| Definition | Escherichia coli str. K-12 substr. MG1655 chromosome, complete genome. |
|---|---|
| Accession | NC_000913 |
| Length | 4,639,675 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 13 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 8238..9191 | PHAGE_Prochl_MED4_213_NC_020845: TalC; b0008; phage(gi472340344) | 3e-12 | Click |
| 2 | 9306..9893 | molybdochelatase incorporating molybdenum into molybdopterin; b0009 | N/A | Click |
| 3 | complement(9928..10494) | inner membrane protein, Grp1_Fun34_YaaH family; b0010 | N/A | Click |
| 4 | complement(10643..11356) | conserved protein, UPF0174 family; b0011 | N/A | Click |
| 5 | complement(11382..11786) | conserved protein, UPF0412 family; b0013 | N/A | Click |
| 6 | 12163..14079 | PHAGE_Bathyc_BpV1_NC_014765: hypothetical protein; b0014; phage(gi313768007) | 2e-154 | Click |
| 7 | 14168..15298 | PHAGE_Cafete_BV_PW1_NC_014637: putative DnaJ/Hsp40; b0015; phage(gi310831116) | 5e-46 | Click |
| 8 | 15445..16557 | PROPHAGE_Escher_MG1655: IS186 transposase; b0016; phage(gi90111427) | 0.0 | Click |
| 9 | complement(16751..16960) | PHAGE_Stx2_converting_II_NC_004914: putative host killer protein; b0018; phage(gi302393105) | 4e-22 | Click |
| 10 | complement(16751..16903) | PHAGE_Stx2_converting_II_NC_004914: putative host killer protein; b4412; phage(gi302393105) | 1e-16 | Click |
| 11 | 17489..18655 | sodium-proton antiporter; b0019 | N/A | Click |
| 12 | 18715..19620 | DNA-binding transcriptional activator; b0020 | N/A | Click |
| 13 | complement(19811..20314) | PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; b0021; phage(gi557307573) | 1e-96 | Click |
Region 2, total : 42 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 262122..262181 | attL CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA | N/A | Click |
| 2 | complement(262552..262893) | CP4-6 prophage; toxin of the YkfI-YafW toxin-antitoxin system; b0245 | N/A | Click |
| 3 | complement(262914..263231) | CP4-6 prophage; antitoxin of the YkfI-YafW toxin-antitoxin system; b0246 | N/A | Click |
| 4 | complement(263250..263471) | hypothetical protein; b4504 | N/A | Click |
| 5 | complement(263480..263956) | CP4-6 prophage; predicted DNA repair protein; b0247 | N/A | Click |
| 6 | complement(263972..264430) | PHAGE_Pseudo_YuA_NC_010116: hypothetical protein; putative; phage protein; b0248(gi162135127) | 1e-16 | Click |
| 7 | complement(264528..264767) | CP4-6 prophage; putative protein; b0249 | N/A | Click |
| 8 | complement(264844..265311) | CP4-6 prophage; putative protein; b0250 | N/A | Click |
| 9 | complement(265334..265777) | lipoprotein, inner membrane; overproduction stimulates degP expression; CP4-6 prophage; b0251 | N/A | Click |
| 10 | complement(265777..265998) | N/A; b4627 | 0 | Click |
| 11 | complement(266000..266191) | N/A; b4628 | 0 | Click |
| 12 | complement(266408..267229) | PHAGE_Cronob_vB_CsaM_GAP32_NC_019401: hypothetical protein; conserved; phage protein; b0252(gi414086954) | 3e-45 | Click |
| 13 | complement(267321..268184) | CP4-6 prophage; predicted GTP-binding protein; b0253 | N/A | Click |
| 14 | complement(268513..269406) | PHAGE_Burkho_phi1026b_NC_005284: gp58; predicted; phage DNA-binding transcriptional regulator; b0254(gi38707948) | 1e-23 | Click |
| 15 | 269502..271413 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; b4587; phage(gi24373865) | 2e-07 | Click |
| 16 | 269827..270978 | PROPHAGE_Escher_MG1655: IS30 transposase; b0256; phage(gi16132105) | 0.0 | Click |
| 17 | 272071..273178 | PHAGE_Vibrio_VHML_NC_004456: ORF37; b0258; phage(gi27311204) | 1e-10 | Click |
| 18 | complement(273325..274341) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; b0259; phage(gi16131377) | 0.0 | Click |
| 19 | 274549..275952 | CP4-6 prophage; predicted S-methylmethionine transporter; b0260 | N/A | Click |
| 20 | 275939..276871 | CP4-6 prophage; S-methylmethionine:homocysteine methyltransferase; b0261 | N/A | Click |
| 21 | complement(276980..278026) | PHAGE_Bacill_G_NC_023719: gp245; predicted; phage ferric transporter subunit; b0262(gi593777701) | 8e-35 | Click |
| 22 | complement(278038..278385) | N/A; b0263 | 0 | Click |
| 23 | complement(278402..278905) | PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; b0264; phage(gi557307573) | 5e-93 | Click |
| 24 | complement(278824..279099) | PHAGE_Entero_P1_NC_005856: InsA; b0265; phage(gi46401643) | 2e-49 | Click |
| 25 | 279155..279328 | PROPHAGE_Escher_CFT073: transposase insI; b4708; phage(gi26250328) | 2e-27 | Click |
| 26 | complement(279338..279586) | PROPHAGE_Xantho_33913: ISxac3 transposase; b4505; phage(gi21231087) | 4e-23 | Click |
| 27 | complement(279651..279959) | N/A; b0266 | 0 | Click |
