| Definition | Erwinia pyrifoliae DSM 12163 complete genome, culture collection DSM:12163. |
|---|---|
| Accession | FN392235 |
| Length | 4,026,286 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1059308..1060471) | PHAGE_Lactob_KC5a: putative minor tail protein; EPYR_00964; phage(gi90592623) | 4e-06 | Click |
| 2 | complement(1060468..1061664) | PHAGE_Plankt_PaV_LD: ABC transporter; EPYR_00965; phage(gi371496158) | 8e-26 | Click |
| 3 | complement(1062057..1063016) | PHAGE_Mycoba_Myrna: gp256; EPYR_00966; phage(gi203454817) | 2e-129 | Click |
| 4 | complement(1063069..1065219) | PHAGE_Entero_phiEF24C: putative ribonucleotide reductase; EPYR_00967; phage(gi158079505) | 0.0 | Click |
| 5 | complement(1065607..1065849) | PHAGE_Mycoba_Porky: gp37; EPYR_00968; phage(gi194303333) | 3e-10 | Click |
| 6 | 1066366..1066701 | Uncharacterized protein ygaC; EPYR_00969 | N/A | Click |
| 7 | 1066809..1067111 | PHAGE_Entero_Sf6: gene 56 protein; EPYR_00970; phage(gi41057344) | 6e-47 | Click |
| 8 | 1067138..1067977 | PHAGE_Entero_Sf6: putative transposase OrfB; EPYR_00971; phage(gi41057343) | 7e-163 | Click |
| 9 | 1068103..1068585 | PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp15; EPYR_00972; phage(gi221328633) | 4e-34 | Click |
| 10 | complement(1068621..1069187) | PHAGE_Bacill_SPBc2: hypothetical protein SPBc2p012; EPYR_00973; phage(gi9630137) | 4e-08 | Click |
Region 2, total : 42 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1976341..1977621) | PHAGE_Feldma_virus: putative hybrid sensor histdine kinase; EPYR_01871; phage(gi197322490) | 1e-12 | Click |
| 2 | 1977859..1977990 | hypothetical protein; EPYR_01872 | N/A | Click |
| 3 | complement(1977987..1978550) | PHAGE_Pectob_ZF40: hypothetical protein; EPYR_01873; phage(gi422936646) | 1e-30 | Click |
| 4 | complement(1978547..1980790) | PHAGE_Pectob_ZF40: putative exonuclease; ORF6;; phage Flags: Fragment; EPYR_01874(gi422936647) | 1e-118 | Click |
| 5 | complement(1980792..1981061) | hypothetical protein; EPYR_01875 | N/A | Click |
| 6 | complement(1981129..1981452) | PHAGE_Gifsy_1: hypothetical protein STM2631.Gifsy1; EPYR_01876; phage(gi169257261) | 2e-13 | Click |
| 7 | complement(1981806..1981904) | hypothetical protein; EPYR_01877 | N/A | Click |
| 8 | 1982036..1982128 | hypothetical protein; EPYR_01878 | N/A | Click |
| 9 | complement(1982199..1982600) | PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; Repressor; phage protein of division inhibition gene dicA; EPYR_01879(gi401817574) | 1e-29 | Click |
| 10 | 1982684..1982887 | PHAGE_Entero_mEp390: prophage anti-repressor; EPYR_01880; phage(gi428782702) | 4e-08 | Click |
| 11 | 1983348..1984256 | PHAGE_Erwini_PEp14: putative phage O family protein; EPYR_01881; phage(gi374531901) | 3e-40 | Click |
| 12 | 1984354..1985004 | PHAGE_Erwini_PEp14: hypothetical protein; EPYR_01882; phage(gi374531902) | 7e-24 | Click |
| 13 | 1985006..1985248 | PHAGE_Bacill_phBC6A51: hypothetical protein BC1874; EPYR_01883; phage(gi31415768) | 2e-16 | Click |
| 14 | 1985932..1986129 | hypothetical protein; EPYR_01884 | N/A | Click |
