs5433; phage(gi169257260) | 4e-06 | Click |
| 11 | complement(1927479..1927712) | PHAGE_Escher_P13374: host killing protein; ECs1936; phage(gi410491620) | 8e-06 | Click |
| 12 | 1928142..1928630 | PHAGE_Entero_lambda: Superinfection exclusion protein B; ECs1937; phage(gi19263394) | 1e-07 | Click |
| 13 | complement(1928627..1928782) | PHAGE_Salico_CGphi29: hypothetical protein; ECs1939; phage(gi472340166) | 7e-10 | Click |
| 14 | complement(1928793..1928972) | hypothetical protein; ECs1940 | N/A | Click |
| 15 | complement(1929215..1929526) | PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECs1941; phage(gi401817574) | 4e-11 | Click |
| 16 | 1929714..1929968 | PHAGE_Escher_HK75: regulatory protein cro; ECs1942; phage(gi356870715) | 5e-19 | Click |
| 17 | 1929965..1930387 | PHAGE_Entero_mEp237: CII protein; ECs1943; phage(gi435439306) | 1e-08 | Click |
| 18 | 1930465..1931253 | PHAGE_Escher_TL_2011b: hypothetical protein; ECs1944; phage(gi418487646) | 5e-44 | Click |
| 19 | 1931260..1932006 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs1945; phage(gi169257280) | 3e-76 | Click |
| 20 | 1931978..1932790 | hypothetical protein; ECs1946 | N/A | Click |
| 21 | 1932806..1933228 | hypothetical protein; ECs1948 | N/A | Click |
| 22 | 1933334..1933546 | hypothetical protein; ECs1949 | N/A | Click |
| 23 | 1933798..1934061 | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; ECs1950; phage(gi399498823) | 3e-23 | Click |
| 24 | 1934072..1934233 | PHAGE_Salmon_c341: Truncated P22 EaA protein; ECs1951; phage(gi255252704) | 1e-15 | Click |
| 25 | 1934312..1934557 | PHAGE_Salmon_ST64B: hypothetical protein sb32; ECs1952; phage(gi23505476) | 1e-08 | Click |
| 26 | 1934989..1936140 | PHAGE_Ostreo_2: putative cytosine-specific methyltransferase; ECs1953; phage(gi314055145) | 7e-27 | Click |
| 27 | complement(1936108..1937097) | hypothetical protein; ECs1954 | N/A | Click |
| 28 | complement(1937097..1938488) | hypothetical protein; ECs1955 | N/A | Click |
| 29 | 1938988..1939587 | PHAGE_Gifsy_2: hypothetical protein STM1020.Gifsy2; ECs1956; phage(gi169257286) | 6e-55 | Click |
| 30 | 1939587..1939877 | PHAGE_Erwini_phiEt88: hypothetical protein; ECs1957; phage(gi327198620) | 2e-34 | Click |
| 31 | 1939874..1940428 | PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECs1958; phage(gi399528832) | 7e-07 | Click |
| 32 | 1940568..1940643 | tRNA | N/A | Click |
| 33 | 1940651..1940730 | tRNA | N/A | Click |
| 34 | 1940744..1940820 | tRNA | N/A | Click |
| 35 | 1940990..1941421 | PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs1959; phage(gi431810338) | 3e-30 | Click |
| 36 | 1941418..1941585 | PHAGE_Entero_P1: TciB; ECs1960; phage(gi46401695) | 1e-08 | Click |
| 37 | 1941996..1943849 | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs1961; phage(gi209427766) | 0.0 | Click |
| 38 | 1943999..1944214 | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs1962; phage(gi209447171) | 1e-33 | Click |
| 39 | 1944219..1944563 | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs1963; phage(gi209427768) | 1e-56 | Click |
| 40 | 1944614..1945147 | PHAGE_Entero_2008: putative endolysin; ECs1964; phage(gi209427769) | 4e-104 | Click |
| 41 | 1945418..1945987 | PHAGE_Entero_2008: putative antirepressor; ECs1965; phage(gi209427770) | 7e-107 | Click |
| 42 | 1946141..1946608 | PHAGE_Entero_2008: putative endopeptidase; ECs1966; phage(gi209427771) | 1e-82 | Click |
| 43 | complement(1946971..1947198) | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs1967; phage(gi209427772) | 5e-38 | Click |
| 44 | 1947240..1947605 | PHAGE_Entero_2008: putative DNAse; ECs1968; phage(gi209427773) | 4e-67 | Click |
| 45 | complement(1947258..1947503) | hypothetical protein; ECs5437 | N/A | Click |
| 46 | 1947895..1948458 | PHAGE_Entero_2008: putative phage terminase; ECs1970; phage(gi209427774) | 1e-95 | Click |
| 47 | 1948455..1950116 | PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs1971; phage(gi209427775) | 0.0 | Click |
| 48 | 1950180..1952117 | PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs1972; phage(gi209427776) | 0.0 | Click |
| 49 | 1952162..1952383 | PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5438; phage(gi209427801) | 2e-36 | Click |
| 50 | 1952329..1953693 | PHAGE_Entero_2008: putative portal protein; ECs1974; phage(gi209427777) | 0.0 | Click |
| 51 | 1953690..1954913 | PHAGE_Entero_2008: putative portal protein; ECs1975; phage(gi209427777) | 0.0 | Click |
| 52 | 1954910..1955236 | PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs1976; phage(gi209427778) | 9e-56 | Click |
| 53 | 1955246..1955596 | PHAGE_Entero_2008: putative head-tail adaptor; ECs1977; phage(gi209427779) | 2e-61 | Click |
| 54 | 1955593..1956039 | PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs1978; phage(gi209427780) | 6e-79 | Click |
| 55 | 1956036..1956380 | PHAGE_Entero_2008: putative prophage structural protein; ECs1979; phage(gi209427781) | 3e-59 | Click |
| 56 | 1956449..1957165 | PHAGE_Entero_2008: putative tail protein; ECs1980; phage(gi209427782) | 2e-122 | Click |
| 57 | 1957171..1957545 | PHAGE_Entero_2008: putative tail assembly protein; ECs1981; phage(gi209427783) | 6e-65 | Click |
| 58 | 1957569..1957850 | PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs1982; phage(gi209427784) | 6e-47 | Click |
| 59 | 1957902..1960982 | PHAGE_Entero_2008: putative tail protein; ECs1983; phage(gi209427785) | 0.0 | Click |
| 60 | 1960975..1961316 | PHAGE_Entero_2008: putative minor tail protein; ECs1984; phage(gi209427786) | 1e-63 | Click |
| 61 | 1961316..1962014 | PHAGE_Entero_2008: putative tail protein; ECs1985; phage(gi209427787) | 1e-126 | Click |
| 62 | 1962025..1962768 | PHAGE_Entero_2008: putative tail component K-like protein; ECs1986; phage(gi209427789) | 2e-140 | Click |
| 63 | 1962666..1963346 | PHAGE_Entero_2008: putative tail assembly protein; ECs1987; phage(gi209427790) | 2e-120 | Click |
| 64 | 1963300..1963506 | hypothetical protein; ECs1988 | N/A | Click |
| 65 | complement(1963537..1964064) | PHAGE_Salmon_1: hypothetical bacteriophage protein; ECs1989; phage(gi169257202) | 3e-61 | Click |
| 66 | 1964198..1967695 | PHAGE_Entero_2008: phage-related tail protein; ECs1990; phage(gi209427791) | 0.0 | Click |
| 67 | 1967766..1968365 | PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs1991; phage(gi209427792) | 6e-112 | Click |
| 68 | 1968658..1969743 | PHAGE_Entero_2008: putative tail protein; ECs1992; phage(gi209427793) | 3e-158 | Click |
