| Definition | Sinorhizobium meliloti BL225C, complete genome. |
|---|---|
| Accession | CP002740 |
| Length | 3,671,982 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1366411..1366422 | attL GCGGCGCAGATG | N/A | Click |
| 2 | 1366668..1368002 | integrase family protein; SinmeB_1290 | N/A | Click |
| 3 | 1368228..1368887 | PHAGE_Salmon_SSU5: hypothetical protein; SinmeB_1291; phage(gi410491447) | 5e-09 | Click |
| 4 | 1368982..1372734 | hypothetical protein; SinmeB_1292 | N/A | Click |
| 5 | complement(1373339..1373644) | hypothetical protein; SinmeB_1294 | N/A | Click |
| 6 | complement(1373644..1375326) | PHAGE_Stx2_c_1717: transposase; SinmeB_1295; phage(gi209447153) | 2e-114 | Click |
| 7 | complement(1375281..1375628) | PHAGE_Stx2_c_1717: transposase; SinmeB_1296; phage(gi209447152) | 6e-28 | Click |
| 8 | complement(1375625..1376008) | PROPHAGE_Ralsto_GMI1000: ISRSO10-transposase ORFA protein; SinmeB_1297; phage(gi17546153) | 2e-12 | Click |
| 9 | 1376831..1377337 | hypothetical protein; SinmeB_1298 | N/A | Click |
| 10 | 1377330..1377515 | hypothetical protein; SinmeB_1299 | N/A | Click |
| 11 | 1377493..1377813 | hypothetical protein; SinmeB_1300 | N/A | Click |
| 12 | 1377779..1378453 | PHAGE_Burkho_KS9: hypothetical protein gp28; SinmeB_1301; phage(gi255033760) | 1e-09 | Click |
| 13 | complement(1378462..1378635) | Protein of unknown function DUF3606; SinmeB_1302 | N/A | Click |
| 14 | 1378881..1379120 | hypothetical protein; SinmeB_1303 | N/A | Click |
| 15 | complement(1379413..1379739) | PHAGE_Rhodob_RcapNL: hypothetical protein; SinmeB_1304; phage(gi461474983) | 2e-30 | Click |
| 16 | 1379789..1379800 | attR GCGGCGCAGATG | N/A | Click |
| 17 | complement(1379859..1380110) | hypothetical protein; SinmeB_1306 | N/A | Click |
| 18 | complement(1380110..1380925) | PHAGE_Synech_Syn19: hypothetical protein; SinmeB_1307; phage(gi326783645) | 3e-05 | Click |
| 19 | complement(1381005..1382819) | PHAGE_Cyanop_S_TIM5: virion structural protein; SinmeB_1308; phage(gi422936245) | 6e-18 | Click |
Region 2, total : 24 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1389968..1391812) | PHAGE_Synech_S_CBS1: tail tape measure protein; SinmeB_1315; phage(gi356870809) | 2e-10 | Click |
| 2 | 1391875..1392267 | hypothetical protein; SinmeB_1316 | N/A | Click |
| 3 | 1392335..1392514 | hypothetical protein; SinmeB_1317 | N/A | Click |
| 4 | complement(1392754..1393155) | hypothetical protein; SinmeB_1318 | N/A | Click |
| 5 | complement(1393170..1393580) | PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; SinmeB_1319; phage(gi461474972) | 5e-15 | Click |
| 6 | complement(1393617..1394081) | hypothetical protein; SinmeB_1320 | N/A | Click |
| 7 | complement(1394083..1394379) | hypothetical protein; SinmeB_1321 | N/A | Click |
| 8 | complement(1394381..1394707) | hypothetical protein; SinmeB_1322 | N/A | Click |
| 9 | complement(1394704..1395108) | PHAGE_Maruca_MNPV: PE38; SinmeB_1323; phage(gi119964655) | 4e-05 | Click |
| 10 | complement(1395185..1396216) | PHAGE_Burkho_BcepNazgul: capsid protein E; SinmeB_1324; phage(gi34610166) | 5e-40 | Click |
| 11 | complement(1396242..1396598) | hypothetical protein; SinmeB_1325 | N/A | Click |
| 12 | complement(1396601..1397152) | PHAGE_Mycoba_Adjutor: gp59; SinmeB_1326; phage(gi189043211) | 3e-07 | Click |
| 13 | complement(1397178..1398083) | PHAGE_Entero_HK630: head maturation protease C; SinmeB_1327; phage(gi428782792) | 2e-43 | Click |
| 14 | complement(1398080..1399804) | PHAGE_Salmon_SPN19: putative lambda family portal protein B; SinmeB_1328; phage(gi414090190) | 8e-70 | Click |
| 15 | complement(1399801..1400037) | PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SinmeB_1329; phage(gi169257234) | 3e-05 | Click |
| 16 | complement(1400048..1402090) | PHAGE_Synech_S_CBS1: large terminase subunit; SinmeB_1330; phage(gi356870795) | 3e-48 | Click |
| 17 | complement(1402087..1402725) | hypothetical protein; SinmeB_1331 | N/A | Click |
| 18 | complement(1402867..1403613) | PHAGE_Synech_S_CBS1: hypothetical protein; SinmeB_1332; phage(gi356870837) | 1e-07 | Click |
| 19 | complement(1403848..1404495) | NusG antitermination factor; SinmeB_1333 | N/A | Click |
| 20 | complement(1404479..1405708) | PHAGE_Burkho_phiE125: hypothetical protein phiE125p61; SinmeB_1334; phage(gi17975222) | 4e-10 | Click |
| 21 | complement(1405705..1407606) | PHAGE_Rhodob_RcapNL: C-5 cytosine-specific DNA methylase; SinmeB_1335; phage(gi461474996) | 1e-152 | Click |