| 15 | 1986187..1986786 | PHAGE_Gifsy_1: conserved hypothetical bacteriophage protein; EPYR_01885; phage(gi169257248) | 3e-52 | Click |
| 16 | 1986783..1987262 | PHAGE_Erwini_phiEt88: hypothetical protein; EPYR_01886; phage(gi327198620) | 1e-36 | Click |
| 17 | 1987262..1987948 | PHAGE_Cronob_phiES15: putative antitermination protein Q; EPYR_01887; phage(gi401817583) | 9e-27 | Click |
| 18 | 1988126..1988455 | PHAGE_Escher_HK75: holin; gpS; phage protein; Includes: RecName: Full=Lysis protein S; Includes: RecName: Full=Lysis inhibitor; EPYR_01888(gi356870729) | 5e-14 | Click |
| 19 | 1988459..1989082 | PHAGE_Cronob_ENT39118: endolysin; EPYR_01889; phage(gi431811063) | 8e-69 | Click |
| 20 | 1989079..1989486 | hypothetical protein; EPYR_01890 | N/A | Click |
| 21 | 1989835..1990242 | PHAGE_Burkho_BcepB1A: gp23; EPYR_01891; phage(gi48697513) | 9e-19 | Click |
| 22 | 1990285..1990629 | PHAGE_Burkho_BcepB1A: gp22; EPYR_01892; phage(gi48697512) | 1e-09 | Click |
| 23 | 1990626..1991066 | PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.115; EPYR_01893; phage(gi126011049) | 1e-14 | Click |
| 24 | 1991063..1991521 | PHAGE_Burkho_BcepB1A: gp20; EPYR_01894; phage(gi48697510) | 1e-16 | Click |
| 25 | 1991521..1991889 | PHAGE_Burkho_BcepB1A: gp19; EPYR_01895; phage(gi48697509) | 2e-08 | Click |
| 26 | 1991819..1992394 | PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.113; EPYR_01896; phage(gi126011047) | 8e-10 | Click |
| 27 | 1992409..1993896 | PHAGE_Burkho_BcepF1: hypothetical protein BcepF1.111; EPYR_01897; phage(gi126011045) | 7e-73 | Click |
| 28 | 1993904..1994359 | PHAGE_Burkho_BcepB1A: gp16; EPYR_01898; phage(gi48697506) | 5e-27 | Click |
| 29 | 1994401..1994859 | PHAGE_Burkho_BcepB1A: gp15 E; EPYR_01899; phage(gi48697505) | 7e-28 | Click |
| 30 | 1994942..1996618 | PHAGE_Burkho_BcepB1A: gp14 T; ORF27;; phage EPYR_01900(gi72257065) | 3e-26 | Click |
| 31 | 1996615..1997124 | PHAGE_Burkho_BcepB1A: gp13; EPYR_01901; phage(gi48697561) | 1e-12 | Click |
| 32 | 1997131..1997424 | PHAGE_Burkho_BcepB1A: gp12; EPYR_01902; phage(gi48697560) | 9e-08 | Click |
| 33 | 1997417..1998232 | PHAGE_Burkho_BcepB1A: gp11; EPYR_01903; phage(gi48697559) | 3e-45 | Click |
| 34 | 1998236..1998928 | PHAGE_Burkho_BcepB1A: gp10 V; EPYR_01904; phage(gi48697558) | 2e-35 | Click |
| 35 | 1998925..1999269 | PHAGE_Burkho_BcepB1A: gp09; EPYR_01905; phage(gi48697557) | 3e-12 | Click |
| 36 | 1999262..2000449 | PHAGE_Burkho_BcepB1A: gp08 W; EPYR_01906; phage(gi48697556) | 8e-81 | Click |
| 37 | 2000446..2001099 | PHAGE_Burkho_BcepB1A: gp07; EPYR_01907; phage(gi48697555) | 1e-37 | Click |
| 38 | 2001103..2002038 | PHAGE_Entero_01: Putative tail fiber protein; EPYR_01908; phage(gi38707850) | 8e-49 | Click |
| 39 | complement(2002059..2003174) | PHAGE_Acidia_virus: hypothetical protein ATV_gp34; EPYR_01909; phage(gi75750403) | 2e-10 | Click |
| 40 | complement(2003213..2003473) | PHAGE_Haemop_HP2: hypothetical protein HP2p14; EPYR_01910; phage(gi17981828) | 5e-16 | Click |
| 41 | complement(2003884..2004729) | PHAGE_Acidia_virus: hypothetical protein ATV_gp34; EPYR_01911; phage(gi75750403) | 2e-05 | Click |