| 69 | 1969673..1970014 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip028; ECs1993; phage(gi20065824) | 3e-58 | Click |
| 70 | 1970127..1970702 | PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs1994; phage(gi209427796) | 6e-20 | Click |
| 71 | 1970775..1971404 | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs1995; phage(gi209427795) | 5e-79 | Click |
| 72 | 1971486..1972127 | PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs1996; phage(gi209427796) | 2e-119 | Click |
| 73 | 1972367..1972378 | attR AAATGGGGCAAA | N/A | Click |
Region 11, total : 133 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2155111..2155314 | PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECs2150; phage(gi410491512) | 1e-13 | Click |
| 2 | complement(2155350..2156810) | PHAGE_Microm_MpV1: hypothetical protein; ECs2151; phage(gi313768442) | 4e-41 | Click |
| 3 | complement(2156899..2158182) | PHAGE_Burkho_phi1026b: gp59; ECs2152; phage(gi38707949) | 2e-33 | Click |
| 4 | 2158314..2158556 | PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2153; phage(gi209427797) | 1e-29 | Click |
| 5 | complement(2158718..2159359) | PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs2154; phage(gi209427796) | 7e-117 | Click |
| 6 | complement(2159441..2160070) | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2155; phage(gi209427795) | 4e-79 | Click |
| 7 | complement(2160143..2160718) | PHAGE_Entero_2008: hypothetical protein YYZ_gp73; ECs2156; phage(gi209427796) | 8e-20 | Click |
| 8 | complement(2160832..2161101) | PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs2157; phage(gi209427794) | 5e-45 | Click |
| 9 | complement(2161515..2162324) | PHAGE_Entero_2008: putative tail protein; ECs2159; phage(gi209427793) | 4e-122 | Click |
| 10 | complement(2162389..2162988) | PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2160; phage(gi209427792) | 2e-114 | Click |
| 11 | complement(2163056..2166535) | PHAGE_Entero_2008: phage-related tail protein; ECs2161; phage(gi209427791) | 0.0 | Click |
| 12 | 2166004..2166015 | attL TAAAGGGCCGGG | N/A | Click |
| 13 | complement(2166776..2167453) | PHAGE_Entero_2008: putative tail assembly protein; ECs2162; phage(gi209427790) | 2e-117 | Click |
| 14 | complement(2167351..2168034) | PHAGE_Entero_2008: putative tail component K-like protein; ECs2163; phage(gi209427789) | 4e-104 | Click |
| 15 | complement(2167863..2168093) | PHAGE_Entero_2008: putative tail component K-like protein; ECs5445; phage(gi209427789) | 5e-28 | Click |
| 16 | complement(2168104..2168802) | PHAGE_Entero_2008: putative tail protein; ECs2164; phage(gi209427787) | 5e-130 | Click |
| 17 | complement(2168802..2169131) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2165; phage(gi15832202) | 4e-60 | Click |
| 18 | complement(2169128..2171740) | PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECs2166; phage(gi15832203) | 0.0 | Click |
| 19 | complement(2171721..2172134) | PHAGE_Entero_HK630: tail assembly protein GT; ECs2167; phage(gi428782802) | 3e-46 | Click |
| 20 | complement(2172161..2172583) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2168; phage(gi15832205) | 7e-74 | Click |
| 21 | complement(2172597..2173349) | PHAGE_Entero_HK630: major tail protein V; ECs2169; phage(gi428782800) | 1e-112 | Click |
| 22 | complement(2173357..2173752) | PHAGE_Entero_HK630: minor tail protein U; ECs2170; phage(gi428782799) | 6e-59 | Click |
| 23 | complement(2173749..2174282) | PHAGE_Entero_HK630: minor tail protein Z; ECs2171; phage(gi428782798) | 2e-65 | Click |
| 24 | complement(2174297..2174650) | PHAGE_Entero_HK630: head-tail connector Fii; ECs2172; phage(gi428782797) | 2e-58 | Click |
| 25 | complement(2174662..2175060) | PHAGE_Entero_HK225: head assembly protein Fi; ECs2173; phage(gi428782384) | 7e-21 | Click |
| 26 | complement(2175102..2176127) | PHAGE_Entero_HK630: major head subunit E; ECs2174; phage(gi428782795) | 0.0 | Click |
| 27 | complement(2176183..2176515) | PHAGE_Entero_HK630: head decoration protein D; ECs2175; phage(gi428782794) | 7e-58 | Click |
| 28 | complement(2176525..2177844) | PHAGE_Entero_HK630: head maturation protease C; ECs2176; phage(gi428782792) | 0.0 | Click |
| 29 | complement(2177825..2179426) | PHAGE_Entero_HK630: portal protein B; ECs2177; phage(gi428782791) | 0.0 | Click |
| 30 | complement(2179423..2179629) | PHAGE_Entero_HK630: head-tail connector W; ECs2178; phage(gi428782790) | 1e-31 | Click |
| 31 | complement(2179626..2181551) | PHAGE_Entero_HK630: terminase large subunit A; ECs2179; phage(gi428782789) | 0.0 | Click |
| 32 | complement(2181526..2182071) | PHAGE_Entero_HK630: terminase small subunit nu1; ECs2180; phage(gi428782788) | 2e-81 | Click |
| 33 | 2182458..2182682 | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs2181; phage(gi209427772) | 3e-19 | Click |
| 34 | complement(2182764..2183078) | transcriptional regulator; ECs2182 | N/A | Click |
| 35 | complement(2183542..2184000) | PHAGE_Stx2_c_I: endopeptidase; ECs2184; phage(gi20065955) | 3e-64 | Click |
| 36 | complement(2184158..2184727) | PHAGE_Entero_2008: putative antirepressor; ECs2185; phage(gi209427770) | 2e-106 | Click |
| 37 | complement(2184998..2185531) | PHAGE_Entero_2008: putative endolysin; ECs2186; phage(gi209427769) | 4e-103 | Click |
| 38 | complement(2185582..2185926) | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2187; phage(gi209427768) | 9e-61 | Click |
| 39 | complement(2185931..2186137) | PHAGE_Entero_2008: lysis protein; ECs2188; phage(gi209427767) | 6e-33 | Click |
| 40 | 2186145..2186306 | hypothetical protein; ECs5446 | N/A | Click |
| 41 | complement(2186628..2188436) | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2189; phage(gi209427766) | 0.0 | Click |
| 42 | complement(2188914..2189345) | PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2190; phage(gi431810338) | 1e-28 | Click |
| 43 | complement(2189515..2189591) | tRNA | N/A | Click |
| 44 | complement(2189605..2189684) | tRNA | N/A | Click |
| 45 | complement(2189692..2189767) | tRNA | N/A | Click |
| 46 | complement(2189796..2190383) | transcriptional regulator; ECs2191 | N/A | Click |
| 47 | complement(2190645..2190842) | PHAGE_Entero_phiP27: hypothetical protein P27p23; ECs2192; phage(gi18249887) | 7e-29 | Click |
| 48 | complement(2191067..2191621) | PHAGE_Salmon_vB_SosS_Oslo: antitermination protein Q; ECs2193; phage(gi399528832) | 1e-06 | Click |
| 49 | complement(2191684..2191989) | PHAGE_Escher_HK75: RusA-like protein; ECs2194; phage(gi356870726) | 2e-32 | Click |