| 28 | complement(280053..281207) | PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; predicted; phage DNA-binding transcriptional regulator; b0267(gi17546158) | 2e-17 | Click |
| 29 | 281502..282410 | 2-keto-3-deoxy gluconate (KDG) aldolase; CP4-6 prophage; b0268 | N/A | Click |
| 30 | 282425..284392 | CP4-6 prophage; predicted dehydratase; b0269 | N/A | Click |
| 31 | 284619..286001 | CP4-6 prophage; predicted sugar transporter; b0270 | N/A | Click |
| 32 | 286013..287623 | CP4-6 prophage; predicted xylosidase/arabinosidase; b0271 | N/A | Click |
| 33 | complement(287628..288386) | CP4-6 prophage; predicted DNA-binding transcriptional regulator; b0272 | N/A | Click |
| 34 | complement(288525..289529) | PHAGE_Parame_bursaria_Chlorella_virus_1_NC_000852: Aspartate transcarbamylase; CP4-6; phage prophage; b0273(gi9631738) | 8e-13 | Click |
| 35 | 289653..289857 | N/A; b4688 | 0 | Click |
| 36 | complement(289873..290376) | PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; b0274; phage(gi557307573) | 5e-93 | Click |
| 37 | complement(290295..290570) | PHAGE_Entero_P1_NC_005856: InsA; b0275; phage(gi46401643) | 2e-49 | Click |
| 38 | 290628..291455 | N/A; b0276 | 0 | Click |
| 39 | complement(291546..292172) | CP4-6 prophage; conserved protein; b0277 | N/A | Click |
| 40 | complement(292444..293142) | CP4-6 prophage; DNA-binding protein; b0278 | N/A | Click |
| 41 | complement(293169..294023) | CP4-6 prophage; putative protein; b0279 | N/A | Click |
| 42 | complement(294363..294803) | CP4-6 prophage; putative protein; b0280 | N/A | Click |
| 43 | complement(294920..296320) | PHAGE_Lactoc_bIL311_NC_002670: integrase; predicted; phage phage integrase; b0281(gi13095659) | 9e-08 | Click |
| 44 | 296430..296489 | attR CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA | N/A | Click |
Region 3, total : 35 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 563978..564024 | attL CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT | N/A | Click |
| 2 | complement(564038..565201) | PHAGE_Salmon_epsilon34_NC_011976: Tyrosine integrase; predicted; phage integrase; b0537(gi221328640) | 0.0 | Click |
| 3 | complement(565081..565302) | PHAGE_Shigel_SfII_NC_021857: excisionase; b4633; phage(gi526244665) | 9e-24 | Click |
| 4 | complement(565321..565599) | PHAGE_Entero_YYZ_2008_NC_011356: putative exonuclease; b0539; phage(gi209427739) | 2e-49 | Click |
| 5 | 565599..565910 | PHAGE_Entero_lambda_NC_001416: DNA replication protein; b4508; phage(gi9626296) | 7e-53 | Click |
| 6 | 565907..567470 | PHAGE_Entero_lambda_NC_001416: ren exclusion protein; b0542; phage(gi9626297) | 9e-09 | Click |
| 7 | 566065..566364 | PROPHAGE_Escher_MG1655: IS3 transposase A; b0540; phage(gi226524700) | 5e-49 | Click |
| 8 | 566361..567227 | PROPHAGE_Escher_MG1655: IS3 transposase B; b0541; phage(gi16128284) | 4e-173 | Click |
| 9 | 567538..567870 | PHAGE_Acinet_Acj61_NC_014661: putative quaternary ammonium compound-resistance protein qacE; multidrug; phage resistance protein; b0543(gi311992758) | 2e-10 | Click |
| 10 | 567928..567939 | attL TTTTATGCTTTT | N/A | Click |
| 11 | 568125..569651 | PHAGE_Bacill_WBeta_NC_007734: putative site-specific recombinase; predicted; phage recombinase; b0544(gi85701406) | 7e-09 | Click |
| 12 | 570116..570667 | DLP12 prophage; secreted protein, UPF0098 family; b0545 | N/A | Click |
| 13 | 570677..571474 | DLP12 prophage; predicted DNA-binding transcriptional regulator; b0546 | N/A | Click |
| 14 | 571591..571692 | hypothetical protein, DLP12 prophage; b4588 | N/A | Click |
| 15 | 571689..572144 | PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; putative; phage protein; b0547(gi401817579) | 7e-61 | Click |
| 16 | 572144..572314 | PHAGE_Entero_HK225_NC_019717: NinE protein; conserved; phage protein; b0548(gi428782437) | 8e-15 | Click |
| 17 | 572307..572597 | PHAGE_Entero_mEp237_NC_019704: hypothetical protein; putative; phage protein; b0549(gi435439317) | 1e-48 | Click |
| 18 | 572594..572956 | PHAGE_Entero_mEp237_NC_019704: Holliday junction resolvase RusA; endonuclease; phage RUS; b0550(gi435439318) | 7e-62 | Click |
| 19 | 572953..573093 | PHAGE_Entero_mEp237_NC_019704: hypothetical protein; b4509; phage(gi435439319) | 2e-10 | Click |
| 20 | 573179..573562 | PHAGE_Entero_YYZ_2008_NC_011356: antitermination protein Q; predicted; phage antitermination protein; b0551(gi209427762) | 7e-56 | Click |
| 21 | complement(573752..576048) | N/A; b0553 | 0 | Click |
| 22 | complement(573960..574976) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; b0552; phage(gi16131377) | 0.0 | Click |
| 23 | 576621..576836 | PHAGE_Stx2_converting_II_NC_004914: holin; predicted; phage phage lysis protein; b0554(gi302393164) | 2e-28 | Click |
