| Definition | Escherichia coli UMNK88, complete genome. |
|---|---|
| Accession | CP002729 |
| Length | 5,186,416 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 51 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 294899..294954 | attL ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA | N/A | Click |
| 2 | complement(294959..296122) | PHAGE_Entero_SfV: integrase; UMNK88_279; phage(gi19549014) | 0.0 | Click |
| 3 | complement(296349..296654) | PHAGE_Entero_SfV: hypothetical protein SfVp28; UMNK88_280; phage(gi19549015) | 1e-53 | Click |
| 4 | complement(296654..296995) | PHAGE_Entero_SfV: hypothetical protein SfVp29; UMNK88_281; phage(gi19549016) | 3e-65 | Click |
| 5 | complement(297007..297543) | PHAGE_Entero_SfV: hypothetical protein SfVp30; UMNK88_282; phage(gi19549017) | 2e-97 | Click |
| 6 | 298185..298679 | hypothetical protein; UMNK88_283 | N/A | Click |
| 7 | complement(299021..299578) | PHAGE_Entero_SfV: repressor; UMNK88_284; phage(gi19549021) | 3e-109 | Click |
| 8 | 299786..299986 | PHAGE_Entero_SfV: repressor; UMNK88_285; phage(gi19549022) | 4e-33 | Click |
| 9 | 300030..300581 | PHAGE_Entero_SfV: hypothetical protein SfVp36; UMNK88_286; phage(gi19549023) | 2e-92 | Click |
| 10 | 300926..301867 | PHAGE_Entero_phiP27: hypothetical protein P27p17; UMNK88_287; phage(gi18249881) | 2e-41 | Click |
| 11 | 301870..302358 | PHAGE_Entero_SfV: hypothetical protein SfVp40; UMNK88_288; phage(gi19549027) | 7e-82 | Click |
| 12 | 302358..302684 | PHAGE_Entero_SfV: hypothetical protein SfVp42; UMNK88_289; phage(gi19549029) | 3e-55 | Click |
| 13 | 302681..303070 | PHAGE_Entero_SfV: crossover junction endodeoxyribonuclease; UMNK88_290; phage(gi19549030) | 4e-70 | Click |
| 14 | 303090..303887 | PHAGE_Entero_SfV: hypothetical protein SfVp44; UMNK88_291; phage(gi19549031) | 1e-133 | Click |
| 15 | 303895..304884 | PHAGE_Entero_SfV: hypothetical protein SfVp45; UMNK88_292; phage(gi19549032) | 1e-180 | Click |
| 16 | 304902..305255 | PHAGE_Entero_cdtI: antitermination protein Q; UMNK88_293; phage(gi148609434) | 2e-30 | Click |
| 17 | complement(305286..306251) | hypothetical protein; UMNK88_294 | N/A | Click |
| 18 | 306965..307291 | PHAGE_Entero_SfV: holin; UMNK88_295; phage(gi19549036) | 5e-57 | Click |
| 19 | 307295..307771 | PHAGE_Entero_SfV: lysin; UMNK88_296; phage(gi19549037) | 9e-87 | Click |
| 20 | 307755..308135 | PHAGE_Entero_SfV: putative Rz lytic protein; UMNK88_297; phage(gi19549038) | 5e-53 | Click |
| 21 | complement(308981..309316) | hypothetical protein; UMNK88_298 | N/A | Click |
| 22 | 309467..309817 | PHAGE_Entero_SfV: hypothetical protein SfVp53; UMNK88_299; phage(gi19549040) | 3e-61 | Click |
| 23 | 309943..310437 | PHAGE_Entero_SfV: small terminase subunit; UMNK88_300; phage(gi19548991) | 1e-91 | Click |
| 24 | 310434..312167 | PHAGE_Entero_SfV: large terminase subunit; UMNK88_301; phage(gi19548992) | 0.0 | Click |
| 25 | 312179..312361 | PHAGE_Salmon_ST64B: putative integral membrane protein; UMNK88_302; phage(gi23505448) | 1e-28 | Click |
| 26 | 312361..313602 | PHAGE_Salmon_ST64B: Portal Protein; UMNK88_303; phage(gi23505449) | 0.0 | Click |
| 27 | 313580..314230 | PHAGE_Salmon_ST64B: Pro-head protease; UMNK88_304; phage(gi23505450) | 6e-119 | Click |
| 28 | 314245..315450 | PHAGE_Salmon_ST64B: Major capsid protein precursor; UMNK88_305; phage(gi23505451) | 0.0 | Click |
| 29 | 315500..315700 | PHAGE_Salmon_ST64B: hypothetical protein sb7; UMNK88_306; phage(gi23505452) | 2e-24 | Click |
| 30 | 315703..316026 | PHAGE_Entero_SfV: hypothetical protein SfVp06; UMNK88_307; phage(gi19548996) | 2e-34 | Click |
| 31 | 316023..316433 | PHAGE_Entero_SfV: hypothetical protein SfVp07; UMNK88_308; phage(gi19548997) | 1e-50 | Click |
| 32 | 316408..316914 | PHAGE_Entero_SfV: hypothetical protein SfVp08; UMNK88_309; phage(gi19548998) | 4e-87 | Click |
| 33 | 316911..317471 | PHAGE_Entero_SfV: hypothetical protein SfVp09; UMNK88_310; phage(gi19548999) | 3e-105 | Click |
| 34 | 317480..317650 | PHAGE_Entero_SfV: hypothetical protein SfVp10; UMNK88_311; phage(gi19549000) | 1e-27 | Click |
| 35 | 317634..319130 | PHAGE_Entero_SfV: tail sheath protein; UMNK88_312; phage(gi19549001) | 0.0 | Click |
| 36 | 319130..319486 | PHAGE_Entero_SfV: hypothetical protein SfVp12; UMNK88_313; phage(gi19549002) | 3e-65 | Click |
| 37 | 319486..319755 | PHAGE_Entero_SfV: hypothetical protein SfVp13; UMNK88_314; phage(gi19549003) | 4e-44 | Click |
| 38 | 319722..319904 | conserved hypothetical protein; UMNK88_315 | N/A | Click |
| 39 | 319897..321729 | PHAGE_Entero_SfV: tail protein; UMNK88_316; phage(gi19549004) | 0.0 | Click |
| 40 | complement(321762..322163) | hypothetical protein; UMNK88_317 | N/A | Click |
| 41 | 322319..323647 | PHAGE_Entero_SfV: tail/DNA circulation protein; UMNK88_318; phage(gi19549005) | 0.0 | Click |
| 42 | 323644..324723 | PHAGE_Entero_SfV: tail protein; UMNK88_319; phage(gi19549006) | 0.0 | Click |
| 43 | 324723..325271 | PHAGE_Entero_SfV: tail protein; UMNK88_320; phage(gi19549007) | 4e-96 | Click |
| 44 | 325271..325696 | PHAGE_Entero_SfV: tail protein; UMNK88_321; phage(gi19549008) | 2e-81 | Click |
| 45 | 325683..326741 | PHAGE_Entero_SfV: tail protein; UMNK88_322; phage(gi19549009) | 0.0 | Click |
| 46 | 326732..327316 | PHAGE_Entero_SfV: tail protein; UMNK88_323; phage(gi19548988) | 1e-113 | Click |
| 47 | 327320..328066 | PHAGE_Entero_SfV: hypothetical protein SfVp21; UMNK88_324; phage(gi19548989) | 2e-51 | Click |
| 48 | 328066..328659 | PHAGE_Entero_HK106: tail fiber assembly protein; UMNK88_326; phage(gi428783304) | 4e-64 | Click |
| 49 | complement(328631..329074) | PHAGE_Entero_mEp213: tail fiber assembly protein; UMNK88_325; phage(gi428782612) | 2e-25 | Click |
| 50 | complement(329095..329442) | PHAGE_Entero_SfV: hypothetical protein SfVp21; UMNK88_327; phage(gi19548989) | 4e-05 | Click |
| 51 | 329536..330090 | PHAGE_Entero_2: DNA-invertase; UMNK88_328; phage(gi169936026) | 8e-89 | Click |
| 52 | complement(330311..333121) | PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; UMNK88_329; phage(gi9631364) | 3e-10 | Click |
| 53 | 333562..333617 | attR ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA | N/A | Click |
Region 2, total : 51 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 913695..913708 | attL AACAAAAAACCCAT | N/A | Click |
| 2 | complement(914299..915315) | PHAGE_Entero_2: P2 Int-like protein; UMNK88_889; phage(gi169936064) | 1e-100 | Click |
| 3 | 916404..916625 | PHAGE_Pasteu_F108: Cox; UMNK88_890; phage(gi109302900) | 2e-05 | Click |
| 4 | 916658..917167 | PHAGE_Entero_2: bacteriophage regulatory protein CII; UMNK88_891; phage(gi169936061) | 1e-83 | Click |
| 5 | 917175..917375 | PHAGE_Entero_2: hypothetical protein STM2735.Fels2; UMNK88_892; phage(gi169936060) | 8e-14 | Click |
| 6 | 917339..917680 | PHAGE_Entero_2: hypothetical protein STM2733.Fels2; UMNK88_893; phage(gi169936058) | 3e-51 | Click |
| 7 | 917748..917981 | PHAGE_Entero_2: hypothetical protein STM2732.Fels2; UMNK88_894; phage(gi169936057) | 6e-28 | Click |
| 8 | 917981..918208 | PHAGE_Entero_2: P2 gpOrf82-like protein; UMNK88_895; phage(gi169936056) | 6e-34 | Click |
| 9 | 918205..919059 | PHAGE_Entero_2: DNA adenine methylase-like protein; UMNK88_896; phage(gi169936055) | 1e-118 | Click |
| 10 | 919065..919886 | PHAGE_Entero_HK106: hypothetical protein; UMNK88_897; phage(gi428783308) | 5e-49 | Click |
| 11 | 919886..922258 | PHAGE_Entero_2: P2 gpA-like protein; UMNK88_898; phage(gi169936054) | 0.0 | Click |
| 12 | 922411..922599 | PHAGE_Entero_2: hypothetical protein STM2728.Fels2; UMNK88_899; phage(gi169936053) | 6e-29 | Click |
| 13 | 922610..922843 | PHAGE_Entero_2: TumB protein; UMNK88_901; phage(gi169936052) | 2e-38 | Click |
| 14 | complement(922835..922981) | hypothetical protein; UMNK88_900 | N/A | Click |
| 15 | 923086..923214 | hypothetical protein; UMNK88_902 | N/A | Click |