| 22 | complement(1407593..1407907) | hypothetical protein; SinmeB_1336 | N/A | Click |
| 23 | complement(1407907..1408404) | PHAGE_Bacter_8: putative DNA N-6-adenine-methyltransferase; SinmeB_1337; phage(gi200003971) | 6e-17 | Click |
| 24 | complement(1408401..1409930) | PHAGE_Rhodov_RS1: MT-A70 family protein; SinmeB_1338; phage(gi472342898) | 2e-21 | Click |
Region 3, total : 24 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1744101..1746848) | PHAGE_Burkho_KS9: tail tip fiber protein gp19; SinmeB_1674; phage(gi255033750) | 4e-22 | Click |
| 2 | complement(1746855..1747259) | hypothetical protein; SinmeB_1675 | N/A | Click |
| 3 | complement(1747359..1747949) | hypothetical protein; SinmeB_1676 | N/A | Click |
| 4 | complement(1747946..1748596) | hypothetical protein; SinmeB_1677 | N/A | Click |
| 5 | complement(1748596..1750467) | PHAGE_Synech_S_CBS1: tail tape measure protein; SinmeB_1678; phage(gi356870809) | 2e-08 | Click |
| 6 | 1750573..1750752 | hypothetical protein; SinmeB_1679 | N/A | Click |
| 7 | complement(1750753..1750944) | Protein of unknown function DUF2376, phage; SinmeB_1680 | N/A | Click |
| 8 | complement(1750992..1751393) | hypothetical protein; SinmeB_1681 | N/A | Click |
| 9 | complement(1751406..1751816) | PHAGE_Rhodob_RcapNL: gene transfer aget (GTA) orfg9-like phage major tail protein; SinmeB_1682; phage(gi461474972) | 2e-14 | Click |
| 10 | complement(1751852..1752316) | PHAGE_Synech_S_CBS3: hypothetical protein; SinmeB_1683; phage(gi331028017) | 5e-05 | Click |
| 11 | complement(1752318..1752614) | hypothetical protein; SinmeB_1684 | N/A | Click |
| 12 | complement(1752617..1752943) | hypothetical protein; SinmeB_1685 | N/A | Click |
| 13 | complement(1752940..1753344) | hypothetical protein; SinmeB_1686 | N/A | Click |
| 14 | complement(1753417..1754448) | PHAGE_Burkho_AH2: major capsid protein; SinmeB_1687; phage(gi399529101) | 4e-39 | Click |
| 15 | complement(1754474..1754830) | hypothetical protein; SinmeB_1688 | N/A | Click |
| 16 | complement(1754833..1755375) | PHAGE_Alcela_1: putative immediate early protein; SinmeB_1689; phage(gi10140993) | 3e-06 | Click |
| 17 | complement(1755401..1756306) | PHAGE_Entero_HK630: head maturation protease C; SinmeB_1690; phage(gi428782792) | 2e-41 | Click |
| 18 | complement(1756303..1758027) | PHAGE_Salmon_SPN19: putative lambda family portal protein B; SinmeB_1691; phage(gi414090190) | 1e-69 | Click |
| 19 | complement(1758024..1758260) | PHAGE_Gifsy_1: bacteriophage head-to-tail joining protein; adapter between portal and gpFII; Lambda gpW homolog; SinmeB_1692; phage(gi169257234) | 3e-05 | Click |
| 20 | complement(1758271..1760313) | PHAGE_Synech_S_CBS1: large terminase subunit; SinmeB_1693; phage(gi356870795) | 7e-47 | Click |
| 21 | complement(1760310..1760948) | hypothetical protein; SinmeB_1694 | N/A | Click |
| 22 | complement(1761091..1761837) | PHAGE_Synech_S_CBS1: hypothetical protein; SinmeB_1695; phage(gi356870837) | 4e-08 | Click |
| 23 | complement(1762065..1762724) | NusG antitermination factor; SinmeB_1696 | N/A | Click |
| 24 | complement(1762708..1763931) | PHAGE_Entero_mEp460: replication protein; SinmeB_1697; phage(gi428782359) | 1e-08 | Click |
Region 4, total : 8 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3563747..3563766 | attL TGTGCTCGTCACAGGGATCC | N/A | Click |
| 2 | complement(3564005..3565585) | PHAGE_Human__2: ubiquitin E3 ligase ICP0; SinmeB_3361; phage(gi109676722) | 6e-10 | Click |
| 3 | 3565725..3566057 | hypothetical protein; SinmeB_3362 | N/A | Click |
| 4 | complement(3566121..3566648) | PHAGE_Europe_virus: hypothetical protein; SinmeB_3363; phage(gi388260142) | 6e-05 | Click |
| 5 | 3567040..3567126 | tRNA | N/A | Click |
| 6 | complement(3567254..3569209) | PHAGE_Pelagi_HTVC008M: adenylate/guanylyl cyclase; SinmeB_3364; phage(gi460042455) | 2e-24 | Click |
| 7 | complement(3569345..3570391) | PHAGE_Acanth_1: hypothetical protein ATCV1_Z295L; SinmeB_3365; phage(gi155371242) | 4e-08 | Click |
| 8 | complement(3570477..3570806) | hypothetical protein; SinmeB_3366 | N/A | Click |
| 9 | 3571014..3571640 | PHAGE_Microc_LMM01: 3'-5' exonuclease; SinmeB_3367; phage(gi117530351) | 7e-05 | Click |
| 10 | 3571662..3571681 | attR TGTGCTCGTCACAGGGATCC | N/A | Click |
| 11 | 3571999..3573147 | PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; SinmeB_3368; phage(gi17546158) | 1e-11 | Click |