| Definition | Lactococcus lactis subsp. cremoris NZ9000, complete genome. |
|---|---|
| Accession | CP002094 |
| Length | 2,530,294 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 34 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 25908..25929 | attL CGGTAGCTCAGTTGGTAGAGCA | N/A | Click |
| 2 | 28377..30311 | PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; LLNZ_00110; phage(gi9631364) | 3e-06 | Click |
| 3 | 30358..30789 | PTS system, mannitol-specific IIA component; LLNZ_00115 | N/A | Click |
| 4 | 30938..32104 | PHAGE_Microm_MpV1: hypothetical protein; LLNZ_00120; phage(gi313768442) | 2e-11 | Click |
| 5 | complement(32974..33297) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p29; LLNZ_00125; phage(gi13095890) | 8e-46 | Click |
| 6 | complement(33398..33778) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p29; LLNZ_00130; phage(gi13095890) | 9e-05 | Click |
| 7 | complement(33806..34108) | hypothetical protein; LLNZ_00135 | N/A | Click |
| 8 | complement(34425..35006) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p26; LLNZ_00140; phage(gi13095887) | 2e-92 | Click |
| 9 | complement(35242..36870) | PHAGE_Lactoc_bIL310: helicase; LLNZ_00145; phage(gi13095886) | 0.0 | Click |
| 10 | complement(36881..37675) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; LLNZ_00150; phage(gi13095885) | 8e-145 | Click |
| 11 | complement(37672..38007) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p23; LLNZ_00155; phage(gi13095884) | 3e-55 | Click |
| 12 | complement(38004..38258) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p21; LLNZ_00160; phage(gi13095882) | 3e-37 | Click |
| 13 | complement(38255..38494) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p20; LLNZ_00165; phage(gi13095881) | 5e-38 | Click |
| 14 | complement(38536..38817) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p19; LLNZ_00170; phage(gi13095880) | 1e-48 | Click |
| 15 | complement(38829..39254) | PHAGE_Lactoc_bIL312: Orf9; LLNZ_00175; phage(gi13095900) | 4e-74 | Click |
| 16 | complement(39259..39453) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p16; LLNZ_00180; phage(gi13095877) | 3e-27 | Click |
| 17 | complement(39569..39754) | PHAGE_Strept_2: hypothetical protein SpyM3_0967; LLNZ_00185; phage(gi28876251) | 8e-07 | Click |
| 18 | 39837..40163 | hypothetical protein; LLNZ_00190 | N/A | Click |
| 19 | complement(40519..40734) | PHAGE_Lactoc_r1t: repressor; LLNZ_00195; phage(gi23455723) | 2e-08 | Click |
| 20 | 40842..41282 | PHAGE_Lactoc_bIL310: immunity repressor; LLNZ_00200; phage(gi13095874) | 1e-30 | Click |
| 21 | 41312..41866 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p12; LLNZ_00205; phage(gi13095873) | 8e-104 | Click |
| 22 | 41977..42207 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p10; LLNZ_00210; phage(gi13095871) | 1e-34 | Click |
| 23 | 42280..42474 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p09; LLNZ_00215; phage(gi13095870) | 1e-30 | Click |
| 24 | 42727..42984 | hypothetical protein; LLNZ_00220 | N/A | Click |
| 25 | 43098..44423 | PHAGE_Cronob_ESP2949_1: tail fiber; LLNZ_00225; phage(gi422935481) | 1e-05 | Click |