| 16 | 923299..924249 | conserved hypothetical protein; UMNK88_903 | N/A | Click |
| 17 | 924251..924787 | hypothetical protein; UMNK88_904 | N/A | Click |
| 18 | 924894..925043 | conserved hypothetical protein; UMNK88_905 | N/A | Click |
| 19 | 925155..926936 | PHAGE_Entero_RB49: hypothetical protein RB49p187; UMNK88_906; phage(gi33620548) | 1e-07 | Click |
| 20 | complement(926977..928002) | PHAGE_Entero_2: P2 gpQ-like protein; UMNK88_907; phage(gi169936049) | 2e-168 | Click |
| 21 | complement(928002..929768) | PHAGE_Entero_2: P2 gpP-like protein; UMNK88_908; phage(gi169936048) | 0.0 | Click |
| 22 | 929911..930744 | PHAGE_Entero_2: P2 gpO-like protein; UMNK88_909; phage(gi169936047) | 4e-131 | Click |
| 23 | 930761..931819 | PHAGE_Entero_2: P2 gpN-like major capsid protein; UMNK88_910; phage(gi169936046) | 1e-178 | Click |
| 24 | 931823..932473 | PHAGE_Entero_2: P2 gpM-like protein; UMNK88_911; phage(gi169936045) | 3e-113 | Click |
| 25 | 932569..933033 | PHAGE_Entero_2: P2 gpL-like protein; UMNK88_912; phage(gi169936044) | 5e-79 | Click |
| 26 | 933033..933236 | PHAGE_Entero_2: P2 gpX-like tail protein; UMNK88_913; phage(gi169936043) | 1e-32 | Click |
| 27 | 933240..933455 | PHAGE_Entero_2: lysis protein; UMNK88_914; phage(gi169936042) | 6e-29 | Click |
| 28 | 933436..933948 | PHAGE_Entero_2: endolysin; UMNK88_915; phage(gi169936041) | 1e-81 | Click |
| 29 | 933950..934327 | conserved hypothetical protein; UMNK88_916 | N/A | Click |
| 30 | 934324..934752 | PHAGE_Entero_2: P2 LysB-like protein; UMNK88_917; phage(gi169936038) | 6e-57 | Click |
| 31 | 934712..934885 | PHAGE_Entero_2: P2 LysC-like protein; UMNK88_918; phage(gi169936037) | 2e-19 | Click |
| 32 | 934848..935279 | PHAGE_Entero_2: P2 gpR-like tail completion protein; UMNK88_919; phage(gi169936036) | 2e-71 | Click |
| 33 | 935272..935718 | PHAGE_Entero_2: P2 gpS-like tail completion protein; UMNK88_920; phage(gi169936035) | 7e-72 | Click |
| 34 | 935787..936365 | PHAGE_Entero_2: P2 gpV-like protein; UMNK88_921; phage(gi169936034) | 2e-96 | Click |
| 35 | 936362..936721 | PHAGE_Entero_2: P2 gpW-like baseplate protein; UMNK88_922; phage(gi169936033) | 1e-50 | Click |
| 36 | 936708..937616 | PHAGE_Entero_2: P2 gpJ-like baseplate assembly protein; UMNK88_923; phage(gi169936032) | 6e-148 | Click |
| 37 | 937609..938214 | PHAGE_Entero_2: P2 gpI-like baseplate assembly protein; UMNK88_924; phage(gi169936031) | 6e-112 | Click |
| 38 | 938211..939740 | PHAGE_Entero_2: P2 gpH-like protein; UMNK88_925; phage(gi169936030) | 2e-120 | Click |
| 39 | 939740..940342 | PHAGE_Entero_HK106: tail fiber assembly protein; UMNK88_927; phage(gi428783304) | 9e-100 | Click |
| 40 | complement(940314..940757) | PHAGE_Entero_mEp213: tail fiber assembly protein; UMNK88_926; phage(gi428782612) | 2e-25 | Click |
| 41 | complement(940778..940942) | phage tail fiber protein; UMNK88_928 | N/A | Click |
| 42 | 940941..941105 | hypothetical protein; UMNK88_929 | N/A | Click |
| 43 | 941219..941785 | PHAGE_Entero_2: DNA-invertase; UMNK88_931; phage(gi169936026) | 3e-87 | Click |
| 44 | complement(941743..941883) | conserved hypothetical protein; UMNK88_930 | N/A | Click |
| 45 | 941928..943100 | PHAGE_Entero_2: P2 gpFI-like protein; UMNK88_932; phage(gi169936025) | 0.0 | Click |
| 46 | 943110..943625 | PHAGE_Entero_2: P2 gpFII-like protein; UMNK88_933; phage(gi169936024) | 4e-91 | Click |
| 47 | 943680..943982 | PHAGE_Entero_2: P2 gpE-like tail protein; UMNK88_934; phage(gi169936023) | 2e-44 | Click |
| 48 | 943997..944116 | PHAGE_Entero_2: P2 gpE-like protein; UMNK88_935; phage(gi169936022) | 1e-14 | Click |
| 49 | 944109..947186 | PHAGE_Entero_2: P2 gpT-like tail protein; UMNK88_936; phage(gi169936021) | 0.0 | Click |
| 50 | 947183..947668 | PHAGE_Entero_2: P2 gpU-like tail protein; UMNK88_937; phage(gi169936020) | 5e-75 | Click |
| 51 | 947665..948765 | PHAGE_Entero_2: P2 gpD-like tail protein; UMNK88_938; phage(gi169936019) | 0.0 | Click |
| 52 | 948856..949074 | PHAGE_Entero_2: P2 gpOgr-like protein (acttivation of late gene expression); UMNK88_939; phage(gi169936018) | 2e-22 | Click |
| 53 | 949152..949165 | attR AACAAAAAACCCAT | N/A | Click |
Region 3, total : 33 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1004930..1005190) | PHAGE_Yersin_413C: Ogr; UMNK88_995; phage(gi30065732) | 1e-07 | Click |
| 2 | complement(1005233..1006333) | PHAGE_Salmon_RE_2010: gene D protein; UMNK88_996; phage(gi418489726) | 3e-97 | Click |
| 3 | complement(1006380..1006511) | conserved hypothetical protein; UMNK88_997 | N/A | Click |
| 4 | 1006491..1007675 | PHAGE_Erwini_ENT90: tail sheath protein; UMNK88_998; phage(gi431810939) | 3e-102 | Click |
| 5 | 1007675..1008187 | PHAGE_Salmon_RE_2010: major tail tube protein; UMNK88_999; phage(gi418489721) | 1e-33 | Click |
| 6 | 1008242..1008610 | PROPHAGE_Salmon_Ty2: putative phage tail protein; UMNK88_1000; phage(gi29143760) | 3e-07 | Click |
| 7 | 1008646..1008774 | PHAGE_Burkho_phiE202: gp27, phage tail protein, P2 GpE family; UMNK88_1001; phage(gi134288776) | 1e-05 | Click |
| 8 | 1008839..1011562 | PHAGE_Vibrio_vB_VpaM_MAR: tail length tape-measure protein; UMNK88_1002; phage(gi428782750) | 5e-110 | Click |
| 9 | 1011574..1012062 | PHAGE_Salmon_RE_2010: tail protein; UMNK88_1003; phage(gi418489725) | 5e-38 | Click |
| 10 | complement(1012091..1012690) | PHAGE_Entero_2: DNA-invertase; UMNK88_1004; phage(gi169936026) | 3e-80 | Click |
| 11 | 1013107..1013550 | PHAGE_Entero_mEp213: tail fiber assembly protein; UMNK88_1006; phage(gi428782612) | 1e-25 | Click |
| 12 | complement(1013522..1014124) | PHAGE_Entero_HK106: tail fiber assembly protein; UMNK88_1005; phage(gi428783304) | 3e-97 | Click |
| 13 | complement(1014124..1014354) | phage tail fiber protein; UMNK88_1007 | N/A | Click |
| 14 | complement(1014351..1014488) | hypothetical protein; UMNK88_1008 | N/A | Click |
| 15 | complement(1014495..1015625) | PHAGE_Salmon_RE_2010: tail fiber protein; UMNK88_1009; phage(gi418489713) | 4e-95 | Click |
| 16 | complement(1015622..1016230) | PHAGE_Salmon_RE_2010: tail protein I; UMNK88_1010; phage(gi418489712) | 3e-63 | Click |
| 17 | complement(1016223..1017119) | PHAGE_Salmon_RE_2010: baseplate assembly protein J; UMNK88_1011; phage(gi418489711) | 4e-84 | Click |
| 18 | complement(1017123..1017473) | PHAGE_Erwini_ENT90: baseplate assembly protein; UMNK88_1012; phage(gi431810974) | 7e-24 | Click |
| 19 | complement(1017470..1018051) | PHAGE_Salmon_RE_2010: baseplate assembly protein V; UMNK88_1013; phage(gi418489709) | 2e-36 | Click |
| 20 | complement(1018048..1018212) | PHAGE_Burkho_KS14: gp23; UMNK88_1014; phage(gi327198292) | 5e-06 | Click |
| 21 | complement(1018264..1019151) | PROPHAGE_Escher_Sakai: putative transposase; UMNK88_1015; phage(gi15834498) | 2e-172 | Click |
| 22 | complement(1019532..1019978) | PHAGE_Salmon_RE_2010: tail completion protein; UMNK88_1016; phage(gi418489707) | 5e-06 | Click |
| 23 | complement(1019992..1020459) | PHAGE_Ralsto_phiRSA1: tail completion protein-like protein; UMNK88_1017; phage(gi145708090) | 2e-19 | Click |
| 24 | complement(1020597..1021004) | conserved hypothetical protein; UMNK88_1018 | N/A | Click |
| 25 | complement(1021001..1021393) | PHAGE_Entero_phiP27: putative endolysin; UMNK88_1019; phage(gi18249894) | 1e-53 | Click |
| 26 | complement(1021390..1021713) | PHAGE_Aeromo_phiO18P: putative holin; UMNK88_1020; phage(gi148727161) | 1e-09 | Click |
| 27 | complement(1021716..1021916) | PHAGE_Salmon_RE_2010: tail component protein; UMNK88_1021; phage(gi418489702) | 4e-12 | Click |
| 28 | complement(1021916..1022410) | PHAGE_Burkho_2: gp50, phage head completion protein (GPL); UMNK88_1022; phage(gi134288689) | 1e-25 | Click |
| 29 | complement(1022513..1023313) | PHAGE_Salmon_RE_2010: terminase endonuclease subunit; UMNK88_1023; phage(gi418489700) | 4e-33 | Click |