| 24 | 576836..577333 | PHAGE_Entero_cdtI_NC_009514: lysin; predicted; phage lysozyme; b0555(gi148609440) | 4e-92 | Click |
| 25 | 577330..577791 | PHAGE_Entero_lambda_NC_001416: cell lysis protein; predicted; phage murein endopeptidase; b0556(gi9626310) | 2e-79 | Click |
| 26 | 577550..577732 | PHAGE_Entero_lambda_NC_001416: Rz1 protein; predicted; phage lipoprotein; b4510(gi160338810) | 1e-29 | Click |
| 27 | complement(577823..578116) | PHAGE_Escher_TL_2011c_NC_019442: Bor protein precursor; predicted; phage lipoprotein; b0557(gi418487071) | 3e-49 | Click |
| 28 | complement(578407..578817) | PHAGE_Entero_lambda_NC_001416: putative envelope protein; putative; phage protein; b0558(gi19263396) | 9e-75 | Click |
| 29 | 579103..579309 | PHAGE_Entero_lambda_NC_001416: hypothetical protein lambdap79; putative; phage protein; b0559(gi19263397) | 2e-32 | Click |
| 30 | complement(579474..579668) | PHAGE_Entero_YYZ_2008_NC_011356: hypothetical protein YYZ_gp48; b4589; phage(gi209427772) | 2e-19 | Click |
| 31 | 580057..580602 | PHAGE_Entero_lambda_NC_001416: DNA packaging protein; DNA; phage packaging protein; b0560(gi9626244) | 2e-96 | Click |
| 32 | 580577..580885 | PHAGE_Entero_lambda_NC_001416: DNA packaging protein; b4634; phage(gi9626245) | 1e-54 | Click |
| 33 | 580883..581320 | PHAGE_Entero_lambda_NC_001416: Putative fiber assembly protein; b0561; phage(gi9626269) | 1e-74 | Click |
| 34 | complement(581375..582029) | N/A; b0562 | 0 | Click |
| 35 | 582176..582358 | PHAGE_Entero_lambda_NC_001416: Putative fiber assembly protein; b0563; phage(gi9626269) | 5e-16 | Click |
| 36 | 582904..583653 | DNA-binding global transcriptional activator; DLP12 prophage; b0564 | N/A | Click |
| 37 | complement(583903..584856) | DLP12 prophage; outer membrane protease VII (outer membrane protein 3b); b0565 | N/A | Click |
| 38 | 585042..585053 | attR TTTTATGCTTTT | N/A | Click |
| 39 | 585280..585326 | attR CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT | N/A | Click |
Region 4, total : 26 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1196090..1196755) | e14 prophage; predicted SAM-dependent methyltransferase; b1137 | N/A | Click |
| 2 | complement(1196756..1197460) | e14 prophage; predicted inner membrane protein; b1138 | N/A | Click |
| 3 | 1197863..1197876 | attL ATTCATCTTATTTT | N/A | Click |
| 4 | 1197918..1198811 | e14 prophage; cell death peptidase, inhibitor of T4 late gene expression; b1139 | N/A | Click |
| 5 | complement(1198902..1200029) | PHAGE_Entero_mEp235_NC_019708: integrase; predicted; phage integrase; b1140(gi428781836) | 1e-58 | Click |
| 6 | complement(1200010..1200255) | e14 prophage; predicted excisionase; b1141 | N/A | Click |
| 7 | 1200720..1201061 | e14 prophage; putative protein; b1143 | N/A | Click |
| 8 | complement(1200999..1201307) | PHAGE_Cronob_phiES15_NC_018454: hypothetical protein; putative; phage protein; b1144(gi401817573) | 2e-11 | Click |
| 9 | complement(1201482..1202156) | PHAGE_Shigel_SfIV_NC_022749: repressor / cI; repressor; phage protein phage e14; b1145(gi557307563) | 5e-132 | Click |
| 10 | 1202247..1202447 | PHAGE_Shigel_SfIV_NC_022749: Cro; predicted; phage DNA-binding transcriptional regulator; b1146(gi557307564) | 9e-32 | Click |
| 11 | 1202491..1203048 | PHAGE_Shigel_SfIV_NC_022749: DNA binding transcriptional regulator; predicted; phage DNA-binding transcriptional regulator; b1147(gi557307565) | 2e-97 | Click |
| 12 | 1203045..1203383 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b1148(gi557307566) | 5e-58 | Click |
| 13 | 1203393..1203626 | PHAGE_Shigel_SfIV_NC_022749: replication protein; b4692; phage(gi557307567) | 2e-39 | Click |
| 14 | 1203627..1204760 | PHAGE_Shigel_SfIV_NC_022749: large terminase subunit; b4693; phage(gi557307528) | 0.0 | Click |
| 15 | 1204772..1204954 | PHAGE_Shigel_SfII_NC_021857: putative integral membrane protein; putative; phage protein; b1150(gi526244693) | 3e-29 | Click |
| 16 | 1204954..1205365 | PHAGE_Shigel_SfIV_NC_022749: portal protein; b1151; phage(gi557307529) | 7e-75 | Click |
| 17 | 1205366..1206145 | PHAGE_Shigel_SfIV_NC_022749: baseplate protein; b1152; phage(gi557307544) | 2e-143 | Click |
| 18 | 1206136..1206720 | PHAGE_Shigel_SfIV_NC_022749: tail protein; b1153; phage(gi557307545) | 2e-111 | Click |
| 19 | 1206724..1207353 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b1154(gi557307546) | 7e-55 | Click |
| 20 | 1207355..1207768 | PHAGE_Shigel_SfIV_NC_022749: tail fiber assembly protein; putative; phage protein; b1155(gi557307547) | 4e-11 | Click |