| 42 | complement(2004946..2005206) | PHAGE_Haemop_HP2: hypothetical protein HP2p14; EPYR_01912; phage(gi17981828) | 2e-15 | Click |
Region 3, total : 64 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2281145..2281390 | PHAGE_Entero_mEp237: virulence protein MsgA; EPYR_02180; phage(gi435439290) | 9e-27 | Click |
| 2 | 2281836..2282066 | hypothetical protein; EPYR_02181 | N/A | Click |
| 3 | complement(2282167..2282547) | PHAGE_Entero_mEp390: putative holin; EPYR_02182; phage(gi428782712) | 6e-22 | Click |
| 4 | complement(2282854..2282967) | hypothetical protein; EPYR_02183 | N/A | Click |
| 5 | 2282984..2283841 | hypothetical protein; EPYR_02184 | N/A | Click |
| 6 | 2283963..2284247 | PROPHAGE_Xantho_33913: ISxac3 transposase; ISO-S3; phage 11 kDa protein; EPYR_02185(gi21231087) | 5e-21 | Click |
| 7 | 2284289..2285098 | PROPHAGE_Escher_CFT073: transposase insF; EPYR_02186; phage(gi26250329) | 5e-81 | Click |
| 8 | complement(2285905..2286057) | isocitrate dehydrogenase; EPYR_02187 | N/A | Click |
| 9 | 2286185..2286197 | attL GGGTTTTGATAAC | N/A | Click |
| 10 | 2286327..2287163 | hypothetical protein; EPYR_02188 | N/A | Click |
| 11 | complement(2287284..2287844) | PHAGE_Sodali_phiSG1: putative phage tail fiber assembly protein; EPYR_02189; phage(gi89886004) | 8e-27 | Click |
| 12 | complement(2287841..2288827) | PHAGE_Entero_SfV: hypothetical protein SfVp21; EPYR_02190; phage(gi19548989) | 9e-19 | Click |
| 13 | complement(2288796..2289377) | PHAGE_Entero_SfV: tail protein; Flags:; phage Precursor; EPYR_02191(gi19548988) | 3e-62 | Click |
| 14 | complement(2289380..2290477) | PHAGE_Entero_SfV: tail protein; EPYR_02192; phage(gi19549009) | 6e-110 | Click |
| 15 | complement(2290446..2290862) | PHAGE_Entero_SfV: tail protein; EPYR_02193; phage(gi19549008) | 2e-46 | Click |
| 16 | complement(2290859..2291398) | PHAGE_Entero_SfV: tail protein; EPYR_02194; phage(gi19549007) | 1e-38 | Click |
| 17 | complement(2291395..2292471) | PHAGE_Entero_SfV: tail protein; 43; phage kDa tail protein; gpP; EPYR_02195(gi19549006) | 2e-149 | Click |
| 18 | complement(2292468..2293775) | PHAGE_Entero_SfV: tail/DNA circulation protein; EPYR_02196; phage(gi19549005) | 2e-146 | Click |
| 19 | complement(2293805..2295712) | PHAGE_Entero_SfV: tail protein; EPYR_02197; phage(gi19549004) | 7e-33 | Click |
| 20 | complement(2295797..2296120) | PHAGE_Entero_SfV: hypothetical protein SfVp13; EPYR_02198; phage(gi19549003) | 2e-11 | Click |
| 21 | complement(2296117..2296473) | PHAGE_Entero_SfV: hypothetical protein SfVp12; EPYR_02199; phage(gi19549002) | 3e-51 | Click |
| 22 | complement(2296473..2297969) | PHAGE_Entero_SfV: tail sheath protein; EPYR_02200; phage(gi19549001) | 0.0 | Click |
| 23 | complement(2297969..2298148) | PHAGE_Entero_SfV: hypothetical protein SfVp10; EPYR_02201; phage(gi19549000) | 4e-13 | Click |
| 24 | complement(2298152..2298712) | PHAGE_Entero_SfV: hypothetical protein SfVp09; EPYR_02202; phage(gi19548999) | 2e-65 | Click |
| 25 | complement(2298709..2299215) | PHAGE_Entero_SfV: hypothetical protein SfVp08; EPYR_02203; phage(gi19548998) | 5e-68 | Click |