| 50 | complement(2192002..2193084) | PHAGE_Entero_mEp460: hypothetical protein; ECs2195; phage(gi428782365) | 6e-112 | Click |
| 51 | complement(2193053..2193325) | PHAGE_Gifsy_2: hypothetical protein STM1021.1n.Gifsy2; ECs2196; phage(gi169257287) | 5e-14 | Click |
| 52 | complement(2193447..2193791) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip070; ECs2197; phage(gi20065865) | 8e-59 | Click |
| 53 | complement(2193911..2194123) | PHAGE_Stx2_c_II: putative host killer protein; ECs2198; phage(gi302393105) | 4e-33 | Click |
| 54 | complement(2194357..2194914) | PHAGE_Escher_TL_2011c: hypothetical protein; ECs2199; phage(gi418487081) | 6e-28 | Click |
| 55 | complement(2194916..2195134) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip090; ECs2200; phage(gi20065885) | 3e-24 | Click |
| 56 | complement(2195262..2195573) | PHAGE_Entero_mEp213: hypothetical protein; ECs2201; phage(gi428782634) | 9e-21 | Click |
| 57 | complement(2195566..2195793) | PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECs2202; phage(gi169257161) | 2e-16 | Click |
| 58 | complement(2195790..2196071) | hypothetical protein; ECs2203 | N/A | Click |
| 59 | complement(2196104..2196838) | hypothetical protein; ECs2204 | N/A | Click |
| 60 | complement(2196854..2197516) | PHAGE_Escher_HK639: replication protein 14; ECs2205; phage(gi356870655) | 9e-29 | Click |
| 61 | complement(2197308..2198351) | PHAGE_Escher_TL_2011b: hypothetical protein; ECs2206; phage(gi418487646) | 3e-48 | Click |
| 62 | complement(2198420..2198845) | PHAGE_Escher_HK639: cII; ECs2207; phage(gi356870652) | 2e-05 | Click |
| 63 | complement(2198829..2199071) | PHAGE_Pectob_ZF40: putative cro anti-repressor; ECs2208; phage(gi422936651) | 5e-09 | Click |
| 64 | 2199277..2199801 | PHAGE_Pectob_ZF40: putative cI repressor; ECs2209; phage(gi422936650) | 2e-14 | Click |
| 65 | 2200013..2200246 | PHAGE_Salico_CGphi29: hypothetical protein; ECs2210; phage(gi472340166) | 5e-09 | Click |
| 66 | 2200258..2200896 | PHAGE_Escher_TL_2011c: hypothetical protein; ECs2211; phage(gi418487085) | 6e-09 | Click |
| 67 | complement(2200897..2201106) | hypothetical protein; ECs2212 | N/A | Click |
| 68 | complement(2201155..2201415) | hypothetical protein; ECs2213 | N/A | Click |
| 69 | 2201671..2201859 | cell division inhibitor; ECs2214 | N/A | Click |
| 70 | 2201856..2202044 | hypothetical protein; ECs2215 | N/A | Click |
| 71 | 2202137..2203381 | PHAGE_Gifsy_2: putatitive bacteriophage exodeoxyribonuclease VIII; ECs2216; phage(gi169257272) | 7e-92 | Click |
| 72 | 2203363..2203914 | PHAGE_Entero_2008: putative integrase; ECs2217; phage(gi209427727) | 2e-61 | Click |
| 73 | 2204020..2204274 | PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2218; phage(gi209427797) | 2e-11 | Click |
| 74 | complement(2204277..2205167) | PROPHAGE_Escher_Sakai: putative transposase; ECs2219; phage(gi15834498) | 2e-173 | Click |
| 75 | complement(2205164..2205490) | PHAGE_Stx2_c_II: putative transposase; ECs2220; phage(gi302393161) | 1e-58 | Click |
| 76 | complement(2205697..2206566) | PROPHAGE_Escher_CFT073: transposase; ECs2221; phage(gi26246249) | 1e-126 | Click |
| 77 | 2206610..2206990 | PHAGE_Stx2_c_1717: truncated transposase; ECs2222; phage(gi209447151) | 9e-69 | Click |
| 78 | 2206987..2207334 | PHAGE_Stx2_c_1717: transposase; ECs2223; phage(gi209447152) | 2e-62 | Click |
| 79 | 2207384..2208922 | PHAGE_Stx2_c_1717: transposase; ECs2224; phage(gi209447153) | 0.0 | Click |
| 80 | complement(2209505..2209876) | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2226; phage(gi209427795) | 3e-18 | Click |
| 81 | complement(2210140..2210487) | PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp79; ECs2227; phage(gi209447202) | 2e-50 | Click |
| 82 | complement(2210866..2211375) | PHAGE_Entero_2008: hypothetical protein YYZ_gp72; ECs2229; phage(gi209427795) | 3e-21 | Click |
| 83 | complement(2211555..2211824) | PHAGE_Entero_2008: hypothetical protein YYZ_gp71; ECs2230; phage(gi209427794) | 5e-45 | Click |
| 84 | complement(2211826..2213049) | PHAGE_Entero_2008: putative tail protein; ECs2231; phage(gi209427793) | 0.0 | Click |
| 85 | complement(2213114..2213713) | PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2232; phage(gi209427792) | 2e-114 | Click |
| 86 | complement(2217597..2218277) | PHAGE_Entero_2008: putative tail assembly protein; ECs2236; phage(gi209427790) | 1e-120 | Click |
| 87 | complement(2218175..2218849) | PHAGE_Entero_2008: putative tail component K-like protein; ECs2237; phage(gi209427789) | 2e-127 | Click |
| 88 | complement(2218929..2219627) | PHAGE_Entero_2008: putative tail protein; ECs2238; phage(gi209427787) | 1e-128 | Click |
| 89 | complement(2219627..2219968) | PHAGE_Entero_2008: putative minor tail protein; ECs2239; phage(gi209427786) | 4e-64 | Click |
| 90 | complement(2219961..2223203) | PHAGE_Entero_2008: putative tail protein; ECs2240; phage(gi209427785) | 0.0 | Click |
| 91 | complement(2223251..2223532) | PHAGE_Entero_2008: hypothetical protein YYZ_gp61; ECs2241; phage(gi209427784) | 1e-47 | Click |
| 92 | complement(2223556..2223930) | PHAGE_Entero_2008: putative tail assembly protein; ECs2242; phage(gi209427783) | 4e-67 | Click |
| 93 | complement(2223945..2224661) | PHAGE_Entero_2008: putative tail protein; ECs2243; phage(gi209427782) | 1e-131 | Click |
| 94 | complement(2224727..2225071) | PHAGE_Entero_2008: putative prophage structural protein; ECs2244; phage(gi209427781) | 6e-60 | Click |
| 95 | complement(2225068..2225514) | PHAGE_Entero_2008: hypothetical protein YYZ_gp57; ECs2245; phage(gi209427780) | 6e-79 | Click |
| 96 | complement(2225511..2225861) | PHAGE_Entero_2008: putative head-tail adaptor; ECs2246; phage(gi209427779) | 8e-62 | Click |
| 97 | complement(2225871..2226197) | PHAGE_Entero_2008: hypothetical protein YYZ_gp55; ECs2247; phage(gi209427778) | 3e-55 | Click |
| 98 | complement(2226200..2228779) | PHAGE_Entero_2008: putative portal protein; ECs2248; phage(gi209427777) | 0.0 | Click |
| 99 | complement(2228725..2228946) | PHAGE_Entero_2008: hypothetical protein YYZ_gp53; ECs5451; phage(gi209427801) | 2e-36 | Click |
| 100 | complement(2228991..2230928) | PHAGE_Entero_2008: putative major head protein/prohead proteinase; ECs2250; phage(gi209427776) | 0.0 | Click |
| 101 | complement(2230992..2232653) | PHAGE_Entero_2008: putative phage terminase-like protein large subunit; ECs2251; phage(gi209427775) | 0.0 | Click |