| 26 | 44505..44711 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p07; LLNZ_00230; phage(gi13095868) | 5e-19 | Click |
| 27 | 44934..45137 | hypothetical protein; LLNZ_00235 | N/A | Click |
| 28 | 45201..45443 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p08; LLNZ_00240; phage(gi13095869) | 1e-37 | Click |
| 29 | 45591..45803 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p07; LLNZ_00245; phage(gi13095868) | 2e-35 | Click |
| 30 | 46467..47690 | PROPHAGE_Escher_CFT073: transposase; LLNZ_00250; phage(gi26248360) | 2e-28 | Click |
| 31 | 47702..48460 | PROPHAGE_Escher_CFT073: transposase/IS protein; LLNZ_00255; phage(gi26248359) | 9e-37 | Click |
| 32 | 48562..48888 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p06; LLNZ_00260; phage(gi19343482) | 4e-24 | Click |
| 33 | 49622..49786 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p03; LLNZ_00265; phage(gi13095865) | 7e-24 | Click |
| 34 | 49908..50213 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p02; LLNZ_00270; phage(gi13095864) | 2e-51 | Click |
| 35 | 50463..51647 | PHAGE_Lactoc_bIL310: integrase; LLNZ_00275; phage(gi13095863) | 0.0 | Click |
| 36 | 60657..60678 | attR CGGTAGCTCAGTTGGTAGAGCA | N/A | Click |
Region 2, total : 34 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 583073..583084 | attL TTACTGACAGAT | N/A | Click |
| 2 | complement(584276..585292) | PHAGE_Lactoc_bIL309: integrase; LLNZ_03050; phage(gi13095806) | 5e-76 | Click |
| 3 | 585309..585322 | attL TTTTTTATATTTTT | N/A | Click |
| 4 | complement(585513..586004) | PHAGE_Lactoc_bIL312: Orf2; LLNZ_03055; phage(gi13095893) | 3e-83 | Click |
| 5 | complement(587045..587221) | PHAGE_Lactoc_bIL286: repressor; LLNZ_03070; phage(gi13095747) | 4e-06 | Click |
| 6 | 587515..589122 | hypothetical protein; LLNZ_03075 | N/A | Click |
| 7 | 589040..589978 | PHAGE_Salmon_SPN9CC: O-antigen conversion protein; LLNZ_03080; phage(gi389060490) | 1e-65 | Click |
| 8 | complement(590245..590736) | PHAGE_Bovine_4: glycoprotein gp80; LLNZ_03085; phage(gi13095628) | 1e-06 | Click |
| 9 | complement(590749..591123) | PHAGE_Lactoc_ul36: hypothetical protein ul36_02; LLNZ_03090; phage(gi21716074) | 5e-52 | Click |
| 10 | complement(591468..591815) | PHAGE_Lactoc_bIL312: repressor; LLNZ_03095; phage(gi13095896) | 1e-22 | Click |
| 11 | 592377..592452 | tRNA | N/A | Click |
| 12 | 592581..593504 | ribonuclease Z; LLNZ_03100 | N/A | Click |
| 13 | 593497..594198 | oxidoreductase; LLNZ_03105 | N/A | Click |
| 14 | 594371..596599 | PHAGE_Bacill_36: RecJ; LLNZ_03110; phage(gi156564062) | 2e-81 | Click |
| 15 | 596723..597235 | adenine phosphoribosyltransferase; LLNZ_03115 | N/A | Click |
| 16 | 597451..598017 | PHAGE_Atelin_3: orf 48; LLNZ_03120; phage(gi9631239) | 2e-11 | Click |
| 17 | 598156..599793 | PHAGE_Yersin_phiR1_37: hypothetical protein; LLNZ_03125; phage(gi358356584) | 2e-05 | Click |
| 18 | 599854..600324 | transcription elongation factor GreA; LLNZ_03130 | N/A | Click |
| 19 | 600416..600973 | PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; LLNZ_03135; phage(gi17546156) | 2e-10 | Click |