| 26 | complement(2299208..2299597) | PHAGE_Entero_SfV: hypothetical protein SfVp07; EPYR_02204; phage(gi19548997) | 2e-22 | Click |
| 27 | complement(2299599..2299928) | PHAGE_Entero_SfV: hypothetical protein SfVp06; EPYR_02205; phage(gi19548996) | 1e-25 | Click |
| 28 | complement(2299938..2300396) | PHAGE_Helico_2: hypothetical protein; EPYR_02206; phage(gi370703036) | 3e-17 | Click |
| 29 | complement(2300396..2301613) | PHAGE_Entero_mEp235: major head subunit; Gp5;; phage Head protein; Flags: Precursor; EPYR_02207(gi428781815) | 0.0 | Click |
| 30 | complement(2301623..2302471) | PHAGE_Entero_mEp235: head maturation protease; EPYR_02208; phage(gi428781814) | 2e-103 | Click |
| 31 | complement(2301739..2301840) | hypothetical protein; EPYR_02209 | N/A | Click |
| 32 | complement(2302483..2303787) | PHAGE_Entero_mEp235: portal protein; GP3;; phage EPYR_02210(gi428781813) | 0.0 | Click |
| 33 | complement(2303787..2305532) | PHAGE_Tetras_SI1: terminase; EPYR_02211; phage(gi472342258) | 1e-131 | Click |
| 34 | complement(2305486..2305959) | PHAGE_Entero_SfV: small terminase subunit; EPYR_02212; phage(gi19548991) | 8e-11 | Click |
| 35 | complement(2306186..2306287) | hypothetical protein; EPYR_02213 | N/A | Click |
| 36 | complement(2306275..2306625) | PHAGE_Cronob_ENT39118: HNH nuclease; EPYR_02214; phage(gi431811078) | 3e-42 | Click |
| 37 | complement(2306603..2306857) | PHAGE_Gifsy_1: bacteriophage lysis protein; Rz; Flags:; phage Fragment; EPYR_02215(gi169257238) | 8e-12 | Click |
| 38 | complement(2307039..2307182) | hypothetical protein; EPYR_02216 | N/A | Click |
| 39 | complement(2307163..2307594) | PHAGE_Burkho_BcepGomr: BcepGomrgp71; Protein; phage V; EPYR_02217(gi146329983) | 1e-27 | Click |
| 40 | complement(2307563..2307919) | PHAGE_Entero_SfV: holin; EPYR_02218; phage(gi19549036) | 8e-38 | Click |
| 41 | 2308308..2308721 | PHAGE_Haemop_HP2: hypothetical protein HP2p14; EPYR_02219; phage(gi17981828) | 4e-19 | Click |
| 42 | complement(2308776..2309834) | PHAGE_Klebsi_phiKO2: putative DNA adenine methylase; EPYR_02220; phage(gi46402138) | 1e-129 | Click |
| 43 | complement(2309983..2310183) | PHAGE_Entero_SfV: hypothetical protein SfVp47; EPYR_02221; phage(gi19549034) | 2e-05 | Click |
| 44 | 2310420..2311235 | hypothetical protein; EPYR_02222 | N/A | Click |
| 45 | 2311241..2311534 | hypothetical protein; EPYR_02223 | N/A | Click |
| 46 | complement(2311570..2311974) | PHAGE_Entero_mEp390: late gene regulator Q; EPYR_02224; phage(gi428782710) | 3e-32 | Click |
| 47 | complement(2311934..2313010) | PHAGE_Entero_SfV: hypothetical protein SfVp45; EPYR_02225; phage(gi19549032) | 4e-114 | Click |
| 48 | complement(2313007..2313888) | PHAGE_Entero_SfV: DNA adenine methylase; EPYR_02226; phage(gi19549028) | 2e-82 | Click |
| 49 | complement(2313882..2314334) | PHAGE_Entero_SfV: hypothetical protein SfVp40; EPYR_02227; phage(gi19549027) | 2e-06 | Click |
| 50 | complement(2314331..2315383) | PHAGE_Pectob_ZF40: putative replication protein; EPYR_02228; phage(gi422936654) | 7e-42 | Click |
| 51 | complement(2315373..2315558) | hypothetical protein; EPYR_02229 | N/A | Click |