| 102 | complement(2232650..2233213) | PHAGE_Entero_2008: putative phage terminase; ECs2252; phage(gi209427774) | 1e-95 | Click |
| 103 | complement(2233397..2233540) | hypothetical protein; ECs2253 | N/A | Click |
| 104 | complement(2233503..2233868) | PHAGE_Entero_2008: putative DNAse; ECs2254; phage(gi209427773) | 4e-67 | Click |
| 105 | 2233910..2234137 | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECs2255; phage(gi209427772) | 5e-38 | Click |
| 106 | complement(2234500..2234967) | PHAGE_Entero_2008: putative endopeptidase; ECs2257; phage(gi209427771) | 1e-82 | Click |
| 107 | complement(2235121..2235690) | PHAGE_Entero_2008: putative antirepressor; ECs2258; phage(gi209427770) | 7e-107 | Click |
| 108 | complement(2235961..2236494) | PHAGE_Entero_2008: putative endolysin; ECs2259; phage(gi209427769) | 4e-104 | Click |
| 109 | complement(2236545..2236889) | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2260; phage(gi209427768) | 9e-61 | Click |
| 110 | complement(2236894..2237100) | PHAGE_Entero_2008: lysis protein; ECs2261; phage(gi209427767) | 6e-33 | Click |
| 111 | 2237108..2237254 | hypothetical protein; ECs5452 | N/A | Click |
| 112 | complement(2237549..2239399) | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2262; phage(gi209427766) | 0.0 | Click |
| 113 | complement(2239448..2239576) | hypothetical protein; ECs2263 | N/A | Click |
| 114 | complement(2239721..2239987) | hypothetical protein; ECs2264 | N/A | Click |
| 115 | complement(2239878..2240306) | PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2265; phage(gi431810338) | 3e-26 | Click |
| 116 | complement(2240486..2240562) | tRNA | N/A | Click |
| 117 | complement(2240576..2240652) | tRNA | N/A | Click |
| 118 | complement(2240660..2240735) | tRNA | N/A | Click |
| 119 | 2240727..2240738 | attR TAAAGGGCCGGG | N/A | Click |
| 120 | complement(2240946..2241635) | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs2267; phage(gi169257244) | 1e-80 | Click |
| 121 | complement(2241632..2241991) | PHAGE_Escher_HK75: RusA-like protein; ECs2268; phage(gi356870726) | 1e-38 | Click |
| 122 | complement(2242004..2243053) | PHAGE_Entero_mEp460: hypothetical protein; ECs2269; phage(gi428782365) | 4e-110 | Click |
| 123 | complement(2243501..2243713) | PHAGE_Stx2_c_II: putative host killer protein; ECs5456; phage(gi302393105) | 2e-29 | Click |
| 124 | 2243758..2243913 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip072; ECs2270; phage(gi20065867) | 7e-11 | Click |
| 125 | complement(2243902..2244006) | hypothetical protein; ECs2271 | N/A | Click |
| 126 | complement(2244122..2244706) | PHAGE_Entero_cdtI: Valyl-tRNA synthetase; ECs2272; phage(gi148609417) | 2e-14 | Click |
| 127 | complement(2244763..2245158) | hypothetical protein; ECs2273 | N/A | Click |
| 128 | complement(2245174..2245842) | PHAGE_Stx2_c_86: hypothetical protein Stx2-86_gp38; ECs2274; phage(gi116222030) | 1e-05 | Click |
| 129 | complement(2245764..2245943) | hypothetical protein; ECs5457 | N/A | Click |
| 130 | complement(2245969..2246709) | PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECs2275; phage(gi169257280) | 8e-77 | Click |
| 131 | complement(2246716..2247627) | PHAGE_Entero_phiP27: hypothetical protein P27p17; ECs2276; phage(gi18249881) | 6e-27 | Click |
| 132 | complement(2247701..2248126) | PHAGE_Entero_mEp237: CII protein; ECs2277; phage(gi435439306) | 3e-05 | Click |
| 133 | complement(2248123..2248425) | PHAGE_Entero_c_1: prophage antirepressor; ECs2278; phage(gi428781783) | 5e-08 | Click |
| 134 | 2248460..2248894 | hypothetical protein; ECs2279 | N/A | Click |
| 135 | 2248879..2249106 | hypothetical protein; ECs2280 | N/A | Click |
| 136 | 2249108..2249386 | hypothetical protein; ECs2281 | N/A | Click |
| 137 | 2249591..2249755 | hypothetical protein; ECs2282 | N/A | Click |
| 138 | 2249682..2250038 | hypothetical protein; ECs2283 | N/A | Click |
| 139 | 2250110..2250328 | hypothetical protein; ECs5458 | N/A | Click |
| 140 | 2250897..2251085 | inhibitor of cell division; ECs2284 | N/A | Click |
| 141 | 2251082..2251273 | hypothetical protein; ECs2285 | N/A | Click |
| 142 | 2251366..2253837 | PHAGE_Entero_mEp460: putative exonuclease; ECs2286; phage(gi428782342) | 4e-58 | Click |
Region 12, total : 50 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2668007..2668037 | attL TGGCGGAGAGAGGGGGATTTGAACCCCCGGT | N/A | Click |
| 2 | complement(2676725..2677402) | PROPHAGE_Escher_Sakai: putative tail assembly protein; ECs2721; phage(gi15832199) | 7e-126 | Click |
| 3 | complement(2677300..2677869) | PROPHAGE_Escher_Sakai: putative tail assembly protein; ECs2722; phage(gi15832200) | 8e-116 | Click |
| 4 | complement(2678054..2678752) | PHAGE_Entero_HK630: minor tail protein L; ECs2723; phage(gi428782805) | 4e-104 | Click |
| 5 | complement(2678752..2679081) | PHAGE_Entero_HK630: minor tail protein M; ECs2724; phage(gi428782804) | 5e-46 | Click |
| 6 | complement(2681637..2681942) | PHAGE_Entero_HK630: tail assembly protein GT; ECs2727; phage(gi428782802) | 8e-28 | Click |
| 7 | complement(2682077..2682508) | PHAGE_Entero_HK630: minor tail protein G; ECs2728; phage(gi428782801) | 5e-45 | Click |
| 8 | complement(2682522..2683184) | PHAGE_Entero_HK630: major tail protein V; ECs2729; phage(gi428782800) | 5e-97 | Click |
| 9 | complement(2683244..2683510) | PHAGE_Entero_HK630: major head subunit E; ECs2730; phage(gi428782795) | 2e-20 | Click |
| 10 | complement(2683568..2683915) | PHAGE_Entero_HK630: head decoration protein D; ECs2731; phage(gi428782794) | 6e-25 | Click |
| 11 | complement(2683952..2685457) | PHAGE_Entero_HK630: head maturation protease C; ECs2732; phage(gi428782792) | 4e-108 | Click |
| 12 | complement(2685447..2687039) | PHAGE_Entero_HK630: portal protein B; ECs2733; phage(gi428782791) | 0.0 | Click |
| 13 | complement(2687036..2687242) | PHAGE_Entero_HK630: head-tail connector W; ECs2734; phage(gi428782790) | 1e-11 | Click |
| 14 | complement(2687226..2689154) | PHAGE_Entero_HK630: terminase large subunit A; ECs2735; phage(gi428782789) | 0.0 | Click |
| 15 | complement(2689126..2689635) | PHAGE_Entero_HK630: terminase small subunit nu1; ECs2736; phage(gi428782788) | 8e-18 | Click |
| 16 | complement(2690336..2690650) | transcriptional regulator; ECs2737 | N/A | Click |
| 17 | complement(2690892..2691032) | hypothetical protein; ECs5470 | N/A | Click |
| 18 | complement(2691115..2691582) | PHAGE_Entero_4795: putative endopeptidase Rz; ECs2739; phage(gi157166036) | 6e-69 | Click |