| 21 | complement(1207740..1208342) | PHAGE_Shigel_SfIV_NC_022749: tail fiber assembly protein; predicted; phage tail fiber assembly protein; b1156(gi557307548) | 1e-87 | Click |
| 22 | complement(1208342..1208842) | PHAGE_Entero_HK106_NC_019768: side tail fiber protein; b1157; phage(gi428783303) | 4e-48 | Click |
| 23 | 1208908..1209462 | PHAGE_Entero_Fels_2_NC_010463: DNA-invertase; site-specific; phage DNA recombinase; b1158(gi169936026) | 1e-88 | Click |
| 24 | 1209569..1210402 | PHAGE_Mycoba_Lamina13_NC_024143: HNH endonuclease; 5-methylcytosine-specific; phage restriction endonuclease B; b1159(gi640884809) | 7e-06 | Click |
| 25 | 1210636..1210800 | N/A; b4519 | 0 | Click |
| 26 | complement(1210903..1211226) | PHAGE_Stx2_converting_1717_NC_011357: hypothetical protein Stx2-1717_gp43; b1160; phage(gi209447168) | 5e-42 | Click |
| 27 | complement(1211926..1212330) | PHAGE_Entero_HK629_NC_019711: putative envelope protein; b1161; phage(gi428782079) | 3e-29 | Click |
| 28 | 1215894..1215907 | attR ATTCATCTTATTTT | N/A | Click |
Region 5, total : 33 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1393976..1393988 | attL CGTCATGCCGGAA | N/A | Click |
| 2 | complement(1404587..1405819) | PHAGE_Bacill_G_NC_023719: gp350; b1341; phage(gi593777806) | 5e-18 | Click |
| 3 | 1406074..1407057 | putative Zn(II) transporter; b1342 | N/A | Click |
| 4 | 1407535..1408908 | PHAGE_Cafete_BV_PW1_NC_014637: putative superfamily II helicase/eIF-4AIII; b1343; phage(gi310831360) | 2e-46 | Click |
| 5 | complement(1409037..1409972) | PHAGE_Parame_bursaria_Chlorella_virus_FR483_NC_008603: hypothetical protein FR483_N404R; b1344; phage(gi155370502) | 4e-08 | Click |
| 6 | complement(1410024..1411259) | PHAGE_Gifsy_2_NC_010393: bacteriophage integrase; integrase;; phage b1345(gi169257268) | 3e-90 | Click |
| 7 | complement(1411261..1411476) | Rac prophage; conserved protein; b1346 | N/A | Click |
| 8 | complement(1411555..1411764) | double-strand break reduction protein, Rac prophage; b1347 | N/A | Click |
| 9 | complement(1411757..1411951) | Rac prophage; restriction alleviation protein; b1348 | N/A | Click |
| 10 | complement(1412008..1412817) | PHAGE_Entero_epsilon15_NC_004775: RecT; recombination; phage and repair protein; b1349(gi30387413) | 1e-81 | Click |
| 11 | complement(1415512..1415787) | Rac prophage; putative protein; b1351 | N/A | Click |
| 12 | complement(1415862..1416032) | PHAGE_Gifsy_2_NC_010393: hypothetical protein STM1010.1n.Gifsy2; conserved; phage protein; b4526(gi169257274) | 7e-06 | Click |
| 13 | complement(1416032..1416253) | PHAGE_Escher_P13374_NC_018846: host killing protein; inhibitor; phage of ftsZ, killing protein; b1352(gi410491620) | 1e-05 | Click |
| 14 | 1416695..1417183 | PHAGE_Entero_lambda_NC_001416: Superinfection exclusion protein B; phage; phage superinfection exclusion protein; b1353(gi19263394) | 1e-07 | Click |
| 15 | complement(1417180..1417335) | PHAGE_Salico_CGphi29_NC_020844: hypothetical protein; putative; phage protein; b4527(gi472340166) | 1e-09 | Click |
| 16 | complement(1417346..1417480) | Rac prophage; putative protein; b1355 | N/A | Click |
| 17 | complement(1417789..1418265) | Rac prophage; predicted DNA-binding transcriptional regulator; b1356 | N/A | Click |
| 18 | 1418389..1418685 | PHAGE_Aggreg_S1249_NC_013597: phage protein; predicted; phage DNA-binding transcriptional regulator; b1357(gi273809591) | 3e-14 | Click |
| 19 | 1418708..1419130 | PHAGE_Entero_mEp237_NC_019704: CII protein; putative; phage protein; b1358(gi435439306) | 4e-08 | Click |
| 20 | 1419143..1420000 | PHAGE_Gifsy_2_NC_010393: bacteriophage DNA replication protein; Lambda gpo homolog; conserved; phage protein; b1359(gi169257279) | 1e-22 | Click |
| 21 | 1420007..1420753 | PHAGE_Gifsy_2_NC_010393: bacteriophage DNA replication protein; predicted; phage DNA replication protein; b1360(gi169257280) | 3e-76 | Click |
| 22 | 1420725..1421224 | N/A; b1361 | 0 | Click |
| 23 | 1421225..1421668 | PHAGE_Entero_HK630_NC_019723: cell lysis protein Rz; b1362; phage(gi428782852) | 4e-72 | Click |
| 24 | 1421424..1421609 | PHAGE_Entero_HK630_NC_019723: Rz1 protein; predicted; phage lipoprotein; b4528(gi428782853) | 1e-28 | Click |
| 25 | 1421806..1423263 | Rac prophage; potassium transporter subunit; b1363 | N/A | Click |
| 26 | 1423401..1423664 | PHAGE_Vibrio_X29_NC_024369: DNA modification methylase; conserved; phage protein; b1365(gi658311236) | 3e-21 | Click |
| 27 | 1423654..1424106 | PHAGE_Pseudo_phiPSA1_NC_024365: hypothetical protein; b1366; phage(gi658307708) | 6e-10 | Click |
| 28 | 1424478..1425410 | PHAGE_Escher_HK639_NC_016158: tail length tape measure protein; b1368; phage(gi356870615) | 7e-27 | Click |