| 30 | complement(1023359..1024411) | PHAGE_Salmon_RE_2010: major capsid protein; UMNK88_1024; phage(gi418489699) | 1e-74 | Click |
| 31 | complement(1024435..1025271) | PHAGE_Salmon_RE_2010: capsid scaffolding protein; UMNK88_1025; phage(gi418489698) | 3e-45 | Click |
| 32 | 1025426..1027177 | PHAGE_Burkho_KS5: gp42; UMNK88_1026; phage(gi327198040) | 9e-138 | Click |
| 33 | 1027177..1028223 | PHAGE_Salmon_RE_2010: capsid packaging protein; UMNK88_1027; phage(gi418489696) | 6e-91 | Click |
Region 4, total : 15 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1249977..1252658 | PHAGE_Porcin_virus: Pol1; UMNK88_1258; phage(gi19387582) | 2e-08 | Click |
| 2 | complement(1252803..1252931) | conserved hypothetical protein; UMNK88_1259 | N/A | Click |
| 3 | 1253159..1254391 | PHAGE_Lactob_AQ113: phosphoadenosine phosphosulfate reductase; UMNK88_1260; phage(gi446730264) | 5e-54 | Click |
| 4 | 1254376..1255014 | PHAGE_Lactob_AQ113: co-activator of prophage gene expression; UMNK88_1261; phage(gi446730265) | 7e-31 | Click |
| 5 | 1255093..1255362 | transcriptional activator protein PerC; UMNK88_1262 | N/A | Click |
| 6 | 1255386..1256027 | conserved hypothetical protein; UMNK88_1263 | N/A | Click |
| 7 | 1256386..1256685 | conserved hypothetical protein; UMNK88_1264 | N/A | Click |
| 8 | complement(1256725..1256973) | PROPHAGE_Escher_EDL933: partial transposase; UMNK88_1265; phage(gi15801133) | 1e-43 | Click |
| 9 | 1257090..1257452 | PHAGE_Stx2_c_1717: truncated transposase; UMNK88_1266; phage(gi209447151) | 4e-11 | Click |
| 10 | complement(1257752..1257934) | conserved hypothetical protein; UMNK88_1267 | N/A | Click |
| 11 | complement(1257996..1259567) | PHAGE_Stx2_c_1717: transposase; UMNK88_1268; phage(gi209447153) | 6e-171 | Click |
| 12 | complement(1259587..1259934) | PHAGE_Stx2_c_1717: transposase; UMNK88_1269; phage(gi209447152) | 6e-46 | Click |
| 13 | complement(1259934..1260584) | PHAGE_Stx2_c_1717: truncated transposase; UMNK88_1270; phage(gi209447151) | 7e-18 | Click |
| 14 | 1260913..1261830 | conserved hypothetical protein; UMNK88_1271 | N/A | Click |
| 15 | 1263160..1266009 | PHAGE_Synech_S_CBS4: tail fiber protein; UMNK88_1274; phage(gi374531790) | 9e-13 | Click |
Region 5, total : 39 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1365133..1365144 | attL TCGCCACAAAAC | N/A | Click |
| 2 | complement(1365453..1366571) | PHAGE_Entero_mEp235: integrase; UMNK88_1398; phage(gi428781836) | 8e-52 | Click |
| 3 | complement(1366540..1366809) | conserved hypothetical protein; UMNK88_1399 | N/A | Click |
| 4 | complement(1366871..1368370) | PHAGE_Entero_mEp460: putative exonuclease; UMNK88_1400; phage(gi428782342) | 4e-59 | Click |
| 5 | complement(1368361..1369341) | conserved hypothetical protein; UMNK88_1401 | N/A | Click |
| 6 | complement(1369434..1369625) | conserved hypothetical protein; UMNK88_1402 | N/A | Click |
| 7 | complement(1369622..1369810) | division inhibition protein DicB; UMNK88_1403 | N/A | Click |
| 8 | 1370373..1370606 | conserved hypothetical protein; UMNK88_1405 | N/A | Click |
| 9 | complement(1370584..1370991) | PHAGE_Escher_TL_2011c: hypothetical protein; UMNK88_1404; phage(gi418487085) | 1e-10 | Click |
| 10 | complement(1371014..1371232) | conserved hypothetical protein; UMNK88_1406 | N/A | Click |
| 11 | complement(1371304..1371660) | conserved hypothetical protein; UMNK88_1407 | N/A | Click |
| 12 | complement(1371930..1372403) | PHAGE_Entero_c_1: prophage repressor; UMNK88_1408; phage(gi428781782) | 8e-27 | Click |
| 13 | 1372742..1373140 | PHAGE_Pectob_ZF40: putative cII repressor; UMNK88_1409; phage(gi422936652) | 2e-06 | Click |
| 14 | 1373212..1374282 | PHAGE_Entero_phiP27: hypothetical protein P27p17; UMNK88_1410; phage(gi18249881) | 1e-28 | Click |
| 15 | 1374323..1374748 | conserved hypothetical protein; UMNK88_1411 | N/A | Click |
| 16 | 1374745..1374945 | PHAGE_Entero_HK106: hypothetical protein; UMNK88_1412; phage(gi428783312) | 3e-15 | Click |
| 17 | 1375107..1375223 | conserved hypothetical protein; UMNK88_1413 | N/A | Click |
| 18 | 1375216..1375392 | PHAGE_Shigel_AG3: hypothetical protein; UMNK88_1414; phage(gi282599330) | 7e-13 | Click |
| 19 | 1375389..1375904 | PHAGE_Salmon_ST64B: hypothetical protein sb32; UMNK88_1415; phage(gi23505476) | 2e-11 | Click |
| 20 | complement(1377438..1377551) | conserved hypothetical protein; UMNK88_1416 | N/A | Click |
| 21 | 1377823..1378872 | PHAGE_Entero_mEp460: hypothetical protein; UMNK88_1417; phage(gi428782365) | 1e-108 | Click |
| 22 | 1378885..1379244 | PHAGE_Escher_HK75: RusA-like protein; UMNK88_1418; phage(gi356870726) | 3e-40 | Click |
| 23 | 1379241..1379930 | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; UMNK88_1419; phage(gi169257244) | 1e-78 | Click |
| 24 | 1380125..1380200 | tRNA | N/A | Click |
| 25 | 1380202..1380278 | tRNA | N/A | Click |
| 26 | 1380281..1380357 | tRNA | N/A | Click |
| 27 | 1380361..1380435 | tRNA | N/A | Click |
| 28 | 1381094..1381486 | PHAGE_Entero_phiP27: putative holin; UMNK88_1424; phage(gi18249892) | 1e-66 | Click |
| 29 | 1381476..1381751 | PHAGE_Entero_phiP27: putative holin; UMNK88_1425; phage(gi18249893) | 1e-46 | Click |
| 30 | 1381754..1382131 | PHAGE_Entero_phiP27: putative endolysin; UMNK88_1426; phage(gi18249894) | 8e-67 | Click |
| 31 | 1382371..1382721 | PHAGE_Entero_phiP27: hypothetical protein P27p34; UMNK88_1427; phage(gi18249898) | 6e-58 | Click |
| 32 | 1383032..1383352 | PHAGE_Entero_mEp235: terminase small subunit; UMNK88_1428; phage(gi428781811) | 1e-47 | Click |
| 33 | 1383352..1385109 | PHAGE_Entero_phiP27: putative terminase; UMNK88_1429; phage(gi18249900) | 1e-96 | Click |
| 34 | 1385121..1385303 | PHAGE_Entero_phiP27: putative integral membrane protein; UMNK88_1430; phage(gi18249901) | 6e-22 | Click |
| 35 | 1385303..1386544 | PHAGE_Entero_phiP27: putative portal protein; UMNK88_1431; phage(gi18249902) | 0.0 | Click |
| 36 | 1386522..1387172 | PHAGE_Entero_phiP27: putative prohead protease; UMNK88_1432; phage(gi18249903) | 1e-120 | Click |
| 37 | 1387187..1388410 | PHAGE_Entero_phiP27: putative major capsid protein; UMNK88_1433; phage(gi18249904) | 0.0 | Click |
| 38 | 1388456..1388773 | PHAGE_Entero_phiP27: hypothetical protein P27p41; UMNK88_1434; phage(gi18249905) | 2e-19 | Click |
| 39 | 1388782..1389120 | PHAGE_Entero_HK97: putative head-tail adaptor; UMNK88_1435; phage(gi9634168) | 3e-33 | Click |
| 40 | 1389120..1389566 | PHAGE_Entero_HK97: Gp10; UMNK88_1436; phage(gi9634169) | 7e-64 | Click |
| 41 | 1389563..1389907 | PHAGE_Cronob_ENT39118: putative minor tail protein; UMNK88_1437; phage(gi431811079) | 4e-32 | Click |
| 42 | 1389967..1390671 | PHAGE_Entero_mEp234: major tail subunit; UMNK88_1438; phage(gi428782264) | 1e-93 | Click |
| 43 | 1390686..1391057 | PHAGE_Stx2_c_1717: putative tail assembly chaperone; UMNK88_1439; phage(gi209447188) | 6e-42 | Click |
| 44 | 1390733..1390744 | attR TCGCCACAAAAC | N/A | Click |
| 45 | 1391069..1391359 | PHAGE_Entero_HK544: tail protein; UMNK88_1440; phage(gi428783227) | 6e-30 | Click |
Region 6, total : 44 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1616731..1616743 | attL GCGTGGCAATTTT | N/A | Click |
| 2 | 1616951..1618219 | PHAGE_Salmon_vB_SosS_Oslo: integrase; UMNK88_1674; phage(gi399528791) | 6e-99 | Click |
| 3 | complement(1618177..1618395) | hypothetical protein; UMNK88_1673 | N/A | Click |
| 4 | complement(1618395..1619054) | hypothetical protein; UMNK88_1675 | N/A | Click |
| 5 | complement(1619069..1619248) | hypothetical protein; UMNK88_1676 | N/A | Click |
| 6 | complement(1619245..1619640) | PHAGE_Entero_HK022: Protein Nin B; UMNK88_1677; phage(gi19343391) | 2e-37 | Click |
| 7 | complement(1619673..1619870) | hypothetical protein; UMNK88_1678 | N/A | Click |
| 8 | complement(1619880..1620086) | hypothetical protein; UMNK88_1679 | N/A | Click |