| 19 | complement(2691734..2691916) | hypothetical protein; ECs2740 | N/A | Click |
| 20 | complement(2692072..2692605) | PHAGE_Entero_4795: putative R protein; ECs2741; phage(gi157166033) | 9e-100 | Click |
| 21 | complement(2692656..2693000) | PHAGE_Entero_2008: hypothetical protein YYZ_gp44; ECs2742; phage(gi209427768) | 6e-60 | Click |
| 22 | complement(2693005..2693211) | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs2743; phage(gi209447171) | 1e-32 | Click |
| 23 | 2693531..2693857 | PHAGE_Stx2_c_II: putative transposase; ECs2744; phage(gi302393161) | 1e-58 | Click |
| 24 | 2693854..2694744 | PROPHAGE_Escher_Sakai: putative transposase; ECs2745; phage(gi15834498) | 2e-173 | Click |
| 25 | complement(2694826..2696676) | PHAGE_Entero_2008: hypothetical protein YYZ_gp42; ECs2746; phage(gi209427766) | 0.0 | Click |
| 26 | complement(2696990..2697157) | PHAGE_Entero_P1: TciB; ECs2748; phage(gi46401695) | 3e-08 | Click |
| 27 | complement(2697154..2697582) | PHAGE_Pseudo_AF: putative tellurite resistance protein; ECs2749; phage(gi431810338) | 2e-26 | Click |
| 28 | complement(2697756..2697832) | tRNA | N/A | Click |
| 29 | complement(2697846..2697922) | tRNA | N/A | Click |
| 30 | complement(2697930..2698005) | tRNA | N/A | Click |
| 31 | complement(2698216..2698905) | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; ECs2750; phage(gi169257244) | 9e-80 | Click |
| 32 | complement(2698902..2699261) | PHAGE_Escher_HK75: RusA-like protein; ECs2751; phage(gi356870726) | 1e-37 | Click |
| 33 | complement(2699274..2700323) | PHAGE_Entero_mEp460: hypothetical protein; ECs2752; phage(gi428782365) | 4e-111 | Click |
| 34 | complement(2700325..2700603) | PHAGE_Cronob_phiES15: hypothetical protein; ECs2753; phage(gi401817580) | 1e-13 | Click |
| 35 | complement(2700771..2700983) | PHAGE_Stx2_c_II: putative host killer protein; ECs2754; phage(gi302393105) | 4e-27 | Click |
| 36 | complement(2701170..2701274) | hypothetical protein; ECs2755 | N/A | Click |
| 37 | complement(2701384..2701947) | PHAGE_Entero_mEp460: hypothetical protein; ECs2756; phage(gi428782343) | 5e-41 | Click |
| 38 | complement(2702074..2702385) | PHAGE_Entero_mEp213: hypothetical protein; ECs2757; phage(gi428782634) | 2e-24 | Click |
| 39 | complement(2702382..2702570) | hypothetical protein; ECs2758 | N/A | Click |
| 40 | complement(2702567..2702923) | PHAGE_Entero_HK629: hypothetical protein; ECs2759; phage(gi428782046) | 9e-16 | Click |
| 41 | complement(2702920..2703144) | PHAGE_Salmon_1: hypothetical protein STM0896.1n.Fels1; ECs2760; phage(gi169257161) | 4e-15 | Click |
| 42 | complement(2703166..2703864) | hypothetical protein; ECs2761 | N/A | Click |
| 43 | complement(2703899..2704561) | PHAGE_Escher_HK639: replication protein 14; ECs2762; phage(gi356870655) | 1e-30 | Click |
| 44 | complement(2704353..2705390) | PHAGE_Escher_TL_2011b: hypothetical protein; ECs2763; phage(gi418487646) | 1e-46 | Click |
| 45 | complement(2705459..2705884) | PHAGE_Pectob_ZF40: putative cII repressor; ECs2764; phage(gi422936652) | 4e-06 | Click |
| 46 | complement(2705881..2706108) | PHAGE_Entero_mEp390: prophage anti-repressor; ECs2765; phage(gi428782702) | 5e-08 | Click |
| 47 | 2706203..2706850 | PHAGE_Entero_mEp390: prophage repressor; ECs2766; phage(gi428782701) | 2e-25 | Click |
| 48 | 2707125..2707277 | PHAGE_Salico_CGphi29: hypothetical protein; ECs2767; phage(gi472340166) | 1e-08 | Click |
| 49 | 2707758..2707946 | cell division inhibition protein; ECs2768 | N/A | Click |
| 50 | 2707943..2708131 | hypothetical protein; ECs2769 | N/A | Click |
| 51 | 2708227..2710425 | PHAGE_Salmon_ST64B: Endodeoxyribonuclease; ECs2770; phage(gi23505474) | 2e-20 | Click |
| 52 | 2710379..2710699 | PHAGE_Entero_mEp460: putative exonuclease; ECs2771; phage(gi428782342) | 3e-30 | Click |
| 53 | 2710758..2710961 | hypothetical protein; ECs2772 | N/A | Click |
| 54 | 2710961..2711983 | PHAGE_Salmon_ST64B: Integrase protein; ECs2773; phage(gi23505472) | 2e-102 | Click |
| 55 | 2712036..2712066 | attR TGGCGGAGAGAGGGGGATTTGAACCCCCGGT | N/A | Click |
Region 13, total : 81 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2888774..2891011 | PHAGE_Stx2_c_II: hypothetical protein Stx2II_gp76; ECs2931; phage(gi302393159) | 5e-44 | Click |
| 2 | complement(2890818..2891708) | PROPHAGE_Escher_Sakai: putative transposase; ECs2932; phage(gi15834498) | 2e-173 | Click |
| 3 | complement(2891705..2892031) | PROPHAGE_Escher_Sakai: putative transposase; ECs2933; phage(gi15832212) | 3e-58 | Click |
| 4 | 2892203..2892676 | hypothetical protein; ECs2934 | N/A | Click |
| 5 | 2892298..2892309 | attL ATCGAAGAAATT | N/A | Click |
| 6 | complement(2892718..2893188) | hypothetical protein; ECs2935 | N/A | Click |
| 7 | complement(2893235..2893954) | two-component response-regulatory protein YehT; ECs2936 | N/A | Click |
| 8 | complement(2893951..2895636) | PHAGE_Entero_2008: putative 2-component sensor protein YehU; ECs2937; phage(gi209427798) | 0.0 | Click |
| 9 | 2896151..2896399 | PHAGE_Entero_2008: putative DNA damage-inducible protein; ECs2939; phage(gi209427797) | 3e-40 | Click |
| 10 | complement(2896767..2897075) | PHAGE_Stx2_c_II: putative tail fiber protein; ECs2940; phage(gi302393091) | 2e-51 | Click |
| 11 | complement(2897038..2898351) | PHAGE_Entero_2008: putative tail protein; ECs2941; phage(gi209427793) | 0.0 | Click |
| 12 | complement(2898416..2899015) | PHAGE_Entero_2008: putative outer membrane protein Lom precursor; ECs2942; phage(gi209427792) | 1e-97 | Click |
| 13 | complement(2902796..2903473) | PHAGE_Entero_2008: putative tail assembly protein; ECs2945; phage(gi209427790) | 2e-117 | Click |
| 14 | complement(2903371..2904114) | PHAGE_Entero_2008: putative tail component K-like protein; ECs2946; phage(gi209427789) | 6e-139 | Click |
| 15 | complement(2904125..2904823) | PHAGE_Entero_2008: putative tail protein; ECs2947; phage(gi209427787) | 7e-129 | Click |
| 16 | complement(2904823..2905152) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2948; phage(gi15832202) | 4e-60 | Click |
| 17 | complement(2905149..2907794) | PROPHAGE_Escher_Sakai: putative tail length tape measure protein precursor; ECs2949; phage(gi15832203) | 0.0 | Click |
| 18 | complement(2907838..2908146) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2950; phage(gi15832204) | 2e-57 | Click |
| 19 | complement(2908173..2908595) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2951; phage(gi15832205) | 2e-76 | Click |