| 29 | 1425413..1427008 | PHAGE_Entero_cdtI_NC_009514: putative Lom-like outer membrane protein; b4570; phage(gi148609401) | 9e-36 | Click |
| 30 | complement(1425770..1426750) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; b1370; phage(gi16131377) | 0.0 | Click |
| 31 | 1427073..1430435 | PHAGE_Entero_9g_NC_024146: side tail fiber; predicted; phage tail fiber protein; b1372(gi640885143) | 0.0 | Click |
| 32 | 1430435..1431010 | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; predicted; phage tail fiber assembly protein; b1373(gi16129505) | 1e-108 | Click |
| 33 | complement(1431108..1431698) | PHAGE_Escher_D108_NC_013594: G region invertase; predicted; phage site-specific recombinase; b1374(gi281199698) | 9e-25 | Click |
| 34 | complement(1432015..1432248) | cold shock protein, function unknown, Rac prophage; b1375 | N/A | Click |
| 35 | 1433075..1433087 | attR CGTCATGCCGGAA | N/A | Click |
Region 6, total : 41 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1617581..1617592 | attL AAAAAAGAGGTA | N/A | Click |
| 2 | 1627239..1627442 | PHAGE_Salmon_SSU5_JQ965645: putative selenium-binding protein YdfZ; b1541; phage(gi390013937) | 1e-13 | Click |
| 3 | complement(1627477..1628937) | PHAGE_Microm_MpV1_NC_014767: hypothetical protein; b1542; phage(gi313768442) | 2e-40 | Click |
| 4 | complement(1629026..1650862) | PHAGE_Entero_mEp460_NC_019716: late gene regulator; b4600; phage(gi428782366) | 2e-135 | Click |
| 5 | 1631096..1631329 | cold shock protein, function unknown, Qin prophage; b1544 | N/A | Click |
| 6 | 1631646..1632236 | PHAGE_Escher_D108_NC_013594: G region invertase; predicted; phage site-specific recombinase; b1545(gi281199698) | 7e-25 | Click |
| 7 | complement(1632334..1632909) | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; predicted; phage tail fiber assembly protein; b1546(gi16129505) | 3e-109 | Click |
| 8 | complement(1632909..1633871) | PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; predicted; phage side tail fiber assembly protein; b1547(gi16129506) | 0.0 | Click |
| 9 | complement(1633864..1634391) | PHAGE_Entero_HK630_NC_019723: terminase small subunit nu1; b1548; phage(gi428782788) | 3e-94 | Click |
| 10 | 1634780..1635013 | PHAGE_Entero_YYZ_2008_NC_011356: hypothetical protein YYZ_gp48; b4533; phage(gi209427772) | 1e-20 | Click |
| 11 | 1635071..1635481 | PHAGE_Entero_HK629_NC_019711: putative envelope protein; putative; phage protein; b1549(gi428782079) | 3e-60 | Click |
| 12 | complement(1635633..1635806) | Qin prophage; multicopy suppressor of secG(Cs) and fabA6(Ts); b1550 | N/A | Click |
| 13 | complement(1635978..1636133) | Qin prophage; cold shock-induced protein; b1551 | N/A | Click |
| 14 | complement(1636479..1636691) | PHAGE_Lactoc_bIL312_NC_002671: Csp; cold; phage shock protein; b1552(gi13095918) | 2e-15 | Click |
| 15 | complement(1637054..1637551) | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; b1553; phage(gi16765210) | 2e-53 | Click |
| 16 | complement(1637104..1637358) | putative Rz1-like lipoprotein, Qin prophage; b4689 | N/A | Click |
| 17 | complement(1637548..1638081) | PHAGE_Entero_mEp460_NC_019716: endolysin; predicted; phage lysozyme; b1554(gi428782372) | 3e-97 | Click |
| 18 | complement(1638078..1638389) | PHAGE_Entero_mEp460_NC_019716: hypothetical protein; putative; phage protein; b1555(gi428782371) | 1e-29 | Click |
| 19 | complement(1638394..1638609) | PHAGE_Entero_mEp460_NC_019716: porin; predicted; phage S lysis protein; b1556(gi428782370) | 4e-33 | Click |
| 20 | complement(1639363..1639578) | PHAGE_Lactoc_bIL312_NC_002671: Csp; cold; phage shock protein; b1557(gi13095918) | 7e-16 | Click |
| 21 | 1639879..1640091 | Qin prophage; cold shock protein; b1558 | N/A | Click |
| 22 | complement(1640513..1641265) | PHAGE_Entero_mEp460_NC_019716: late gene regulator; predicted; phage antitermination protein Q; b1559(gi428782366) | 6e-137 | Click |
| 23 | complement(1641279..1642328) | PHAGE_Entero_mEp460_NC_019716: hypothetical protein; putative; phage protein; b1560(gi428782365) | 6e-114 | Click |
| 24 | complement(1642675..1642926) | Qin prophage; putative protein; b1561 | N/A | Click |
| 25 | complement(1643143..1643298) | PHAGE_Stx2_converting_II_NC_004914: putative host killer protein; small; phage toxic polypeptide; b1562(gi302393105) | 4e-19 | Click |
| 26 | complement(1643370..1643657) | Qin prophage; toxin of the RelE-RelB toxin-antitoxin system; b1563 | N/A | Click |
| 27 | complement(1643657..1643896) | Qin prophage; bifunctional antitoxin of the RelE-RelB toxin-antitoxin system/ transcriptional repressor; b1564 | N/A | Click |
| 28 | 1643921..1644226 | Qin prophage; putative protein; b1565 | N/A | Click |
| 29 | 1644429..1644761 | Qin prophage; putative protein; b1566 | N/A | Click |