| 9 | complement(1620083..1620640) | conserved hypothetical protein; UMNK88_1680 | N/A | Click |
| 10 | complement(1620720..1622141) | PHAGE_Salmon_SPN9CC: replicative DNA helicase; UMNK88_1681; phage(gi389060513) | 2e-144 | Click |
| 11 | complement(1622160..1623278) | PHAGE_Entero_TLS: gp66; UMNK88_1682; phage(gi148734539) | 6e-145 | Click |
| 12 | complement(1623312..1624031) | PHAGE_Salmon_vB_SenS_Ent1: putative DNA-binding protein; UMNK88_1683; phage(gi423261866) | 3e-47 | Click |
| 13 | complement(1624398..1625465) | PHAGE_Vibrio_VBM1: hypothetical protein; UMNK88_1684; phage(gi472340790) | 2e-15 | Click |
| 14 | complement(1625469..1625711) | PHAGE_Entero_mEp460: replication protein; UMNK88_1685; phage(gi428782359) | 1e-05 | Click |
| 15 | 1626031..1626678 | PHAGE_Entero_IME10: repressor protein; UMNK88_1686; phage(gi422934295) | 5e-35 | Click |
| 16 | complement(1627039..1627158) | conserved hypothetical protein; UMNK88_1687 | N/A | Click |
| 17 | 1627182..1627472 | hypothetical protein; UMNK88_1688 | N/A | Click |
| 18 | 1627503..1627622 | hypothetical protein; UMNK88_1689 | N/A | Click |
| 19 | 1627622..1628257 | PHAGE_Salmon_vB_SosS_Oslo: essential recombination function Erf; UMNK88_1690; phage(gi399528800) | 1e-59 | Click |
| 20 | 1628257..1628673 | PHAGE_Aeromo_vB_AsaM_56: putative single-strand DNA binding protein; UMNK88_1691; phage(gi422937500) | 2e-31 | Click |
| 21 | 1628690..1628968 | PHAGE_Entero_mEp235: Abc2 protein; UMNK88_1692; phage(gi428781839) | 4e-05 | Click |
| 22 | 1628983..1629207 | conserved hypothetical protein; UMNK88_1693 | N/A | Click |
| 23 | 1629204..1629317 | hypothetical protein; UMNK88_1694 | N/A | Click |
| 24 | 1629326..1629448 | conserved hypothetical protein; UMNK88_1695 | N/A | Click |
| 25 | 1629445..1629717 | hypothetical protein; UMNK88_1696 | N/A | Click |
| 26 | 1629708..1629899 | hypothetical protein; UMNK88_1697 | N/A | Click |
| 27 | 1630054..1630221 | hypothetical protein; UMNK88_1698 | N/A | Click |
| 28 | 1630235..1630855 | conserved hypothetical protein; UMNK88_1699 | N/A | Click |
| 29 | 1630955..1631173 | hypothetical protein; UMNK88_1700 | N/A | Click |
| 30 | 1631272..1631463 | hypothetical protein; UMNK88_1701 | N/A | Click |
| 31 | 1631453..1631656 | hypothetical protein; UMNK88_1702 | N/A | Click |
| 32 | 1631658..1631894 | DNA translocase FtsK; UMNK88_1703 | N/A | Click |
| 33 | 1631897..1632130 | PHAGE_Entero_TLS: gp24; UMNK88_1704; phage(gi148734496) | 7e-10 | Click |
| 34 | 1632140..1632679 | PHAGE_Entero_IME10: hypothetical protein; UMNK88_1705; phage(gi422934273) | 2e-31 | Click |
| 35 | 1632672..1633163 | PHAGE_Shigel_EP23: hypothetical protein; UMNK88_1706; phage(gi371496294) | 2e-14 | Click |
| 36 | 1633144..1633647 | conserved hypothetical protein; UMNK88_1707 | N/A | Click |
| 37 | 1633689..1634432 | PHAGE_Entero_TLS: Dcm; UMNK88_1708; phage(gi148734547) | 7e-79 | Click |
| 38 | 1634783..1635388 | PHAGE_Entero_HK630: NinG protein; UMNK88_1709; phage(gi428782844) | 9e-52 | Click |
| 39 | 1635385..1635792 | PHAGE_Cronob_ENT47670: endodeoxyribonuclease RUS; UMNK88_1710; phage(gi431810529) | 1e-37 | Click |
| 40 | 1635789..1635971 | hypothetical protein; UMNK88_1711 | N/A | Click |
| 41 | 1635971..1636699 | PHAGE_Salmon_SE1: Gp23; UMNK88_1712; phage(gi219681234) | 4e-47 | Click |
| 42 | 1636699..1636902 | hypothetical protein; UMNK88_1713 | N/A | Click |
| 43 | 1636889..1637236 | PHAGE_Acinet_AP22: hypothetical protein; UMNK88_1714; phage(gi388570774) | 4e-06 | Click |
| 44 | 1637382..1637495 | hypothetical protein; UMNK88_1715 | N/A | Click |
| 45 | 1637485..1637796 | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_1716; phage(gi399498820) | 2e-27 | Click |
| 46 | 1640165..1640177 | attR GCGTGGCAATTTT | N/A | Click |
Region 7, total : 39 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1642122..1642253 | PHAGE_Shigel_EP23: hypothetical protein; UMNK88_1733; phage(gi371496311) | 9e-08 | Click |
| 2 | 1642246..1642446 | conserved hypothetical protein; UMNK88_1734 | N/A | Click |
| 3 | 1642436..1642633 | hypothetical protein; UMNK88_1736 | N/A | Click |
| 4 | complement(1642600..1642812) | hypothetical protein; UMNK88_1735 | N/A | Click |
| 5 | 1642772..1642939 | PHAGE_Salmon_vB_SosS_Oslo: class II holin; UMNK88_1737; phage(gi399528833) | 3e-06 | Click |
| 6 | 1642941..1643432 | PHAGE_Salmon_vB_SemP_Emek: lysin; UMNK88_1738; phage(gi399498856) | 2e-56 | Click |
| 7 | 1643420..1643890 | PHAGE_Entero_mEp235: lysis protein Rz; UMNK88_1739; phage(gi428781868) | 7e-18 | Click |
| 8 | 1644169..1644711 | PHAGE_Salmon_ST160: hypotthetical protein; UMNK88_1740; phage(gi318065947) | 1e-21 | Click |
| 9 | 1644767..1644901 | hypothetical protein; UMNK88_1741 | N/A | Click |
| 10 | 1645085..1645243 | hypothetical protein; UMNK88_1742 | N/A | Click |
| 11 | 1645636..1646121 | PHAGE_Entero_Sf6: gene 1 protein; UMNK88_1743; phage(gi41057279) | 1e-24 | Click |
| 12 | 1646481..1647602 | PHAGE_Strept_6: terminase large subunit; UMNK88_1744; phage(gi93007440) | 1e-27 | Click |
| 13 | 1647681..1649054 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1745; phage(gi423262380) | 3e-149 | Click |
| 14 | 1649071..1649940 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1746; phage(gi423262381) | 7e-74 | Click |
| 15 | 1649921..1651213 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1747; phage(gi423262382) | 6e-107 | Click |
| 16 | 1651230..1651601 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1748; phage(gi423262383) | 3e-23 | Click |
| 17 | 1651619..1652668 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1749; phage(gi423262384) | 2e-101 | Click |
| 18 | 1652736..1653122 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1750; phage(gi423262386) | 1e-41 | Click |
| 19 | 1653125..1653310 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1751; phage(gi423262387) | 1e-09 | Click |
| 20 | 1653303..1653671 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1752; phage(gi423262388) | 3e-30 | Click |
| 21 | 1653869..1654114 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1753; phage(gi423262389) | 1e-22 | Click |
| 22 | 1654111..1654497 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1754; phage(gi423262390) | 5e-43 | Click |
| 23 | 1654510..1654986 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1755; phage(gi423262391) | 4e-57 | Click |
| 24 | 1655118..1655720 | PHAGE_Salmon_SPN3UB: hypothetical protein; UMNK88_1756; phage(gi423262392) | 2e-38 | Click |
| 25 | complement(1655735..1655998) | hypothetical protein; UMNK88_1757 | N/A | Click |
| 26 | 1656507..1658846 | PHAGE_Salmon_SPN3UB: putative tape measure protein; UMNK88_1758; phage(gi423262407) | 2e-81 | Click |
| 27 | complement(1658879..1659058) | hypothetical protein; UMNK88_1759 | N/A | Click |
| 28 | complement(1659386..1659640) | hypothetical protein; UMNK88_1760 | N/A | Click |
| 29 | complement(1660462..1660710) | hypothetical protein; UMNK88_1761 | N/A | Click |
| 30 | 1660709..1660849 | hypothetical protein; UMNK88_1762 | N/A | Click |
| 31 | complement(1660971..1661153) | hypothetical protein; UMNK88_1763 | N/A | Click |
| 32 | complement(1661293..1661496) | hypothetical protein; UMNK88_1764 | N/A | Click |
| 33 | complement(1661519..1661743) | hypothetical protein; UMNK88_1765 | N/A | Click |
| 34 | 1662238..1663065 | PHAGE_Salmon_SPN3UB: putative tail assembly protein K; UMNK88_1766; phage(gi423262412) | 4e-83 | Click |
| 35 | 1663098..1663538 | PHAGE_Salmon_SPN3UB: putative tail assembly protein I; UMNK88_1767; phage(gi423262413) | 3e-41 | Click |
| 36 | 1663553..1668595 | PHAGE_Salmon_SPN3UB: host specificity protein J; UMNK88_1768; phage(gi423262414) | 0.0 | Click |
| 37 | 1669306..1669590 | PHAGE_Escher_HK75: hypothetical membrane associated protein; UMNK88_1770; phage(gi356870699) | 1e-18 | Click |