| 52 | complement(2315380..2315562) | hypothetical protein; EPYR_02230 | N/A | Click |
| 53 | complement(2315559..2316371) | PHAGE_Entero_SfV: hypothetical protein SfVp44; EPYR_02231; phage(gi19549031) | 4e-37 | Click |
| 54 | complement(2316368..2316577) | hypothetical protein; EPYR_02232 | N/A | Click |
| 55 | complement(2316624..2317088) | PHAGE_Entero_mEp390: hypothetical protein; EPYR_02233; phage(gi428782704) | 1e-59 | Click |
| 56 | complement(2319142..2319579) | hypothetical protein; EPYR_02234 | N/A | Click |
| 57 | 2319680..2320051 | PHAGE_Entero_SfV: hypothetical protein SfVp32; EPYR_02235; phage(gi19549019) | 1e-34 | Click |
| 58 | 2320111..2320938 | PHAGE_Entero_SfV: hypothetical protein SfVp31; EPYR_02236; phage(gi19549018) | 9e-86 | Click |
| 59 | 2321059..2321601 | PHAGE_Entero_SfV: hypothetical protein SfVp30; EPYR_02237; phage(gi19549017) | 2e-56 | Click |
| 60 | 2321594..2322037 | PHAGE_Yersin_PY54: hypothetical protein PY54p47; EPYR_02238; phage(gi33770556) | 4e-38 | Click |
| 61 | 2322012..2322689 | PHAGE_Entero_P1: PmgT; EPYR_02239; phage(gi46401715) | 4e-66 | Click |
| 62 | 2322686..2323075 | PHAGE_Entero_SfV: hypothetical protein SfVp29; EPYR_02240; phage(gi19549016) | 2e-22 | Click |
| 63 | 2323072..2323641 | PHAGE_Entero_mEp460: putative exonuclease; EPYR_02241; phage(gi428782342) | 2e-85 | Click |
| 64 | 2323656..2323763 | hypothetical protein; EPYR_02242 | N/A | Click |
| 65 | 2323910..2325037 | PHAGE_Entero_mEp235: integrase; EPYR_02243; phage(gi428781836) | 4e-57 | Click |
| 66 | 2326440..2326452 | attR GGGTTTTGATAAC | N/A | Click |
Region 4, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2591921..2593153) | PHAGE_Mollus_1: MC006L; EPYR_02521; phage(gi9628938) | 2e-06 | Click |
| 2 | complement(2593354..2593806) | Transcriptional regulator mntR; EPYR_02522 | N/A | Click |
| 3 | 2593987..2594094 | hypothetical protein; EPYR_02523 | N/A | Click |
| 4 | complement(2594356..2594919) | PHAGE_Salmon_1: putative Lom-like outer membrane protein; EPYR_02524; phage(gi169257198) | 2e-24 | Click |
| 5 | 2595222..2596118 | PHAGE_Lactob_KC5a: putative minor tail protein; EPYR_02525; phage(gi90592623) | 3e-06 | Click |
| 6 | 2596473..2596979 | PHAGE_Cronob_vB_CsaP_GAP52: DNA-binding protein; EPYR_02526; phage(gi414087525) | 3e-08 | Click |
| 7 | 2597057..2597320 | PHAGE_Klebsi_KP15: hypothetical protein KP-KP15_gp024; EPYR_02527; phage(gi294661446) | 3e-20 | Click |
| 8 | 2597608..2598357 | PHAGE_Cafete_BV_PW1: putative ABC-type amino acid transporter; EPYR_02528; phage(gi310831221) | 2e-12 | Click |
| 9 | 2598458..2599117 | glutamine ABC transport system, inner membrane component; EPYR_02529 | N/A | Click |
| 10 | 2599114..2599836 | PHAGE_Plankt_PaV_LD: ABC transporter; EPYR_02530; phage(gi371496158) | 9e-36 | Click |
| 11 | 2600086..2600328 | hypothetical protein; EPYR_02531 | N/A | Click |
| 12 | complement(2600482..2601522) | PROPHAGE_Escher_EDL933: putative transposase; ISO-IS200; phage 39 kDa protein; EPYR_02532(gi15803522) | 1e-140 | Click |
Region 5, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3176004..3176019 | attL CAACGCCAGCGGCAAT | N/A | Click |