| 30 | complement(1645198..1645380) | N/A; b1567 | 0 | Click |
| 31 | complement(1645382..1645660) | N/A; b1568 | 0 | Click |
| 32 | complement(1645644..1645874) | PHAGE_Pectob_ZF40_NC_019522: putative cro anti-repressor; DNA-binding; phage transcriptional regulator for DicB; b1569(gi422936651) | 2e-08 | Click |
| 33 | 1645958..1646365 | PHAGE_Cronob_phiES15_NC_018454: putative transcriptional repressor DicA; predicted; phage regulator for DicB; b1570(gi401817574) | 6e-33 | Click |
| 34 | 1646532..1646687 | PHAGE_Salico_CGphi29_NC_020844: hypothetical protein; putative; phage protein; b1571(gi472340166) | 3e-09 | Click |
| 35 | 1646689..1646817 | Qin prophage; putative protein; b1572 | N/A | Click |
| 36 | 1646847..1647065 | conserved protein, Qin prophage; b1573 | N/A | Click |
| 37 | 1647633..1647821 | Qin prophage; cell division inhibition protein; b1575 | N/A | Click |
| 38 | 1647818..1648009 | Qin prophage; putative protein; b1576 | N/A | Click |
| 39 | 1648102..1648866 | N/A; b1577 | 0 | Click |
| 40 | 1648869..1649561 | PROPHAGE_Escher_MG1655: IS2 transposase TnpB; b1578; phage(gi16130763) | 9e-136 | Click |
| 41 | 1649575..1650732 | PHAGE_Entero_YYZ_2008_NC_011356: putative integrase; b1579; phage(gi209427727) | 1e-134 | Click |
| 42 | 1650876..1650887 | attR AAAAAAGAGGTA | N/A | Click |
| 43 | complement(1650920..1651939) | PHAGE_Synech_S_SM2_NC_015279: zinc-containing alcohol dehydrogenase superfamily protein; b1580; phage(gi326781942) | 3e-18 | Click |
Region 7, total : 16 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2066976..2067881) | PROPHAGE_Escher_MG1655: IS2 transposase TnpB; b1996; phage(gi16130763) | 8e-179 | Click |
| 2 | complement(2067839..2068204) | PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; b1997; phage(gi17546153) | 2e-45 | Click |
| 3 | 2068684..2069235 | N/A; b1999 | 0 | Click |
| 4 | 2069563..2072682 | PHAGE_Cronob_vB_CsaM_GAP32_NC_019401: long tail fiber proximal subunit; antigen; phage 43 (Ag43) phase-variable biofilm formation autotransporter; b2000(gi414087138) | 3e-18 | Click |
| 5 | 2072803..2074335 | CP4-44 prophage; predicted membrane protein; b2001 | N/A | Click |
| 6 | 2074332..2074778 | CP4-44 prophage; predicted DNA repair protein; b2002 | N/A | Click |
| 7 | 2074841..2075062 | CP4-44 prophage; putative protein; b2003 | N/A | Click |
| 8 | 2075136..2075504 | CP4-44 prophage; cytoskeleton bundling-enhancing factor A; CbtA antitoxin; b2004 | N/A | Click |
| 9 | 2075593..2075967 | CP4-44 prophage; toxin of the YeeV-YeeU toxin-antitoxin system; b2005 | N/A | Click |
| 10 | 2075964..2076131 | N/A; b2006 | 0 | Click |
| 11 | complement(2076573..2076701) | PHAGE_Stx2_converting_1717_NC_011357: transposase; b4642; phage(gi209447153) | 2e-11 | Click |
| 12 | 2076770..2076955 | N/A; b4538 | 0 | Click |
| 13 | complement(2077056..2077385) | conserved protein, UPF0265 family; b2007 | N/A | Click |
| 14 | complement(2077557..2078615) | inner membrane protein, FUSC family; b2008 | N/A | Click |
| 15 | complement(2078813..2079286) | DNA gyrase inhibitor; b2009 | N/A | Click |
| 16 | complement(2079405..2080571) | PHAGE_Stx2_converting_1717_NC_011357: penicillin-binding protein 6b; b2010; phage(gi209447203) | 0.0 | Click |
Region 8, total : 18 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2464376..2464391 | attL TTGCAGGTTCGATTCC | N/A | Click |
| 2 | 2464567..2465724 | PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; predicted; phage prophage CPS-53 integrase; b2349(gi16130281) | 0.0 | Click |
| 3 | 2465877..2466239 | PHAGE_Shigel_SfIV_NC_022749: putative flippase; bactoprenol-linked; phage glucose translocase (flippase); b2350(gi557307553) | 2e-58 | Click |
| 4 | 2466236..2467156 | PHAGE_Shigel_SfIV_NC_022749: bactoprenol glucosyltransferase; bactoprenol; phage glucosyl transferase; b2351(gi557307552) | 8e-160 | Click |
| 5 | 2467153..2468484 | PHAGE_Shigel_SfIV_NC_022749: serotype specific glucosyltransferase; b2352; phage(gi557307551) | 6e-86 | Click |
| 6 | 2468837..2469127 | PHAGE_Shigel_SfIV_NC_022749: tail fiber assembly protein; b2353; phage(gi557307548) | 7e-45 | Click |
| 7 | complement(2469099..2469539) | PHAGE_Shigel_SfIV_NC_022749: tail fiber assembly protein; conserved; phage protein; b2354(gi557307547) | 3e-17 | Click |
| 8 | complement(2469566..2470144) | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; b2355; phage(gi557307546) | 2e-53 | Click |
| 9 | complement(2470140..2470409) | PHAGE_Shigel_SfII_NC_021857: DNA adenine methylase; b2356; phage(gi526244677) | 3e-50 | Click |
| 10 | complement(2470409..2470903) | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b2357(gi557307568) | 2e-86 | Click |