| 38 | complement(1669587..1669826) | PHAGE_Entero_2009a: phage superinfection exclusion protein; UMNK88_1769; phage(gi225220090) | 5e-19 | Click |
| 39 | 1669986..1672511 | PHAGE_Entero_mEp460: side tail fiber protein; UMNK88_1771; phage(gi428782336) | 2e-68 | Click |
Region 8, total : 41 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1899408..1899611 | PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; UMNK88_1968; phage(gi410491512) | 1e-13 | Click |
| 2 | complement(1899647..1901107) | PHAGE_Microm_MpV1: hypothetical protein; UMNK88_1969; phage(gi313768442) | 2e-41 | Click |
| 3 | complement(1901196..1902479) | PHAGE_Burkho_phi1026b: gp59; UMNK88_1970; phage(gi38707949) | 1e-33 | Click |
| 4 | 1903338..1903496 | conserved hypothetical protein; UMNK88_1971 | N/A | Click |
| 5 | 1903813..1904403 | PHAGE_Escher_D108: G region invertase; UMNK88_1972; phage(gi281199698) | 8e-26 | Click |
| 6 | complement(1904501..1905076) | PHAGE_Entero_HK629: tail fiber assembly protein; UMNK88_1973; phage(gi428782036) | 1e-104 | Click |
| 7 | complement(1905076..1906818) | PHAGE_Entero_HK629: tail fiber; UMNK88_1974; phage(gi428782035) | 1e-86 | Click |
| 8 | 1906889..1907686 | PHAGE_Entero_lambda: hypothetical protein lambdap90; UMNK88_1976; phage(gi9626267) | 3e-54 | Click |
| 9 | 1908074..1908247 | PHAGE_Entero_4795: hypothetical protein PBV4795_ORF74; UMNK88_1977; phage(gi157166059) | 2e-29 | Click |
| 10 | complement(1908248..1908847) | PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; UMNK88_1978; phage(gi148609401) | 2e-106 | Click |
| 11 | complement(1908915..1912394) | PHAGE_Entero_HK629: tail fiber; UMNK88_1979; phage(gi428782032) | 0.0 | Click |
| 12 | complement(1912455..1913027) | PHAGE_Entero_HK629: tail component protein; UMNK88_1980; phage(gi428782031) | 4e-101 | Click |
| 13 | complement(1913024..1913623) | PHAGE_Entero_HK629: tail component protein; UMNK88_1981; phage(gi428782030) | 7e-118 | Click |
| 14 | complement(1913772..1914470) | PHAGE_Entero_HK629: minor tail protein; UMNK88_1982; phage(gi428782029) | 5e-134 | Click |
| 15 | complement(1914470..1914799) | PHAGE_Entero_HK629: minor tail protein; UMNK88_1983; phage(gi428782028) | 1e-58 | Click |
| 16 | complement(1914796..1917357) | PHAGE_Entero_HK629: tail length tape measure protein; UMNK88_1984; phage(gi428782027) | 0.0 | Click |
| 17 | complement(1917350..1917784) | PHAGE_Entero_HK629: tail assembly protein; UMNK88_1985; phage(gi428782026) | 1e-80 | Click |
| 18 | complement(1917766..1918188) | PHAGE_Entero_HK629: minor tail protein; UMNK88_1986; phage(gi428782025) | 1e-73 | Click |
| 19 | complement(1918204..1918944) | PHAGE_Entero_HK629: major tail protein; UMNK88_1987; phage(gi428782024) | 4e-136 | Click |
| 20 | complement(1918952..1919347) | PHAGE_Entero_HK629: minor tail protein; UMNK88_1988; phage(gi428782023) | 4e-71 | Click |
| 21 | complement(1919344..1919922) | PHAGE_Entero_HK629: minor tail protein; UMNK88_1989; phage(gi428782022) | 8e-100 | Click |
| 22 | complement(1919934..1920287) | PHAGE_Entero_HK629: head-tail connector Fii; UMNK88_1990; phage(gi428782021) | 2e-62 | Click |
| 23 | complement(1920299..1920697) | PHAGE_Entero_HK629: DNA packaging protein Fi; UMNK88_1991; phage(gi428782020) | 2e-62 | Click |
| 24 | complement(1920739..1921764) | PHAGE_Entero_HK629: major head subunit; UMNK88_1992; phage(gi428782019) | 0.0 | Click |
| 25 | complement(1921820..1922152) | PHAGE_Entero_HK629: head decoration protein; UMNK88_1993; phage(gi428782018) | 2e-57 | Click |
| 26 | complement(1922162..1923481) | PHAGE_Entero_HK629: head maturation protease; UMNK88_1994; phage(gi428782016) | 0.0 | Click |
| 27 | complement(1923462..1925063) | PHAGE_Entero_HK629: portal protein; UMNK88_1995; phage(gi428782015) | 0.0 | Click |
| 28 | complement(1925060..1925266) | PHAGE_Entero_HK629: head-tail connector; UMNK88_1996; phage(gi428782014) | 1e-31 | Click |
| 29 | complement(1925263..1927188) | PHAGE_Entero_HK629: terminase large subunit A; UMNK88_1997; phage(gi428782013) | 0.0 | Click |
| 30 | complement(1927163..1927708) | PHAGE_Entero_HK629: terminase small subunit nu1; UMNK88_1998; phage(gi428782012) | 7e-98 | Click |
| 31 | 1928157..1928330 | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; UMNK88_1999; phage(gi209427772) | 6e-10 | Click |
| 32 | complement(1928950..1929123) | conserved hypothetical protein; UMNK88_2000 | N/A | Click |
| 33 | complement(1929797..1930009) | PHAGE_Lactoc_bIL312: Csp; UMNK88_2001; phage(gi13095918) | 1e-15 | Click |
| 34 | complement(1930373..1930855) | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; UMNK88_2002; phage(gi16765210) | 1e-52 | Click |
| 35 | complement(1930867..1931400) | PHAGE_Entero_mEp460: endolysin; UMNK88_2003; phage(gi428782372) | 2e-97 | Click |
| 36 | complement(1931397..1931708) | PHAGE_Entero_mEp460: hypothetical protein; UMNK88_2004; phage(gi428782371) | 1e-29 | Click |
| 37 | complement(1931713..1931919) | PHAGE_Stx2_c_II: holin; UMNK88_2005; phage(gi302393164) | 3e-27 | Click |
| 38 | complement(1932682..1932897) | PHAGE_Lactoc_bIL312: Csp; UMNK88_2006; phage(gi13095918) | 5e-16 | Click |
| 39 | 1933198..1933410 | cold shock-like protein CspI; UMNK88_2007 | N/A | Click |
| 40 | complement(1933832..1934584) | PHAGE_Entero_SfV: antitermination protein Q; UMNK88_2008; phage(gi19549033) | 3e-137 | Click |
| 41 | complement(1934598..1935647) | PHAGE_Entero_mEp460: hypothetical protein; UMNK88_2009; phage(gi428782365) | 5e-114 | Click |
Region 9, total : 22 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2353941..2354522) | PHAGE_Entero_HK630: tail fiber assembly protein; UMNK88_2452; phage(gi428782810) | 8e-105 | Click |
| 2 | complement(2354522..2355166) | PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; UMNK88_2453; phage(gi16129506) | 2e-87 | Click |
| 3 | complement(2355276..2355536) | PHAGE_Entero_2008: putative tail protein; UMNK88_2454; phage(gi209427782) | 1e-24 | Click |
| 4 | complement(2355596..2355817) | PHAGE_Cronob_ENT39118: putative minor tail protein; UMNK88_2455; phage(gi431811079) | 1e-14 | Click |
| 5 | complement(2355937..2356383) | PHAGE_Entero_HK97: Gp10; UMNK88_2456; phage(gi9634169) | 7e-64 | Click |
| 6 | complement(2356730..2357035) | PHAGE_Entero_phiP27: hypothetical protein P27p41; UMNK88_2457; phage(gi18249905) | 4e-08 | Click |
| 7 | complement(2357047..2357235) | PHAGE_Salmon_ST64B: hypothetical protein sb7; UMNK88_2458; phage(gi23505452) | 2e-13 | Click |
| 8 | complement(2357286..2358491) | PHAGE_Entero_phiP27: putative major capsid protein; UMNK88_2459; phage(gi18249904) | 0.0 | Click |
| 9 | complement(2358506..2359156) | PHAGE_Entero_phiP27: putative prohead protease; UMNK88_2460; phage(gi18249903) | 1e-110 | Click |
| 10 | complement(2359134..2360375) | PHAGE_Entero_phiP27: putative portal protein; UMNK88_2461; phage(gi18249902) | 0.0 | Click |
| 11 | complement(2360375..2360557) | PHAGE_Entero_phiP27: putative integral membrane protein; UMNK88_2462; phage(gi18249901) | 7e-27 | Click |
| 12 | complement(2360569..2362326) | PHAGE_Entero_phiP27: putative terminase; UMNK88_2463; phage(gi18249900) | 9e-96 | Click |
| 13 | complement(2362326..2362646) | PHAGE_Entero_mEp235: terminase small subunit; UMNK88_2464; phage(gi428781811) | 1e-47 | Click |
| 14 | complement(2362956..2363306) | PHAGE_Entero_phiP27: hypothetical protein P27p34; UMNK88_2465; phage(gi18249898) | 6e-58 | Click |
| 15 | complement(2363546..2363923) | PHAGE_Entero_phiP27: putative endolysin; UMNK88_2466; phage(gi18249894) | 8e-67 | Click |
| 16 | complement(2363926..2364201) | PHAGE_Entero_phiP27: putative holin; UMNK88_2467; phage(gi18249893) | 1e-46 | Click |
| 17 | complement(2364191..2364583) | PHAGE_Entero_phiP27: putative holin; UMNK88_2468; phage(gi18249892) | 1e-66 | Click |
| 18 | complement(2364674..2364826) | PHAGE_Entero_P1: TciB; UMNK88_2469; phage(gi46401695) | 5e-06 | Click |