| 20 | complement(2908609..2909361) | PHAGE_Entero_HK630: major tail protein V; ECs2952; phage(gi428782800) | 1e-112 | Click |
| 21 | complement(2909369..2909767) | PROPHAGE_Escher_Sakai: putative minor tail protein U; ECs2953; phage(gi15832207) | 1e-72 | Click |
| 22 | complement(2909780..2910403) | PROPHAGE_Escher_Sakai: putative minor tail protein; ECs2954; phage(gi15832208) | 6e-112 | Click |
| 23 | complement(2910406..2910687) | PHAGE_Entero_mEp460: hypothetical protein; ECs2955; phage(gi428782323) | 6e-22 | Click |
| 24 | complement(2910680..2911006) | PHAGE_Entero_mEp213: hypothetical protein; ECs2956; phage(gi428782595) | 1e-32 | Click |
| 25 | complement(2911094..2912110) | PHAGE_Entero_mEp213: head maturation protease; ECs2957; phage(gi428782594) | 1e-162 | Click |
| 26 | 2912256..2912582 | PROPHAGE_Escher_Sakai: putative transposase; ECs2958; phage(gi15832212) | 3e-58 | Click |
| 27 | 2912579..2913469 | PROPHAGE_Escher_Sakai: putative transposase; ECs2959; phage(gi15834498) | 2e-173 | Click |
| 28 | complement(2913472..2914578) | PHAGE_Entero_mEp213: head maturation protease; ECs2960; phage(gi428782594) | 7e-122 | Click |
| 29 | complement(2914376..2915878) | PROPHAGE_Escher_Sakai: putative portal protein; ECs2961; phage(gi15832215) | 0.0 | Click |
| 30 | complement(2915878..2916114) | PHAGE_Entero_mEp460: hypothetical protein; ECs2962; phage(gi428782319) | 3e-23 | Click |
| 31 | complement(2916087..2918210) | PROPHAGE_Escher_Sakai: putative terminase large subunit; ECs2963; phage(gi15832217) | 0.0 | Click |
| 32 | complement(2918207..2918683) | PHAGE_Salmon_1: bacteriophage terminase, small subunit; ECs2964; phage(gi169257184) | 3e-47 | Click |
| 33 | 2918740..2918988 | hypothetical protein; ECs5480 | N/A | Click |
| 34 | complement(2919138..2919605) | PHAGE_Entero_2008: putative endopeptidase; ECs2966; phage(gi209427771) | 1e-82 | Click |
| 35 | complement(2919759..2920328) | PHAGE_Entero_2008: putative antirepressor; ECs2967; phage(gi209427770) | 7e-107 | Click |
| 36 | complement(2920599..2921132) | PHAGE_Stx2_c_II: endolysin; ECs2968; phage(gi302393165) | 1e-103 | Click |
| 37 | complement(2921137..2921352) | PHAGE_Stx2_c_II: holin; ECs2969; phage(gi302393164) | 2e-35 | Click |
| 38 | complement(2921430..2921675) | PHAGE_Escher_P13374: hypothetical protein; ECs2970; phage(gi410491644) | 6e-39 | Click |
| 39 | complement(2921716..2921895) | PHAGE_Escher_P13374: hypothetical protein; ECs2971; phage(gi410491643) | 2e-28 | Click |
| 40 | complement(2922033..2923979) | PHAGE_Stx1_converting: hypothetical protein Stx1_gp75; ECs2972; phage(gi302861197) | 0.0 | Click |
| 41 | complement(2924490..2924759) | PHAGE_Entero_2008: Shiga toxin 1 subunit B; ECs2973; phage(gi209427764) | 4e-46 | Click |
| 42 | complement(2924769..2925716) | PHAGE_Entero_2008: Shiga toxin 1 subunit A; ECs2974; phage(gi209427763) | 1e-176 | Click |
| 43 | complement(2926223..2926657) | PHAGE_Stx1_converting: antitermination protein Q; ECs2975; phage(gi302861194) | 2e-83 | Click |
| 44 | complement(2926650..2926844) | PHAGE_Stx2_c_II: NinH protein; ECs2976; phage(gi302393155) | 2e-32 | Click |
| 45 | complement(2926841..2927446) | PHAGE_Stx1_converting: NinG protein; ECs2977; phage(gi302861192) | 1e-118 | Click |
| 46 | complement(2927439..2927648) | PHAGE_Entero_mEp234: NinF protein; ECs2978; phage(gi428782303) | 1e-29 | Click |
| 47 | complement(2927608..2928009) | PHAGE_Stx1_converting: hypothetical protein Stx1_gp68; ECs2979; phage(gi302861190) | 3e-76 | Click |
| 48 | complement(2928012..2928188) | PHAGE_Entero_mEp234: NinE protein; ECs2980; phage(gi428782301) | 4e-30 | Click |
| 49 | complement(2928185..2928712) | PHAGE_Entero_2008: putative DNA N-6-adenine-methyltransferase; ECs2981; phage(gi209427758) | 1e-101 | Click |
| 50 | complement(2928709..2929155) | PHAGE_Entero_2008: putative recombination protein; ECs2982; phage(gi209427757) | 4e-83 | Click |
| 51 | complement(2929112..2929537) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip131; ECs2983; phage(gi20065926) | 1e-81 | Click |
| 52 | complement(2929707..2929985) | PHAGE_Entero_2008: hypothetical protein YYZ_gp30; ECs2984; phage(gi209427755) | 2e-51 | Click |
| 53 | complement(2930056..2930346) | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip128; ECs2985; phage(gi20065923) | 2e-49 | Click |
| 54 | complement(2930343..2931044) | PHAGE_Entero_4795: putative replication protein P; ECs2986; phage(gi157166012) | 1e-131 | Click |
| 55 | complement(2931041..2931979) | PHAGE_Entero_4795: putative replication protein O; ECs2987; phage(gi157166011) | 0.0 | Click |
| 56 | complement(2932012..2932308) | PHAGE_Entero_mEpX1: CII protein; ECs2988; phage(gi428781917) | 7e-48 | Click |
| 57 | complement(2932423..2932641) | PHAGE_Entero_mEpX1: prophage antirepressor; ECs2989; phage(gi428781916) | 3e-36 | Click |
| 58 | 2932759..2933397 | PHAGE_Entero_mEpX1: prophage repressor; ECs2990; phage(gi428781915) | 4e-121 | Click |
| 59 | 2933520..2933801 | PHAGE_Entero_HK544: hypothetical protein; ECs2991; phage(gi428783256) | 1e-47 | Click |
| 60 | 2933808..2934359 | PHAGE_Entero_HK544: hypothetical protein; ECs2992; phage(gi428783255) | 1e-95 | Click |
| 61 | 2934872..2935144 | PHAGE_Entero_HK629: transcription antitermination protein N; ECs2993; phage(gi428782056) | 7e-45 | Click |
| 62 | complement(2935161..2935742) | PHAGE_Entero_HK140: superinfection exclusion protein; ECs2995; phage(gi428781984) | 4e-109 | Click |
| 63 | 2936003..2936371 | PHAGE_Stx2_c_I: Ea10 protein; ECs2996; phage(gi20065907) | 5e-68 | Click |
| 64 | 2936444..2936608 | PHAGE_Entero_HK630: CIII protein; ECs2997; phage(gi428782826) | 1e-27 | Click |
| 65 | 2936451..2936720 | PHAGE_Stx2_c_86: putative host killing protein Kil; ECs2998; phage(gi116222047) | 6e-44 | Click |
| 66 | 2937098..2937883 | PHAGE_Stx2_c_I: Bet protein; ECs3001; phage(gi20065900) | 2e-151 | Click |
| 67 | 2937880..2938557 | PHAGE_Entero_2008: putative exonuclease; ECs3002; phage(gi209427739) | 2e-131 | Click |
| 68 | 2938551..2938739 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip101; ECs3003; phage(gi20065896) | 5e-31 | Click |
| 69 | 2938712..2938903 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip099; ECs3004; phage(gi20065894) | 2e-29 | Click |
| 70 | 2938914..2939195 | PHAGE_Entero_2008: hypothetical protein YYZ_gp11; ECs3005; phage(gi209427737) | 7e-50 | Click |
| 71 | 2939294..2939515 | PHAGE_Entero_2008: hypothetical protein YYZ_gp10; ECs3006; phage(gi209427736) | 2e-37 | Click |