| 2 | 3187766..3195784 | PHAGE_Prochl_P_SSM7: YadA domain-containing structural protein; EPYR_03134; phage(gi326784580) | 1e-17 | Click |
| 3 | 3195962..3196825 | PHAGE_Bacill_BPS13: putative tail lysin 2; EPYR_03135; phage(gi410492620) | 1e-05 | Click |
| 4 | complement(3196010..3196219) | hypothetical protein; EPYR_03136 | N/A | Click |
| 5 | complement(3197140..3197367) | Endoribonuclease symE; EPYR_03137 | N/A | Click |
| 6 | complement(3197547..3197969) | PHAGE_Vibrio_CTX: RstR; Ans; phage operon repressor protein; EPYR_03138(gi332672299) | 2e-09 | Click |
| 7 | 3198082..3201147 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03139; phage(gi371671350) | 2e-14 | Click |
| 8 | 3201176..3202213 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03140; phage(gi157265417) | 4e-10 | Click |
| 9 | 3202213..3202542 | hypothetical protein; EPYR_03141 | N/A | Click |
| 10 | 3202539..3202838 | Uncharacterized protein y4kP; EPYR_03142 | N/A | Click |
| 11 | 3203541..3204356 | PHAGE_Bacill_BPS13: putative tail lysin 2; EPYR_03143; phage(gi410492620) | 9e-06 | Click |
| 12 | 3213065..3213080 | attR CAACGCCAGCGGCAAT | N/A | Click |
Region 6, total : 44 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(3442365..3442868) | PHAGE_Clostr_CD119: RepR; putative repressor; EPYR_03399; phage(gi90592681) | 2e-09 | Click |
| 2 | 3442862..3445546 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03400; phage(gi371671350) | 2e-18 | Click |
| 3 | 3445587..3445721 | hypothetical protein; EPYR_03401 | N/A | Click |
| 4 | 3445718..3446788 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03402; phage(gi157265417) | 6e-11 | Click |
| 5 | 3446814..3447572 | PHAGE_Mollus_1: MC018L; EPYR_03403; phage(gi9628950) | 9e-05 | Click |
| 6 | complement(3447236..3447352) | hypothetical protein; EPYR_03404 | N/A | Click |
| 7 | 3447433..3448101 | Protein rhsB precursor; EPYR_03405 | N/A | Click |
| 8 | 3448116..3448385 | hypothetical protein; EPYR_03406 | N/A | Click |
| 9 | complement(3448450..3448752) | hypothetical protein; EPYR_03407 | N/A | Click |
| 10 | complement(3448827..3449330) | PHAGE_Clostr_CD119: RepR; putative repressor; EPYR_03408; phage(gi90592681) | 2e-09 | Click |
| 11 | 3449324..3452008 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03409; phage(gi371671350) | 2e-18 | Click |
| 12 | 3452049..3452183 | hypothetical protein; EPYR_03410 | N/A | Click |
| 13 | 3452180..3453250 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03411; phage(gi157265417) | 6e-11 | Click |
| 14 | 3453263..3453331 | attL CAGGCCGCAGGTTGTGGAGTCCGGCAGAGCGCACCCTCCCTGGTGCGATCTGCCTTCATCACGTTCAGC | N/A | Click |
| 15 | 3453263..3453331 | attL CAGGCCGCAGGTTGTGGAGTCCGGCAGAGCGCACCCTCCCTGGTGCGATCTGCCTTCATCACGTTCAGC | N/A | Click |
| 16 | 3453276..3454034 | PHAGE_Mollus_1: MC018L; EPYR_03412; phage(gi9628950) | 9e-05 | Click |
| 17 | complement(3453698..3453814) | hypothetical protein; EPYR_03413 | N/A | Click |
| 18 | 3454994..3455335 | hypothetical protein; EPYR_03414 | N/A | Click |
| 19 | complement(3455054..3455356) | hypothetical protein; EPYR_03415 | N/A | Click |