| 19 | complement(2364823..2365248) | PHAGE_Entero_P1: TciA; UMNK88_2470; phage(gi46401694) | 2e-63 | Click |
| 20 | complement(2366344..2366418) | tRNA | N/A | Click |
| 21 | complement(2366422..2366498) | tRNA | N/A | Click |
| 22 | complement(2366579..2366654) | tRNA | N/A | Click |
| 23 | 2367197..2367310 | hypothetical protein; UMNK88_2474 | N/A | Click |
| 24 | 2367783..2367902 | hypothetical protein; UMNK88_2475 | N/A | Click |
| 25 | complement(2367920..2368588) | PHAGE_Gifsy_1: bacteriophage antiterminator protein Q; UMNK88_2476; phage(gi169257244) | 3e-79 | Click |
Region 10, total : 60 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2814370..2814385 | attL TTGCAGGTTCGATTCC | N/A | Click |
| 2 | 2814561..2815709 | PHAGE_Entero_IME10: integrase; UMNK88_2903; phage(gi422934296) | 0.0 | Click |
| 3 | complement(2815714..2817417) | PHAGE_Entero_HK620: tail spike protein; UMNK88_2904; phage(gi13559880) | 1e-57 | Click |
| 4 | complement(2817518..2818420) | PHAGE_Salmon_epsilon34: Ant; UMNK88_2905; phage(gi221328691) | 2e-171 | Click |
| 5 | complement(2818483..2818704) | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_2906; phage(gi399498813) | 3e-36 | Click |
| 6 | 2819198..2819431 | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_2907; phage(gi399498810) | 2e-40 | Click |
| 7 | complement(2819612..2819797) | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_2908; phage(gi399498808) | 6e-28 | Click |
| 8 | complement(2820614..2821057) | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_2909; phage(gi399498806) | 2e-60 | Click |
| 9 | 2821432..2821854 | hypothetical protein; UMNK88_2910 | N/A | Click |
| 10 | complement(2821879..2824035) | PHAGE_Entero_HK620: DNA transfer protein; UMNK88_2911; phage(gi13559877) | 0.0 | Click |
| 11 | complement(2824035..2825384) | PHAGE_Salmon_vB_SemP_Emek: injection protein; UMNK88_2912; phage(gi399498803) | 5e-117 | Click |
| 12 | complement(2825395..2826066) | PHAGE_Salmon_vB_SemP_Emek: injection protein; UMNK88_2913; phage(gi399498802) | 3e-113 | Click |
| 13 | complement(2826069..2826524) | PHAGE_Entero_IME10: head assembly protein; UMNK88_2914; phage(gi422934287) | 6e-85 | Click |
| 14 | complement(2826524..2827477) | PHAGE_Salmon_epsilon34: Tail accessory protein; UMNK88_2915; phage(gi221328627) | 4e-40 | Click |
| 15 | complement(2827477..2828895) | PHAGE_Entero_IME10: DNA stabilization protein; UMNK88_2916; phage(gi422934285) | 0.0 | Click |
| 16 | complement(2828905..2829366) | PHAGE_Sodali_phiSG1: phage DNA stabilization protein; UMNK88_2917; phage(gi89885996) | 2e-27 | Click |
| 17 | complement(2829347..2829523) | conserved hypothetical protein; UMNK88_2918 | N/A | Click |
| 18 | complement(2829577..2830830) | PHAGE_Entero_P22: coat protein; UMNK88_2919; phage(gi9635538) | 3e-35 | Click |
| 19 | complement(2830849..2831742) | PHAGE_Entero_Sf6: gene 4 protein; UMNK88_2920; phage(gi41057282) | 1e-28 | Click |
| 20 | complement(2831833..2832039) | PHAGE_Bacter_2: portal protein; UMNK88_2921; phage(gi212499722) | 4e-11 | Click |
| 21 | complement(2832094..2832981) | PROPHAGE_Escher_Sakai: putative transposase; UMNK88_2922; phage(gi15834498) | 4e-169 | Click |
| 22 | complement(2833063..2833308) | PHAGE_Stx2_c_II: putative transposase; UMNK88_2923; phage(gi302393161) | 3e-41 | Click |
| 23 | complement(2833360..2835351) | PHAGE_Entero_HK620: portal protein; UMNK88_2924; phage(gi13559867) | 0.0 | Click |
| 24 | complement(2835348..2836844) | PHAGE_Entero_IME10: terminase large subunit; UMNK88_2925; phage(gi422934280) | 0.0 | Click |
| 25 | complement(2836822..2837046) | PHAGE_Entero_IME10: terminase small subunit; UMNK88_2926; phage(gi422934279) | 4e-36 | Click |
| 26 | complement(2837390..2837632) | PHAGE_Salmon_vB_SemP_Emek: hypothetical protein; UMNK88_2927; phage(gi399498861) | 6e-39 | Click |
| 27 | complement(2837736..2838116) | PHAGE_Entero_Sf6: hypothetical protein Sf6p66; UMNK88_2928; phage(gi41057339) | 1e-68 | Click |
| 28 | 2838151..2838282 | hypothetical protein; UMNK88_2929 | N/A | Click |
| 29 | complement(2838351..2838830) | PHAGE_Escher_KBNP21: hypothetical protein; UMNK88_2930; phage(gi410492019) | 8e-32 | Click |
| 30 | complement(2838912..2839055) | PHAGE_Salmon_epsilon34: hypothetical protein epsilon34_gp67; UMNK88_2931; phage(gi221328686) | 7e-21 | Click |
| 31 | complement(2839052..2839519) | PHAGE_Salmon_SPN9CC: endopeptidase; UMNK88_2932; phage(gi389060532) | 2e-80 | Click |
| 32 | complement(2839516..2839989) | PHAGE_Escher_HK75: lysozyme; UMNK88_2933; phage(gi356870730) | 2e-88 | Click |
| 33 | complement(2839976..2840299) | PHAGE_Entero_IME10: holin; UMNK88_2934; phage(gi422934276) | 1e-55 | Click |
| 34 | complement(2840968..2841576) | PHAGE_Entero_IME10: regulatory protein Q; UMNK88_2935; phage(gi422934275) | 7e-115 | Click |
| 35 | complement(2841588..2842253) | PHAGE_Entero_HK446: NinI protein; UMNK88_2936; phage(gi428782246) | 2e-131 | Click |
| 36 | complement(2842231..2842437) | PHAGE_Entero_mEp234: NinH protein; UMNK88_2937; phage(gi428782305) | 4e-33 | Click |
| 37 | complement(2842434..2843045) | PHAGE_Entero_HK446: NinG protein; UMNK88_2938; phage(gi428782244) | 6e-119 | Click |
| 38 | complement(2843214..2843573) | PHAGE_Entero_IME10: ninX; UMNK88_2939; phage(gi422934274) | 5e-65 | Click |
| 39 | complement(2843749..2844276) | PHAGE_Entero_mEp213: DNA N-6-adenine-methyltransferase (Dam); UMNK88_2940; phage(gi428782650) | 9e-102 | Click |
| 40 | complement(2844273..2844713) | PHAGE_Entero_HK446: NinB protein; UMNK88_2941; phage(gi428782241) | 3e-82 | Click |
| 41 | complement(2844787..2846163) | PHAGE_Entero_mEp213: replicative DNA helicase; UMNK88_2942; phage(gi428782646) | 0.0 | Click |
| 42 | complement(2846160..2847047) | PHAGE_Salmon_SPN9CC: bacteriophage replication protein O; UMNK88_2943; phage(gi389060512) | 6e-67 | Click |
| 43 | complement(2847405..2847704) | PHAGE_Entero_Min27: regulatory protein CII; UMNK88_2944; phage(gi170783637) | 1e-51 | Click |
| 44 | complement(2847811..2848011) | PHAGE_Entero_HK544: Cro protein; UMNK88_2945; phage(gi428783258) | 9e-32 | Click |
| 45 | 2848112..2848825 | PHAGE_Entero_mEp234: prophage repressor; UMNK88_2946; phage(gi428782293) | 1e-130 | Click |
| 46 | 2848941..2849942 | conserved hypothetical protein; UMNK88_2947 | N/A | Click |
| 47 | 2850328..2850720 | PHAGE_Entero_ST104: gp24; UMNK88_2948; phage(gi46358669) | 8e-30 | Click |
| 48 | 2851059..2851529 | PHAGE_Stx2_c_I: hypothetical protein Stx2Ip113; UMNK88_2949; phage(gi20065908) | 6e-91 | Click |
| 49 | 2851576..2851710 | hypothetical protein; UMNK88_2950 | N/A | Click |
| 50 | 2852033..2853001 | PHAGE_Entero_IME10: Orf53; UMNK88_2951; phage(gi422934294) | 3e-170 | Click |
| 51 | 2853142..2853294 | PHAGE_Entero_mEpX2: Kil protein; UMNK88_2952; phage(gi428765649) | 6e-23 | Click |
| 52 | 2853370..2853540 | PHAGE_Entero_mEp234: hypothetical protein; UMNK88_2953; phage(gi428782284) | 2e-26 | Click |
| 53 | 2853551..2854156 | PHAGE_Entero_HK542: essential recombination function protein; UMNK88_2954; phage(gi428783375) | 3e-111 | Click |
| 54 | 2854156..2854539 | PHAGE_Entero_mEp213: hypothetical protein; UMNK88_2955; phage(gi428782627) | 8e-70 | Click |
| 55 | 2854563..2854856 | PHAGE_Escher_HK75: anti-RecBCD protein 2; UMNK88_2956; phage(gi356870707) | 4e-53 | Click |
| 56 | 2854867..2855031 | PHAGE_Entero_HK620: hypothetical protein HK620p09; UMNK88_2957; phage(gi13559832) | 2e-24 | Click |
| 57 | 2855028..2855720 | PHAGE_Entero_HK022: hypothetical protein HK022p35; UMNK88_2958; phage(gi9634146) | 2e-31 | Click |
| 58 | 2855713..2855997 | PHAGE_Entero_ST104: ORF6; UMNK88_2959; phage(gi46358654) | 6e-51 | Click |
| 59 | complement(2856055..2856225) | hypothetical protein; UMNK88_2960 | N/A | Click |
| 60 | 2856260..2856275 | attR TTGCAGGTTCGATTCC | N/A | Click |
| 61 | 2856295..2856495 | PHAGE_Entero_HK633: hypothetical protein; UMNK88_2961; phage(gi428782548) | 3e-34 | Click |