| 72 | 2939512..2940459 | PHAGE_Entero_2008: hypothetical protein YYZ_gp09; ECs3007; phage(gi209427735) | 0.0 | Click |
| 73 | 2940687..2940974 | PHAGE_Entero_2008: hypothetical protein YYZ_gp07; ECs5481; phage(gi209427733) | 2e-55 | Click |
| 74 | 2940971..2941327 | PHAGE_Entero_2008: hypothetical protein YYZ_gp06; ECs3009; phage(gi209427732) | 4e-65 | Click |
| 75 | 2941324..2941686 | PHAGE_Entero_2008: hypothetical protein YYZ_gp05; ECs3010; phage(gi209427731) | 7e-74 | Click |
| 76 | 2941774..2942016 | PHAGE_Entero_2008: hypothetical protein YYZ_gp04; ECs3011; phage(gi209427730) | 2e-40 | Click |
| 77 | 2942020..2942154 | PHAGE_Entero_2008: hypothetical protein YYZ_gp03; ECs5482; phage(gi209427729) | 3e-23 | Click |
| 78 | 2942173..2942427 | PHAGE_Entero_2008: putative excisionase; ECs3012; phage(gi209427728) | 4e-46 | Click |
| 79 | 2942359..2942370 | attR ATCGAAGAAATT | N/A | Click |
| 80 | 2942461..2943747 | PHAGE_Entero_2008: putative integrase; ECs3013; phage(gi209427727) | 0.0 | Click |
| 81 | 2943822..2944469 | transcriptional regulator; ECs3014 | N/A | Click |
| 82 | complement(2944617..2945348) | transport system permease protein; ECs3015 | N/A | Click |
| 83 | complement(2945353..2946279) | PHAGE_Plankt_PaV_LD: ABC transporter; ECs3016; phage(gi371496158) | 4e-25 | Click |
Region 14, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3476233..3476481 | PHAGE_Entero_cdtI: hypothetical protein PcdtI_gp30; ECs3483; phage(gi148609412) | 3e-41 | Click |
| 2 | complement(3476983..3477573) | chaperone-like protein; ECs3485 | N/A | Click |
| 3 | 3477756..3478406 | PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECs3486; phage(gi209447201) | 4e-26 | Click |
| 4 | 3478485..3479543 | hypothetical protein; ECs3487 | N/A | Click |
| 5 | 3479657..3479669 | attL ACACCAACAAAAA | N/A | Click |
| 6 | complement(3479673..3480095) | PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp78; ECs3488; phage(gi209447201) | 5e-21 | Click |
| 7 | complement(3480256..3480645) | PHAGE_Entero_4795: hypothetical protein PBV4795_ORF76; ECs3489; phage(gi157166061) | 2e-68 | Click |
| 8 | 3480743..3481069 | PHAGE_Stx2_c_1717: putative transposase; ECs3490; phage(gi209447180) | 1e-58 | Click |
| 9 | 3481066..3481956 | PROPHAGE_Escher_Sakai: putative transposase; ECs3491; phage(gi15834498) | 2e-173 | Click |
| 10 | complement(3481763..3482260) | PHAGE_Stx2_c_1717: transposase; ECs3492; phage(gi209447153) | 8e-46 | Click |
| 11 | complement(3482457..3482804) | PHAGE_Stx2_c_1717: transposase; ECs3493; phage(gi209447152) | 2e-62 | Click |
| 12 | complement(3482801..3483181) | PHAGE_Stx2_c_1717: truncated transposase; ECs3494; phage(gi209447151) | 9e-69 | Click |
| 13 | complement(3483538..3483882) | PHAGE_Entero_4795: hypothetical protein PBV4795_ORF47; ECs3496; phage(gi157166032) | 3e-60 | Click |
| 14 | complement(3483887..3484102) | PHAGE_Stx2_c_1717: holin protein S-like protein; ECs3497; phage(gi209447171) | 7e-35 | Click |
| 15 | complement(3484252..3486105) | PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp44; ECs3498; phage(gi209447169) | 0.0 | Click |
| 16 | 3486346..3486675 | hypothetical protein; ECs3499 | N/A | Click |
| 17 | complement(3486766..3487482) | hypothetical protein; ECs3500 | N/A | Click |
| 18 | complement(3487762..3488385) | PHAGE_Entero_mEpX1: late gene regulator Q; ECs3501; phage(gi428781929) | 7e-116 | Click |
| 19 | complement(3488382..3489047) | PHAGE_Stx2_c_1717: NinI protein; ECs3502; phage(gi209447164) | 3e-130 | Click |
| 20 | complement(3489044..3489655) | PHAGE_Stx2_c_1717: NinG protein; ECs3503; phage(gi209447163) | 5e-101 | Click |
| 21 | complement(3489630..3490196) | PHAGE_Xantho_Xp10: endonuclease of the HNH family with predicted DNA-binding module at C-terminus; ECs3504; phage(gi32128470) | 2e-35 | Click |
| 22 | 3491224..3491619 | lipoprotein; ECs3506 | N/A | Click |
| 23 | complement(3491695..3492963) | PHAGE_Cafete_BV_PW1: hypothetical protein; ECs3507; phage(gi310831380) | 6e-29 | Click |
| 24 | complement(3493359..3493772) | hypothetical protein; ECs3508 | N/A | Click |
| 25 | complement(3493870..3494268) | hypothetical protein; ECs3509 | N/A | Click |
| 26 | complement(3494269..3495900) | hypothetical protein; ECs3510 | N/A | Click |
| 27 | complement(3495897..3497210) | hypothetical protein; ECs3511 | N/A | Click |
| 28 | complement(3497212..3498417) | PHAGE_Temper_1: integrase-like protein; ECs3512; phage(gi16271777) | 8e-07 | Click |
| 29 | 3500189..3500201 | attR ACACCAACAAAAA | N/A | Click |
Region 15, total : 19 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4580800..4580811 | attL ACTTCAAATCCA | N/A | Click |
| 2 | 4581059..4582240 | PROPHAGE_Escher_Sakai: putative integrase; ECs4534; phage(gi15833788) | 0.0 | Click |
| 3 | 4582339..4582689 | PHAGE_Stx2_c_1717: putative transposase; ECs4535; phage(gi209447180) | 4e-05 | Click |
| 4 | 4582702..4582884 | hypothetical protein; ECs4536 | N/A | Click |
| 5 | 4582902..4583555 | PHAGE_Entero_Sf6: putative transposase OrfB; ECs4537; phage(gi41057343) | 3e-79 | Click |
| 6 | 4583573..4583716 | hypothetical protein; ECs4538 | N/A | Click |
| 7 | 4583806..4584180 | hypothetical protein; ECs4539 | N/A | Click |
| 8 | 4584177..4584668 | hypothetical protein; ECs4540 | N/A | Click |
| 9 | 4584680..4584877 | hypothetical protein; ECs4541 | N/A | Click |
| 10 | 4584962..4585303 | hypothetical protein; ECs4542 | N/A | Click |
| 11 | 4586059..4586460 | PHAGE_Stx2_c_1717: truncated transposase; ECs4545; phage(gi209447151) | 8e-73 | Click |
| 12 | 4586457..4586804 | PHAGE_Stx2_c_1717: transposase; ECs4546; phage(gi209447152) | 2e-62 | Click |
| 13 | 4586854..4588392 | PHAGE_Stx2_c_1717: transposase; ECs4547; phage(gi209447153) | 0.0 | Click |
| 14 | 4588589..4588822 | hypothetical protein; ECs4548 | N/A | Click |
| 15 | complement(4589257..4590003) | PHAGE_Suid_h_1: large tegument protein; ECs4550; phage(gi51557505) | 2e-08 | Click |
| 16 | complement(4590088..4590366) | hypothetical protein; ECs4551 | N/A | Click |
| 17 | complement(4590372..4590593) | EscF; ECs4552 | N/A | Click |
| 18 | complement(4590629..4591036) | hypothetical protein; ECs4553 | N/A | Click |
| 19 | complement(4591043..4591981) | PHAGE_Lactob_1: putative tail fibre protein; ECs4554; phage(gi226377752) | 1e-07 | Click |
| 20 | complement(4592002..4593126) | PHAGE_Strept_Sfi11: putative minor tail protein; ECs4555; phage(gi9635024) | 3e-05 | Click |