| 11 | complement(2470900..2471607) | PHAGE_Shigel_SfIV_NC_022749: replication protein; b2358; phage(gi557307567) | 9e-137 | Click |
| 12 | 2471626..2471988 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b2359(gi557307560) | 7e-62 | Click |
| 13 | 2472054..2472878 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b2360(gi557307559) | 9e-152 | Click |
| 14 | 2473006..2473542 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; conserved; phage protein; b2361(gi557307558) | 1e-99 | Click |
| 15 | 2473533..2473895 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b2362(gi557307557) | 7e-67 | Click |
| 16 | 2473895..2474200 | PHAGE_Shigel_SfIV_NC_022749: hypothetical protein; putative; phage protein; b2363(gi557307556) | 5e-52 | Click |
| 17 | 2474203..2474253 | N/A; b4545 | 0 | Click |
| 18 | 2474297..2474312 | attR TTGCAGGTTCGATTCC | N/A | Click |
| 19 | 2474332..2474532 | PHAGE_Entero_HK633_NC_019719: hypothetical protein; b4501; phage(gi428782548) | 4e-34 | Click |
| 20 | 2474606..2474620 | tRNA | N/A | Click |
| 21 | complement(2474716..2475651) | PHAGE_Burkho_phi1026b_NC_005284: gp58; b2364; phage(gi38707948) | 2e-15 | Click |
Region 9, total : 32 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2749817..2751478 | PHAGE_Human_herpesvirus_8_NC_009333: LANA; b2616; phage(gi139472804) | 2e-05 | Click |
| 2 | 2751627..2751968 | lipoprotein component of BamABCDE OM biogenesis complex; b2617 | N/A | Click |
| 3 | complement(2752030..2752320) | conserved protein, UPF0125 family; b2618 | N/A | Click |
| 4 | complement(2752310..2752786) | toxic UPF0083 family protein inhibitor of 70S ribosome formation; b2619 | N/A | Click |
| 5 | 2752918..2753400 | PHAGE_Staphy_StauST398_5_NC_023500: SsrA-binding protein; b2620; phage(gi588498309) | 2e-31 | Click |
| 6 | 2753615..2753977 | tRNA | N/A | Click |
| 7 | 2753819..2753831 | attL GAAGCCCTGCCTG | N/A | Click |
| 8 | 2754181..2755422 | PHAGE_Entero_P4_NC_001609: integrase; integrase;; phage b2622(gi9627511) | 2e-65 | Click |
| 9 | complement(2755666..2756622) | CP4-57 prophage; putative protein; b2623 | N/A | Click |
| 10 | 2756666..2756878 | PHAGE_Stenot_S1_NC_011589: putative repressor protein; DNA-binding; phage transcriptional activator; b2624(gi213163928) | 2e-06 | Click |
| 11 | 2757007..2758416 | PHAGE_Entero_TLS_NC_009540: YfiJ; putative; phage protein; b2625(gi148734544) | 2e-06 | Click |
| 12 | 2758569..2759195 | CP4-57 prophage; putative protein; b2626 | N/A | Click |
| 13 | complement(2759373..2761562) | CP4-57 prophage; conserved protein; b2627 | N/A | Click |
| 14 | complement(2761559..2763175) | CP4-57 prophage; putative protein; b2628 | N/A | Click |
| 15 | complement(2763535..2763798) | CP4-57 prophage; putative protein; b2629 | N/A | Click |
| 16 | 2763940..2765013 | CP4-57 prophage; RNase LS; b2630 | N/A | Click |
| 17 | 2765006..2765377 | CP4-57 prophage; putative protein; b2631 | N/A | Click |
| 18 | 2765732..2766595 | CP4-57 prophage; predicted GTP-binding protein; b2632 | N/A | Click |
| 19 | 2766687..2767508 | PHAGE_Cronob_vB_CsaM_GAP32_NC_019401: hypothetical protein; putative; phage protein; b2633(gi414086954) | 8e-45 | Click |
| 20 | 2767725..2768426 | CP4-57 prophage; predicted DNA-binding transcriptional regulator; b2634 | N/A | Click |
| 21 | 2768467..2768703 | CP4-57 prophage; predicted inner membrane protein; b2635 | N/A | Click |
| 22 | 2768703..2769146 | CP4-57 prophage; putative protein; b2636 | N/A | Click |
| 23 | 2769170..2769637 | CP4-57 prophage; putative protein; b2637 | N/A | Click |
| 24 | complement(2770024..2770176) | N/A; b2638 | 0 | Click |
| 25 | complement(2770189..2771204) | N/A; b2641 | 0 | Click |
| 26 | 2771340..2773043 | CP4-57 prophage; predicted inner membrane protein; b2642 | N/A | Click |
| 27 | 2773567..2773838 | N/A; b4644 | 0 | Click |
| 28 | 2773941..2774399 | PHAGE_Pseudo_YuA_NC_010116: hypothetical protein; predicted; phage antirestriction protein; b2643(gi162135127) | 5e-15 | Click |
| 29 | 2774408..2774890 | CP4-57 prophage; predicted DNA repair protein; b2644 | N/A | Click |
| 30 | 2774899..2775099 | hypothetical protein; b4548 | N/A | Click |
| 31 | 2775137..2775454 | CP4-57 prophage; antitoxin of the YpjF-YfjZ toxin-antitoxin system; b2645 | N/A | Click |
| 32 | 2775475..2775804 | CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system; b2646 | N/A | Click |
| 33 | 2775510..2775522 | attR GAAGCCCTGCCTG | N/A | Click |
| 34 | complement(2776168..2780748) | PHAGE_Synech_S_IOM18_NC_021536: structural protein; b2647; phage(gi514051118) | 4e-20 | Click |
| 35 | complement(2781087..2781326) | PHAGE_Entero_Fels_2_NC_010463: DNA-invertase; b2648; phage(gi169936026) | 1e-13 | Click |