| 62 | complement(2856679..2857614) | PHAGE_Burkho_phi1026b: gp58; UMNK88_2962; phage(gi38707948) | 7e-16 | Click |
Region 11, total : 55 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3000495..3000998 | PROPHAGE_Escher_MG1655: IS1 transposase B; UMNK88_3102; phage(gi16131317) | 4e-96 | Click |
| 2 | complement(3000992..3002800) | conserved hypothetical protein; UMNK88_3101 | N/A | Click |
| 3 | complement(3002982..3003134) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3103; phage(gi418487684) | 7e-21 | Click |
| 4 | 3003152..3003343 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3104; phage(gi418487683) | 4e-30 | Click |
| 5 | 3003657..3004172 | PHAGE_Escher_TL_2011b: putative outer membrane lipoprotein; UMNK88_3105; phage(gi418487638) | 2e-93 | Click |
| 6 | 3004188..3004727 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3106; phage(gi418487682) | 1e-95 | Click |
| 7 | 3004818..3004834 | attL AATCATTCCCACTCAAT | N/A | Click |
| 8 | complement(3004931..3005419) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3107; phage(gi418487681) | 4e-32 | Click |
| 9 | complement(3005416..3006045) | PHAGE_Escher_TL_2011b: putative endolysin; UMNK88_3108; phage(gi418487637) | 1e-114 | Click |
| 10 | complement(3006035..3006343) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3109; phage(gi418487680) | 2e-51 | Click |
| 11 | complement(3006980..3009007) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3110; phage(gi418487677) | 2e-108 | Click |
| 12 | 3009296..3009460 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3111; phage(gi418487676) | 1e-23 | Click |
| 13 | 3009776..3010486 | PHAGE_Escher_TL_2011b: putative anti-repressor protein; UMNK88_3112; phage(gi418487636) | 7e-102 | Click |
| 14 | 3010587..3010754 | conserved hypothetical protein; UMNK88_3113 | N/A | Click |
| 15 | 3011081..3011215 | conserved hypothetical protein; UMNK88_3114 | N/A | Click |
| 16 | 3011310..3011471 | PHAGE_Escher_TL_2011b: putative transmembrane anchored protein; UMNK88_3115; phage(gi418487635) | 1e-24 | Click |
| 17 | complement(3011510..3011632) | conserved hypothetical protein; UMNK88_3116 | N/A | Click |
| 18 | complement(3011933..3014407) | PHAGE_Entero_phiV10: hypothetical protein PhiV10p20; UMNK88_3117; phage(gi89152441) | 0.0 | Click |
| 19 | complement(3014413..3016215) | PHAGE_Burkho_BcepC6B: SLT domain-containing tail structural protein; UMNK88_3118; phage(gi48697206) | 2e-09 | Click |
| 20 | complement(3016212..3018725) | PHAGE_Escher_TL_2011b: lytic transglycosylase; UMNK88_3119; phage(gi418487634) | 1e-49 | Click |
| 21 | complement(3018725..3019270) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3120; phage(gi418487668) | 4e-98 | Click |
| 22 | complement(3019270..3019734) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3121; phage(gi418487667) | 2e-87 | Click |
| 23 | complement(3019734..3022205) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3122; phage(gi418487666) | 0.0 | Click |
| 24 | complement(3022205..3022810) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3123; phage(gi418487665) | 4e-114 | Click |
| 25 | complement(3022810..3023133) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3124; phage(gi418487664) | 2e-54 | Click |
| 26 | complement(3023184..3023519) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3125; phage(gi418487663) | 2e-58 | Click |
| 27 | complement(3023530..3023967) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3126; phage(gi418487662) | 9e-77 | Click |
| 28 | complement(3024019..3025005) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3127; phage(gi418487661) | 0.0 | Click |
| 29 | complement(3025020..3025715) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3128; phage(gi418487660) | 1e-128 | Click |
| 30 | complement(3025718..3026014) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3129; phage(gi418487659) | 9e-51 | Click |
| 31 | complement(3026011..3027690) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3130; phage(gi418487658) | 0.0 | Click |
| 32 | complement(3027705..3027911) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3131; phage(gi418487657) | 3e-32 | Click |
| 33 | 3028339..3028415 | tRNA | N/A | Click |
| 34 | 3028618..3028989 | PHAGE_Entero_phiV10: hypothetical protein PhiV10p03; UMNK88_3134; phage(gi89152424) | 5e-65 | Click |
| 35 | complement(3029080..3030555) | PHAGE_Escher_TL_2011b: putative phage terminase, large subunit; UMNK88_3135; phage(gi418487633) | 0.0 | Click |
| 36 | complement(3030552..3031226) | PHAGE_Escher_TL_2011b: putative terminase small subunit; UMNK88_3136; phage(gi418487632) | 6e-101 | Click |
| 37 | complement(3031267..3031605) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3137; phage(gi418487654) | 8e-60 | Click |
| 38 | 3031580..3031699 | hypothetical protein; UMNK88_3138 | N/A | Click |
| 39 | complement(3031948..3032490) | PHAGE_Entero_HK140: hypothetical protein; UMNK88_3139; phage(gi428781971) | 1e-36 | Click |
| 40 | complement(3032487..3033002) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3140; phage(gi418487651) | 7e-101 | Click |
| 41 | complement(3033007..3034098) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3141; phage(gi418487649) | 3e-40 | Click |
| 42 | complement(3034160..3034462) | PHAGE_Entero_phiV10: hypothetical protein PhiV10p45; UMNK88_3142; phage(gi89152461) | 2e-53 | Click |
| 43 | complement(3034625..3035407) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3143; phage(gi418487647) | 4e-138 | Click |
| 44 | complement(3035382..3036239) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3144; phage(gi418487646) | 4e-25 | Click |
| 45 | complement(3036255..3036455) | PHAGE_Entero_phiV10: hypothetical protein PhiV10p42; UMNK88_3145; phage(gi89152475) | 6e-34 | Click |
| 46 | complement(3036606..3036836) | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3146; phage(gi418487645) | 1e-40 | Click |
| 47 | 3036991..3037575 | PHAGE_Escher_TL_2011b: helix-turn-helix protein; UMNK88_3147; phage(gi418487631) | 2e-105 | Click |
| 48 | 3037729..3037881 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3148; phage(gi418487644) | 1e-26 | Click |
| 49 | 3037884..3038183 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3149; phage(gi418487643) | 2e-48 | Click |
| 50 | 3038180..3039001 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3150; phage(gi418487642) | 2e-158 | Click |
| 51 | 3039082..3039939 | PHAGE_Escher_TL_2011b: enterohemolysin 1; UMNK88_3151; phage(gi418487630) | 9e-116 | Click |
| 52 | 3039989..3040237 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3152; phage(gi418487641) | 2e-11 | Click |
| 53 | 3040738..3041289 | PHAGE_Escher_TL_2011b: putative adenine methylase; UMNK88_3153; phage(gi418487629) | 4e-104 | Click |
| 54 | 3041337..3041480 | PHAGE_Escher_TL_2011b: hypothetical protein; UMNK88_3154; phage(gi418487639) | 4e-19 | Click |
| 55 | complement(3041484..3042734) | PHAGE_Escher_TL_2011b: putative integrase; UMNK88_3155; phage(gi418487628) | 0.0 | Click |
| 56 | 3042925..3042941 | attR AATCATTCCCACTCAAT | N/A | Click |
| 57 | complement(3042927..3044504) | GMP synthase GuaA; UMNK88_3156 | N/A | Click |
| 58 | complement(3044573..3046039) | PHAGE_Staphy_42E: ORF012; UMNK88_3157; phage(gi66395520) | 4e-32 | Click |
Region 12, total : 52 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3163781..3165442 | PHAGE_Human__8: LANA; UMNK88_3269; phage(gi139472804) | 2e-05 | Click |
| 2 | 3165591..3165932 | OmlA family protein; UMNK88_3270 | N/A | Click |
| 3 | complement(3165994..3166284) | conserved hypothetical protein; UMNK88_3271 | N/A | Click |
| 4 | complement(3166274..3166711) | conserved hypothetical protein; UMNK88_3272 | N/A | Click |
| 5 | 3166882..3167364 | ssrA-binding protein SmpB; UMNK88_3273 | N/A | Click |
| 6 | 3167579..3167941 | tRNA | N/A | Click |