| 21 | 4601341..4601352 | attR ACTTCAAATCCA | N/A | Click |
Region 16, total : 60 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 5041814..5042062 | PHAGE_Entero_Mu: DNA binding protein ner; ECs4944; phage(gi9633495) | 2e-06 | Click |
| 2 | 5042064..5044154 | PROPHAGE_Escher_Sakai: phage transposase; ECs4945; phage(gi15834199) | 0.0 | Click |
| 3 | 5044225..5045157 | PHAGE_Entero_Mu: DNA transposition protein; ECs4946; phage(gi9633513) | 1e-72 | Click |
| 4 | 5045160..5045381 | hypothetical protein; ECs4947 | N/A | Click |
| 5 | 5045394..5045648 | hypothetical protein; ECs4948 | N/A | Click |
| 6 | 5045650..5045931 | PHAGE_Pseudo_MP38: host nuclease inhibitor protein; ECs4949; phage(gi215479937) | 7e-11 | Click |
| 7 | 5045928..5046200 | hypothetical protein; ECs4950 | N/A | Click |
| 8 | 5046205..5046498 | hypothetical protein; ECs4951 | N/A | Click |
| 9 | 5046510..5047040 | PHAGE_Entero_Mu: Gam; ECs4952; phage(gi9633500) | 4e-52 | Click |
| 10 | 5047138..5047680 | hypothetical protein; ECs4953 | N/A | Click |
| 11 | 5047684..5048217 | PHAGE_Entero_Mu: hypothetical protein Mup11; ECs4954; phage(gi9633501) | 1e-68 | Click |
| 12 | 5048217..5048732 | PHAGE_Entero_Mu: hypothetical protein Mup12; ECs4955; phage(gi9633502) | 2e-45 | Click |
| 13 | 5048997..5049287 | hypothetical protein; ECs4956 | N/A | Click |
| 14 | 5049284..5049469 | hypothetical protein; ECs5580 | N/A | Click |
| 15 | 5049466..5049840 | hypothetical protein; ECs4957 | N/A | Click |
| 16 | 5049833..5050030 | PHAGE_Pseudo_JG024: hypothetical protein; ECs4958; phage(gi418486984) | 3e-05 | Click |
| 17 | 5050020..5050316 | hypothetical protein; ECs4959 | N/A | Click |
| 18 | 5050313..5050822 | PHAGE_Entero_Mu: hypothetical protein Mup16; ECs4960; phage(gi9633506) | 4e-29 | Click |
| 19 | 5050892..5051317 | PHAGE_Entero_Mu: putative transcription regulator; ECs4961; phage(gi9633511) | 2e-22 | Click |
| 20 | 5051389..5051889 | PHAGE_Xantho_CP1: hypothetical protein; ECs4962; phage(gi431811023) | 5e-28 | Click |
| 21 | 5052108..5052554 | PHAGE_Entero_SfV: putative Rz1 lytic protein; ECs4964; phage(gi19549039) | 9e-14 | Click |
| 22 | 5052564..5052791 | PHAGE_Vibrio_VP882: conjugative transfer protein; ECs4965; phage(gi126010902) | 2e-05 | Click |
| 23 | 5052772..5053080 | PHAGE_Entero_Mu: hypothetical protein Mup25; ECs4966; phage(gi9633516) | 1e-09 | Click |
| 24 | 5053077..5053367 | PHAGE_Entero_Mu: hypothetical protein Mup26; ECs4967; phage(gi9633517) | 3e-26 | Click |
| 25 | 5053370..5053951 | PHAGE_Entero_Mu: hypothetical protein Mup27; ECs4968; phage(gi9633518) | 6e-55 | Click |
| 26 | 5053951..5055615 | PHAGE_Entero_Mu: putative portal protein; ECs4969; phage(gi9633519) | 0.0 | Click |
| 27 | 5055678..5057204 | PHAGE_Entero_Mu: hypothetical protein Mup29; ECs4970; phage(gi9633520) | 5e-162 | Click |
| 28 | 5057188..5058513 | PHAGE_Entero_Mu: virion morphogenesis late F orf; ECs4971; phage(gi9633521) | 1e-156 | Click |
| 29 | 5058632..5059105 | PHAGE_Entero_Mu: putative virion morphogenesis protein; ECs4972; phage(gi9633522) | 4e-40 | Click |
| 30 | 5059282..5060406 | PHAGE_Entero_Mu: putative protease protein; ECs4973; phage(gi9633523) | 4e-81 | Click |
| 31 | 5060406..5061353 | PHAGE_Entero_Mu: major head subunit; ECs4974; phage(gi9633525) | 5e-123 | Click |
| 32 | 5061397..5061783 | PHAGE_Entero_Mu: hypothetical protein Mup35; ECs4975; phage(gi9633526) | 4e-06 | Click |
| 33 | 5061780..5062199 | PHAGE_Entero_Mu: hypothetical protein Mup36; ECs4976; phage(gi9633527) | 2e-28 | Click |
| 34 | 5062196..5062756 | PHAGE_Entero_Mu: hypothetical protein Mup37; ECs4977; phage(gi9633528) | 4e-34 | Click |
| 35 | 5062757..5063002 | PHAGE_Entero_Mu: hypothetical protein Mup38; ECs4978; phage(gi9633529) | 3e-09 | Click |
| 36 | 5062999..5064501 | PHAGE_Entero_Mu: major tail subunit; ECs4979; phage(gi9633530) | 7e-139 | Click |
| 37 | 5064510..5064875 | PHAGE_Entero_Mu: hypothetical protein Mup40; ECs4980; phage(gi9633531) | 4e-27 | Click |
| 38 | 5064890..5065366 | PHAGE_Entero_Mu: hypothetical protein Mup41; ECs4981; phage(gi9633532) | 3e-24 | Click |
| 39 | 5065493..5067568 | PHAGE_Entero_Mu: putative tape measure protein; ECs4982; phage(gi9633533) | 7e-103 | Click |
| 40 | 5067534..5068904 | PHAGE_Entero_Mu: putative DNA circulation protein; ECs4983; phage(gi9633534) | 2e-71 | Click |
| 41 | 5068888..5070012 | PHAGE_Entero_Mu: putative tail protein; ECs4984; phage(gi9633535) | 2e-92 | Click |
| 42 | 5070002..5070616 | PHAGE_Entero_Mu: putative baseplate assembly protein; ECs4985; phage(gi9633536) | 2e-53 | Click |
| 43 | 5070609..5071046 | PHAGE_Entero_Mu: hypothetical protein Mup46; ECs4986; phage(gi9633537) | 1e-40 | Click |
| 44 | 5071043..5072128 | PHAGE_Entero_Mu: hypothetical protein Mup47; ECs4987; phage(gi9633538) | 2e-100 | Click |
| 45 | 5072119..5072679 | PHAGE_Entero_Mu: hypothetical protein Mup48; ECs4988; phage(gi9633539) | 1e-44 | Click |
| 46 | 5072679..5073590 | PHAGE_Entero_Mu: tail fiber; ECs4989; phage(gi9633540) | 2e-39 | Click |
| 47 | complement(5073625..5074146) | PHAGE_Entero_Mu: tail fiber assembly protein; ECs4990; phage(gi19584573) | 6e-18 | Click |
| 48 | complement(5074226..5074429) | PHAGE_Entero_Mu: tail fiber; ECs4991; phage(gi9633540) | 8e-06 | Click |
| 49 | 5074651..5075211 | PHAGE_Entero_Mu: Gin; ECs4992; phage(gi9633542) | 8e-78 | Click |
| 50 | 5075311..5077350 | PHAGE_Entero_4795: hypothetical protein YjhS; ECs4993; phage(gi157166028) | 0.0 | Click |
| 51 | 5077497..5077679 | PHAGE_Escher_P13374: hypothetical protein; ECs4994; phage(gi410491643) | 2e-12 | Click |
| 52 | 5077715..5077960 | PHAGE_Escher_TL_2011c: hypothetical protein; ECs4995; phage(gi418487098) | 3e-07 | Click |
| 53 | complement(5077999..5078310) | hypothetical protein; ECs4996 | N/A | Click |
| 54 | 5078578..5078778 | PHAGE_Entero_Mu: Com; ECs4997; phage(gi9633543) | 4e-08 | Click |
| 55 | complement(5078681..5078917) | hypothetical protein; ECs5581 | N/A | Click |
| 56 | 5078732..5079469 | PHAGE_Entero_Mu: Mom; ECs4998; phage(gi9633544) | 9e-106 | Click |
| 57 | complement(5079801..5080598) | sorbose-permease PTS system IIC component; ECs5000 | N/A | Click |
| 58 | complement(5080664..5081158) | sorbose-permease PTS system IIB component; ECs5001 | N/A | Click |
| 59 | complement(5081158..5081565) | sorbose-permease PTS system IIA component; ECs5002 | N/A | Click |
| 60 | complement(5081575..5082381) | PHAGE_Tricho_2c: hypothetical protein TNAV2c_gp071; ECs5003; phage(gi116326757) | 6e-12 | Click |