Region 10, total : 41 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4502081..4503298 | PHAGE_Burkho_phi1026b_NC_005284: gp59; b4279; phage(gi38707949) | 2e-14 | Click |
| 2 | 4503310..4504428 | putative oxidoreductase; b4280 | N/A | Click |
| 3 | 4504471..4504596 | hypothetical protein; b4655 | N/A | Click |
| 4 | complement(4504649..4504879) | N/A; b4281 | 0 | Click |
| 5 | 4504884..4505132 | N/A; b4282 | 0 | Click |
| 6 | 4505220..4507816 | PHAGE_Entero_Sf6_NC_005344: putative transposase OrfB; b4623; phage(gi41057343) | 2e-88 | Click |
| 7 | complement(4505489..4506640) | PROPHAGE_Escher_MG1655: IS30 transposase; b4284; phage(gi16132105) | 0.0 | Click |
| 8 | complement(4506699..4506965) | PHAGE_Shigel_SfIV_NC_022749: ISEhe3 orfA; b4561; phage(gi557307550) | 1e-05 | Click |
| 9 | 4507827..4508156 | N/A; b4286 | 0 | Click |
| 10 | complement(4508713..4509480) | PHAGE_Plankt_PaV_LD_NC_016564: ABC transporter; iron-dicitrate; phage transporter subunit; b4287(gi371496158) | 2e-16 | Click |
| 11 | complement(4509481..4510437) | KpLE2 phage-like element; iron-dicitrate transporter subunit; b4288 | N/A | Click |
| 12 | complement(4510434..4511432) | KpLE2 phage-like element; iron-dicitrate transporter subunit; b4289 | N/A | Click |
| 13 | complement(4511429..4512331) | KpLE2 phage-like element; iron-dicitrate transporter subunit; b4290 | N/A | Click |
| 14 | complement(4512376..4514700) | KpLE2 phage-like element; ferric citrate outer membrane transporter; b4291 | N/A | Click |
| 15 | complement(4514787..4515740) | KpLE2 phage-like element; transmembrane signal transducer for ferric citrate transport; b4292 | N/A | Click |
| 16 | complement(4515737..4516258) | KpLE2 phage-like element; RNA polymerase, sigma 19 factor; b4293 | N/A | Click |
| 17 | 4516530..4516541 | attL GGTGATTTTAAG | N/A | Click |
| 18 | 4516550..4516825 | PHAGE_Entero_P1_NC_005856: InsA; b4294; phage(gi46401643) | 3e-45 | Click |
| 19 | 4516744..4517247 | PHAGE_Shigel_SfIV_NC_022749: IS1 transposase B; b4576; phage(gi557307573) | 5e-84 | Click |
| 20 | complement(4517361..4518347) | putative DNA-binding transcriptional regulator; KpLE2 phage-like element; b4295 | N/A | Click |
| 21 | complement(4518694..4520043) | KpLE2 phage-like element; predicted transporter; b4296 | N/A | Click |
| 22 | complement(4520150..4522117) | KpLE2 phage-like element; predicted dehydratase; b4297 | N/A | Click |
| 23 | complement(4522128..4523033) | KpLE2 phage-like element; predicted lyase/synthase; b4298 | N/A | Click |
| 24 | complement(4523038..4523826) | KpLE2 phage-like element; predicted DNA-binding transcriptional regulator; b4299 | N/A | Click |
| 25 | complement(4524129..4524911) | KpLE2 phage-like element; predicted DNA-binding transcriptional regulator; b4300 | N/A | Click |
| 26 | complement(4524928..4525560) | KpLE2 phage-like element; predicted epimerase; b4301 | N/A | Click |
| 27 | complement(4525572..4526003) | KpLE2 phage-like element; predicted phosphotransferase enzyme IIA component; b4302 | N/A | Click |
| 28 | complement(4526134..4526940) | KpLE2 phage-like element; predicted nucleoside triphosphatase; b4303 | N/A | Click |
| 29 | complement(4526953..4528266) | KpLE2 phage-like element; predicted phosphotransferase enzyme IIC component; b4304 | N/A | Click |
| 30 | complement(4528278..4528556) | putative enzyme IIB component of PTS; b4565 | N/A | Click |
| 31 | complement(4528553..4529674) | KpLE2 phage-like element; predicted endoglucanase with Zn-dependent exopeptidase domain; b4305 | N/A | Click |
| 32 | complement(4530073..4530333) | N/A; b4656 | 0 | Click |
| 33 | complement(4530460..4531206) | KpLE2 phage-like element; predicted methyltransferase; b4306 | N/A | Click |
| 34 | complement(4531262..4531807) | KpLE2 phage-like element; predicted acetyltransferase; b4307 | N/A | Click |
| 35 | complement(4531819..4532076) | hypothetical protein; b4566 | N/A | Click |
| 36 | complement(4532453..4532698) | N/A; b4657 | 0 | Click |
| 37 | 4532814..4534054 | N/A; b4308 | 0 | Click |
| 38 | complement(4534637..4535617) | PHAGE_Stx2_converting_86_NC_008464: hypothetical protein Stx2-86_gp03; b4309; phage(gi116221995) | 8e-103 | Click |
| 39 | complement(4535682..4536788) | N-acetylneuraminic acid mutarotase; b4310 | N/A | Click |
| 40 | complement(4536808..4537524) | N-acetylnuraminic acid outer membrane channel protein; b4311 | N/A | Click |
| 41 | 4538980..4539582 | PHAGE_Thermu_P74_26_NC_009804: phage XerD-like integrase; b4312; phage(gi157265417) | 1e-09 | Click |
| 42 | 4540060..4540656 | PHAGE_Mycoba_32HC_NC_023602: integrase; b4313; phage(gi589893371) | 2e-07 | Click |
| 43 | 4543096..4543107 | attR GGTGATTTTAAG | N/A | Click |