| 7 | 3167915..3167928 | attL CGGGTTCAACTCCC | N/A | Click |
| 8 | 3168213..3168479 | PHAGE_Entero_mEp237: virulence protein MsgA; UMNK88_3274; phage(gi435439290) | 4e-42 | Click |
| 9 | complement(3168522..3169790) | PHAGE_Entero_HK542: tail fiber; UMNK88_3275; phage(gi428783368) | 1e-126 | Click |
| 10 | complement(3169817..3169975) | PHAGE_Escher_HK639: hypothetical protein; UMNK88_3276; phage(gi356870626) | 5e-22 | Click |
| 11 | 3169944..3170279 | hypothetical protein; UMNK88_3278 | N/A | Click |
| 12 | complement(3170244..3170885) | PHAGE_Cronob_ENT39118: hypothetical protein; UMNK88_3277; phage(gi431811062) | 1e-31 | Click |
| 13 | complement(3171178..3175002) | PHAGE_Entero_mEp390: central tail fiber; UMNK88_3279; phage(gi428782683) | 0.0 | Click |
| 14 | complement(3175056..3175655) | PHAGE_Entero_mEp234: tail assembly protein I; UMNK88_3280; phage(gi428782273) | 5e-84 | Click |
| 15 | complement(3176073..3176783) | PHAGE_Entero_mEp234: minor tail protein K; UMNK88_3281; phage(gi428782271) | 6e-143 | Click |
| 16 | complement(3176785..3177543) | PHAGE_Escher_HK75: minor tail protein L; UMNK88_3282; phage(gi356870693) | 4e-148 | Click |
| 17 | complement(3177540..3177878) | PHAGE_Escher_HK75: minor tail protein; UMNK88_3283; phage(gi356870692) | 9e-64 | Click |
| 18 | complement(3177881..3181162) | PHAGE_Cronob_ENT39118: phage tail tape measure protein; UMNK88_3284; phage(gi431811045) | 0.0 | Click |
| 19 | complement(3181197..3181460) | PHAGE_Escher_HK75: phage tail protein; UMNK88_3285; phage(gi356870689) | 6e-20 | Click |
| 20 | complement(3181484..3181885) | PHAGE_Cronob_ENT39118: phage tail assembly chaperone; UMNK88_3286; phage(gi431811075) | 4e-33 | Click |
| 21 | complement(3181940..3182410) | PHAGE_Cronob_ENT39118: phage major tail subunit; UMNK88_3287; phage(gi431811069) | 8e-80 | Click |
| 22 | complement(3182465..3182812) | PHAGE_Cronob_ENT39118: putative minor tail protein; UMNK88_3288; phage(gi431811079) | 1e-57 | Click |
| 23 | complement(3182809..3183228) | PHAGE_Cronob_ENT39118: hypothetical protein; UMNK88_3289; phage(gi431811071) | 2e-71 | Click |
| 24 | complement(3183255..3183593) | PHAGE_Escher_HK75: head-tail adaptor protein; UMNK88_3290; phage(gi356870684) | 1e-59 | Click |
| 25 | complement(3183593..3183904) | PHAGE_Entero_mEp390: head-tail connector I; UMNK88_3291; phage(gi428782670) | 3e-52 | Click |
| 26 | complement(3183954..3185111) | PHAGE_Entero_mEpX2: major head subunit; UMNK88_3292; phage(gi428765618) | 0.0 | Click |
| 27 | complement(3185114..3185791) | PHAGE_Cronob_ENT39118: head maturation protease; UMNK88_3293; phage(gi431811061) | 2e-125 | Click |
| 28 | complement(3185809..3187083) | PHAGE_Cronob_ENT39118: head portal protein; UMNK88_3294; phage(gi431811049) | 0.0 | Click |
| 29 | complement(3187083..3188597) | PHAGE_Escher_HK75: terminase large subunit; UMNK88_3295; phage(gi356870679) | 0.0 | Click |
| 30 | complement(3188604..3189089) | PHAGE_Entero_mEp390: terminase small subunit; UMNK88_3296; phage(gi428782665) | 7e-84 | Click |
| 31 | complement(3189274..3189477) | PHAGE_Entero_HK140: hypothetical protein; UMNK88_3297; phage(gi428782010) | 1e-24 | Click |
| 32 | complement(3189477..3189818) | PHAGE_Entero_mEp390: hypothetical protein; UMNK88_3298; phage(gi428782721) | 3e-65 | Click |
| 33 | complement(3189815..3190405) | PHAGE_Cronob_ENT39118: hypothetical protein; UMNK88_3299; phage(gi431811065) | 6e-108 | Click |
| 34 | complement(3190387..3191844) | PHAGE_Cronob_ENT39118: glycosyl transferase; UMNK88_3300; phage(gi431811048) | 0.0 | Click |
| 35 | complement(3192581..3192865) | PHAGE_Escher_HK639: hypothetical protein; UMNK88_3301; phage(gi356870672) | 2e-30 | Click |
| 36 | complement(3192862..3193011) | PHAGE_Entero_mEp390: hypothetical protein; UMNK88_3302; phage(gi428782716) | 1e-18 | Click |
| 37 | complement(3193016..3193285) | PHAGE_Escher_HK639: hypothetical protein; UMNK88_3303; phage(gi356870670) | 1e-40 | Click |
| 38 | complement(3193293..3193922) | PHAGE_Escher_HK639: endochitinase; UMNK88_3304; phage(gi356870669) | 1e-109 | Click |
| 39 | complement(3193922..3194203) | PHAGE_Entero_mEp390: putative holin; UMNK88_3305; phage(gi428782713) | 3e-21 | Click |
| 40 | complement(3194190..3194576) | PHAGE_Cronob_ENT39118: putative prophage membrane protein; UMNK88_3306; phage(gi431811074) | 8e-44 | Click |
| 41 | complement(3194685..3194840) | PHAGE_Entero_P1: TciB; UMNK88_3307; phage(gi46401695) | 1e-06 | Click |
| 42 | complement(3194837..3195262) | PHAGE_Entero_P1: TciA; UMNK88_3308; phage(gi46401694) | 4e-64 | Click |
| 43 | complement(3195518..3196318) | PHAGE_Cronob_ENT39118: antitermination protein; UMNK88_3309; phage(gi431811056) | 8e-111 | Click |
| 44 | complement(3196315..3197286) | PHAGE_Cronob_ENT39118: putative phage DNA primase; UMNK88_3310; phage(gi431811053) | 9e-150 | Click |
| 45 | complement(3197283..3198902) | PHAGE_Cronob_ENT39118: putative helicase; UMNK88_3311; phage(gi431811046) | 0.0 | Click |
| 46 | 3200561..3200680 | hypothetical protein; UMNK88_3312 | N/A | Click |
| 47 | 3200766..3201080 | PHAGE_Salmon_1: hypothetical protein STM0898.7n.Fels1; UMNK88_3313; phage(gi169257170) | 1e-19 | Click |
| 48 | 3201073..3201261 | PHAGE_Salmon_1: hypothetical protein STM0898.6n.Fels1; UMNK88_3314; phage(gi169257169) | 3e-08 | Click |
| 49 | 3201430..3201795 | PHAGE_Cronob_ENT39118: hypothetical protein; UMNK88_3315; phage(gi431811077) | 3e-31 | Click |
| 50 | complement(3202307..3202495) | hypothetical protein; UMNK88_3316 | N/A | Click |
| 51 | 3202505..3202639 | conserved hypothetical protein; UMNK88_3318 | N/A | Click |
| 52 | complement(3202617..3202739) | hypothetical protein; UMNK88_3317 | N/A | Click |
| 53 | 3202743..3203027 | conserved hypothetical protein; UMNK88_3319 | N/A | Click |
| 54 | 3203310..3204353 | PHAGE_Cronob_phiES15: putative integrase; UMNK88_3320; phage(gi401817566) | 0.0 | Click |
| 55 | 3204486..3204499 | attR CGGGTTCAACTCCC | N/A | Click |
Region 13, total : 17 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 4304108..4304119 | attL GGTGTACATAAT | N/A | Click |
| 2 | 4304177..4305436 | PHAGE_Burkho_BcepC6B: putative integrase protein; UMNK88_4429; phage(gi48697215) | 4e-47 | Click |
| 3 | 4305532..4306497 | conserved hypothetical protein; UMNK88_4430 | N/A | Click |
| 4 | 4306612..4306815 | conserved hypothetical protein; UMNK88_4431 | N/A | Click |
| 5 | 4306815..4307246 | conserved hypothetical protein; UMNK88_4432 | N/A | Click |
| 6 | 4307259..4308092 | PHAGE_Escher_TL_2011c: putative antirepressor; UMNK88_4433; phage(gi418487055) | 6e-23 | Click |
| 7 | complement(4308405..4308521) | PHAGE_Salmon_vB_SemP_Emek: terminase small subunit; UMNK88_4434; phage(gi399498792) | 3e-08 | Click |
| 8 | 4308884..4309078 | conserved hypothetical protein; UMNK88_4435 | N/A | Click |
| 9 | 4309071..4309289 | conserved hypothetical protein; UMNK88_4436 | N/A | Click |
| 10 | 4309282..4309476 | conserved hypothetical protein; UMNK88_4437 | N/A | Click |
| 11 | 4309473..4309736 | nicotinic acetylcholine receptor protein; UMNK88_4438 | N/A | Click |
| 12 | 4309733..4309954 | conserved hypothetical protein; UMNK88_4439 | N/A | Click |
| 13 | 4309947..4310549 | PHAGE_Entero_phiP27: hypothetical protein P27p06; UMNK88_4440; phage(gi18249870) | 3e-24 | Click |
| 14 | 4310562..4313324 | PHAGE_Entero_P4: DNA primase; UMNK88_4441; phage(gi9627512) | 3e-39 | Click |
| 15 | 4313616..4313729 | hypothetical protein; UMNK88_4442 | N/A | Click |
| 16 | 4313910..4314083 | conserved hypothetical protein; UMNK88_4443 | N/A | Click |
| 17 | 4314088..4315467 | PHAGE_Entero_P22: injection protein; UMNK88_4444; phage(gi9635545) | 8e-166 | Click |
| 18 | 4315467..4317479 | PHAGE_Entero_P22: injection protein; UMNK88_4445; phage(gi51236731) | 5e-64 | Click |
| 19 | 4320375..4320386 | attR GGTGTACATAAT | N/A | Click |