| 20 | 601060..601218 | PROPHAGE_Lactoc_Il1403: IS1077F transposase; LLNZ_03140; phage(gi15674057) | 1e-07 | Click |
| 21 | 601127..601792 | PROPHAGE_Lactoc_Il1403: IS1077F transposase; LLNZ_03145; phage(gi15674057) | 2e-123 | Click |
| 22 | 601864..602154 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; LLNZ_03150; phage(gi24373865) | 2e-08 | Click |
| 23 | 602172..603011 | PROPHAGE_Lactoc_Il1403: transposase of IS904H; LLNZ_03155; phage(gi15674055) | 2e-146 | Click |
| 24 | 603242..603697 | transcriptional regulator CtsR; LLNZ_03160 | N/A | Click |
| 25 | 603687..606137 | PROPHAGE_Escher_EDL933: ATP-dependent Clp protease ATP-binding subunit; LLNZ_03165; phage(gi15800640) | 8e-135 | Click |
| 26 | 606272..606829 | putative sigma 54 modulation protein; LLNZ_03170 | N/A | Click |
| 27 | 607017..608318 | phosphopyruvate hydratase; LLNZ_03175 | N/A | Click |
| 28 | 608407..609342 | PHAGE_Thermu_26: phage XerD-like integrase; LLNZ_03180; phage(gi157265417) | 2e-11 | Click |
| 29 | complement(609435..609566) | hypothetical protein; LLNZ_03185 | N/A | Click |
| 30 | 609469..610101 | PHAGE_Lactob_A2: hypothetical protein A2p22; LLNZ_03190; phage(gi22296544) | 6e-06 | Click |
| 31 | complement(610114..610818) | PROPHAGE_Escher_CFT073: transposase insF; LLNZ_03195; phage(gi26250329) | 4e-36 | Click |
| 32 | complement(610980..611255) | PHAGE_Lactob_phiAT3: putative transposase A; LLNZ_03200; phage(gi48697273) | 3e-11 | Click |
| 33 | complement(611481..612335) | PHAGE_Lactob_phiAT3: putative transposase B; LLNZ_03205; phage(gi48697274) | 3e-46 | Click |
| 34 | complement(612332..612592) | PHAGE_Lactob_phiAT3: putative transposase A; LLNZ_03210; phage(gi48697273) | 3e-12 | Click |
| 35 | 612672..613352 | abortive phage resistance protein abiP; LLNZ_03215 | N/A | Click |
| 36 | 613666..613782 | phosphopyruvate hydratase; LLNZ_03220 | N/A | Click |
| 37 | 613882..613895 | attR TTTTTTATATTTTT | N/A | Click |
| 38 | complement(613886..614557) | PHAGE_Plankt_PaV_LD: ABC transporter; LLNZ_03225; phage(gi371496158) | 4e-32 | Click |
| 39 | 616364..616375 | attR TTACTGACAGAT | N/A | Click |
Region 3, total : 64 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 776265..777743 | PHAGE_Plankt_PaV_LD: ABC transporter; LLNZ_04080; phage(gi371496158) | 8e-18 | Click |
| 2 | 777740..778687 | ribose transport system permease protein RbsC; LLNZ_04085 | N/A | Click |
| 3 | 778699..779673 | ribose ABC transporter substrate binding protein RbsB; LLNZ_04090 | N/A | Click |
| 4 | 779684..779696 | attL CTCTGTCGCTAGG | N/A | Click |
| 5 | complement(779864..780997) | PHAGE_Strept_MM1: integrase; LLNZ_04095; phage(gi15088744) | 7e-61 | Click |
| 6 | complement(781123..781749) | PHAGE_Lactoc_r1t: hypothetical protein r1tp02; LLNZ_04100; phage(gi23455721) | 9e-37 | Click |
| 7 | complement(781806..782243) | PHAGE_Lactoc_1: ORF3; LLNZ_04105; phage(gi13786534) | 8e-83 | Click |
| 8 | complement(782240..782737) | PHAGE_Lactoc_bIL285: repressor; LLNZ_04110; phage(gi13095684) | 1e-33 | Click |