| 20 | complement(3455435..3455836) | PHAGE_Strept_858: orf44; EPYR_03416; phage(gi168229317) | 2e-07 | Click |
| 21 | 3456096..3458642 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03417; phage(gi371671350) | 2e-12 | Click |
| 22 | 3458857..3459912 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03418; phage(gi157265417) | 4e-11 | Click |
| 23 | complement(3459801..3459974) | hypothetical protein; EPYR_03419 | N/A | Click |
| 24 | 3460032..3460043 | attL TCAGGCCGCAGG | N/A | Click |
| 25 | 3460045..3460059 | attL TGTGGAGTCCGGCAG | N/A | Click |
| 26 | 3460173..3460415 | Antitoxin RelB; EPYR_03420 | N/A | Click |
| 27 | 3460405..3460689 | Toxin relE; EPYR_03421 | N/A | Click |
| 28 | 3462063..3462275 | hypothetical protein; EPYR_03422 | N/A | Click |
| 29 | complement(3462323..3462625) | hypothetical protein; EPYR_03423 | N/A | Click |
| 30 | complement(3462704..3463117) | PHAGE_Bacill_IEBH: helix-turn-helix domain protein; Repressor; phage protein of division inhibition gene dicA; EPYR_03424(gi197261593) | 8e-07 | Click |
| 31 | 3463377..3466010 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03425; phage(gi371671350) | 6e-09 | Click |
| 32 | 3466115..3467170 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03426; phage(gi157265417) | 2e-10 | Click |
| 33 | complement(3467059..3467232) | hypothetical protein; EPYR_03427 | N/A | Click |
| 34 | 3467303..3467317 | attR TGTGGAGTCCGGCAG | N/A | Click |
| 35 | 3467447..3468256 | hypothetical protein; EPYR_03428 | N/A | Click |
| 36 | 3468688..3468798 | hypothetical protein; EPYR_03429 | N/A | Click |
| 37 | complement(3469359..3469688) | conserved hypothetical protein; EPYR_03430 | N/A | Click |
| 38 | complement(3469770..3470198) | PHAGE_Vibrio_CTX: RstR; EPYR_03431; phage(gi332672299) | 2e-06 | Click |
| 39 | 3470277..3473063 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03432; phage(gi371671350) | 4e-17 | Click |
| 40 | 3473379..3474434 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03433; phage(gi157265417) | 1e-10 | Click |
| 41 | complement(3474323..3474496) | hypothetical protein; EPYR_03434 | N/A | Click |
| 42 | 3474695..3474937 | Antitoxin RelB; EPYR_03435 | N/A | Click |
| 43 | 3474927..3475211 | Toxin relE; EPYR_03436 | N/A | Click |
| 44 | 3475241..3475252 | attR TCAGGCCGCAGG | N/A | Click |
| 45 | 3475242..3475310 | attR CAGGCCGCAGGTTGTGGAGTCCGGCAGAGCGCACCCTCCCTGGTGCGATCTGCCTTCATCACGTTCAGC | N/A | Click |
| 46 | complement(3475848..3476012) | hypothetical protein; EPYR_03437 | N/A | Click |
| 47 | 3476453..3476563 | hypothetical protein; EPYR_03438 | N/A | Click |
| 48 | complement(3477124..3477453) | conserved hypothetical protein; EPYR_03439 | N/A | Click |
| 49 | complement(3477535..3477963) | PHAGE_Vibrio_CTX: RstR; EPYR_03440; phage(gi332672299) | 2e-06 | Click |
| 50 | 3478042..3480804 | PHAGE_Helico_phiHP33: DNA primase; EPYR_03441; phage(gi371671350) | 1e-16 | Click |
| 51 | 3481120..3482175 | PHAGE_Thermu_26: phage XerD-like integrase; EPYR_03442; phage(gi157265417) | 4e-10 | Click |
| 52 | 3482296..3482364 | attR CAGGCCGCAGGTTGTGGAGTCCGGCAGAGCGCACCCTCCCTGGTGCGATCTGCCTTCATCACGTTCAGC | N/A | Click |