| 9 | complement(783139..783948) | phage protein; LLNZ_04115 | N/A | Click |
| 10 | 784102..784353 | PHAGE_Lactoc_r1t: repressor; LLNZ_04120; phage(gi23455723) | 1e-13 | Click |
| 11 | 784368..784586 | hypothetical protein; LLNZ_04125 | N/A | Click |
| 12 | 784596..785309 | PHAGE_Lactoc_Tuc2009: major structural protein; LLNZ_04130; phage(gi13487806) | 6e-123 | Click |
| 13 | 785322..785558 | hypothetical protein; LLNZ_04135 | N/A | Click |
| 14 | complement(785900..786178) | PHAGE_Lactoc_ul36: hypothetical protein ul36_60; LLNZ_04140; phage(gi146334931) | 1e-49 | Click |
| 15 | 786284..786532 | PHAGE_Lactoc_lato: hypothetical protein P335p05; LLNZ_04145; phage(gi30089866) | 4e-39 | Click |
| 16 | 786529..786705 | PHAGE_Lactoc_1: ORF9; LLNZ_04150; phage(gi13786540) | 1e-27 | Click |
| 17 | 786810..787328 | PHAGE_Lactoc_bIL285: Orf13; LLNZ_04155; phage(gi13095693) | 6e-92 | Click |
| 18 | 787337..788056 | PHAGE_Lactoc_T: hypothetical protein BK5-Tp46; LLNZ_04160; phage(gi14251170) | 1e-82 | Click |
| 19 | 788056..788559 | PHAGE_Lactoc_T: putative single stranded DNA binding protein; LLNZ_04165; phage(gi14251188) | 8e-50 | Click |
| 20 | 788695..789534 | PHAGE_Lactoc_bIL286: replication protein; LLNZ_04170; phage(gi13095759) | 1e-159 | Click |
| 21 | 789544..790428 | PHAGE_Lactoc_bIL309: DnaC; LLNZ_04175; phage(gi13095820) | 1e-166 | Click |
| 22 | 790425..790589 | PHAGE_Lactoc_bIL309: Orf16; LLNZ_04180; phage(gi13095821) | 7e-24 | Click |
| 23 | 790579..790998 | PHAGE_Lactoc_1: RUS; LLNZ_04185; phage(gi13786546) | 6e-75 | Click |
| 24 | 790999..791238 | PHAGE_Lactoc_1: ORF16; LLNZ_04190; phage(gi13786547) | 5e-40 | Click |
| 25 | 791344..791868 | PHAGE_Lactoc_1: ORF17; LLNZ_04195; phage(gi13786548) | 3e-95 | Click |
| 26 | 791882..792088 | PHAGE_Lactoc_1: ORF18; LLNZ_04200; phage(gi13786549) | 9e-34 | Click |
| 27 | 792081..792629 | PHAGE_Lactoc_lato: hypothetical protein P335p18; LLNZ_04205; phage(gi30089879) | 1e-61 | Click |
| 28 | 792626..793045 | PHAGE_Lactoc_bIL286: dUTPase; LLNZ_04210; phage(gi13095772) | 1e-73 | Click |
| 29 | 793048..793386 | PHAGE_Lactoc_ul36: hypothetical protein ul36_25; LLNZ_04215; phage(gi21716096) | 5e-36 | Click |
| 30 | 793383..794063 | PHAGE_Lactoc_r1t: hypothetical protein r1tp22; LLNZ_04220; phage(gi23455741) | 6e-129 | Click |
| 31 | 794143..794361 | PHAGE_Lactoc_ul36: hypothetical protein ul36_29; LLNZ_04225; phage(gi21716100) | 9e-37 | Click |
| 32 | 794358..794531 | PHAGE_Lactoc_bIL309: Orf28; LLNZ_04230; phage(gi13095833) | 3e-07 | Click |
| 33 | 794886..795311 | PHAGE_Lactoc_ul36: hypothetical protein ul36_35; LLNZ_04235; phage(gi21716106) | 2e-50 | Click |
| 34 | 795488..796711 | PROPHAGE_Escher_CFT073: transposase; LLNZ_04240; phage(gi26248360) | 2e-28 | Click |
| 35 | 796723..797481 | PROPHAGE_Escher_CFT073: transposase/IS protein; LLNZ_04245; phage(gi26248359) | 9e-37 | Click |
| 36 | 797862..798374 | PHAGE_Lactob_phig1e: putative terminase small subunit; LLNZ_04250; phage(gi23455798) | 2e-41 | Click |
| 37 | 798364..799599 | PHAGE_Entero_phiFL1A: terminase large subunit; LLNZ_04255; phage(gi281416362) | 0.0 | Click |
| 38 | 799609..801117 | PHAGE_Lactob_Lj965: putative portal protein; LLNZ_04260; phage(gi41179240) | 3e-112 | Click |
| 39 | 801074..801238 | hypothetical protein; LLNZ_04265 | N/A | Click |
| 40 | 801280..801510 | hypothetical protein; LLNZ_04270 | N/A | Click |
| 41 | 801507..801794 | PHAGE_Entero_phiFL3A: ribosomal protein; LLNZ_04275; phage(gi281416258) | 2e-16 | Click |
| 42 | 801800..802897 | PHAGE_Lactob_Lj965: putative minor head protein; LLNZ_04280; phage(gi41179242) | 1e-51 | Click |
| 43 | 802930..803460 | hypothetical protein; LLNZ_04285 | N/A | Click |
| 44 | 803520..803678 | hypothetical protein; LLNZ_04290 | N/A | Click |
| 45 | complement(803675..803947) | hypothetical protein; LLNZ_04295 | N/A | Click |
| 46 | 804124..804750 | PHAGE_Entero_phiFL3A: scaffold protein; LLNZ_04300; phage(gi281416260) | 4e-57 | Click |
| 47 | 804762..805880 | PHAGE_Staphy_vB_SepiS_phiIPLA5: major head protein; LLNZ_04305; phage(gi399528901) | 2e-60 | Click |
| 48 | 805901..806233 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0315; LLNZ_04310; phage(gi41179246) | 3e-15 | Click |
| 49 | 806223..806567 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0316; LLNZ_04315; phage(gi41179247) | 5e-25 | Click |
| 50 | 806551..807099 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0317; LLNZ_04320; phage(gi41179258) | 5e-35 | Click |
| 51 | 807099..807461 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0318; LLNZ_04325; phage(gi41179248) | 6e-17 | Click |
| 52 | 807474..807887 | PHAGE_Lactob_Lj965: putative major tail protein; LLNZ_04330; phage(gi41179249) | 1e-21 | Click |
| 53 | 807964..808374 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0320; LLNZ_04335; phage(gi41179250) | 2e-26 | Click |
| 54 | 808398..808769 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0321; LLNZ_04340; phage(gi41179259) | 2e-12 | Click |
| 55 | 808801..813501 | PHAGE_Lactob_Lj965: putative putative minor tail protein; LLNZ_04345; phage(gi41179260) | 3e-115 | Click |
| 56 | 813513..813878 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0323; LLNZ_04350; phage(gi41179261) | 9e-16 | Click |
| 57 | 813890..816427 | PHAGE_Lactob_Lj965: hypothetical protein Ljo_0324; LLNZ_04355; phage(gi41179262) | 1e-85 | Click |
| 58 | 816424..816561 | hypothetical protein; LLNZ_04360 | N/A | Click |
| 59 | 816561..818054 | PHAGE_Lactoc_1: NPS; LLNZ_04365; phage(gi13786582) | 4e-87 | Click |
| 60 | 818135..818440 | PHAGE_Lactoc_ul36: hypothetical protein ul36_56; LLNZ_04370; phage(gi21716127) | 1e-51 | Click |
| 61 | 818427..818651 | PHAGE_Lactoc_ul36: putative holin; LLNZ_04375; phage(gi21716128) | 6e-34 | Click |
| 62 | 818648..819937 | PHAGE_Lactoc_1: LYS; LLNZ_04380; phage(gi13786584) | 0.0 | Click |
| 63 | 820119..821078 | PHAGE_Clostr_phiC2: putative abortive infection bacteriophage resistance protein ORF 37; LLNZ_04385; phage(gi134287370) | 8e-15 | Click |
| 64 | 821631..821691 | tRNA | N/A | Click |
| 65 | 821757..821769 | attR CTCTGTCGCTAGG | N/A | Click |
| 66 | 822010..822432 | hypothetical protein; LLNZ_04390 | N/A | Click |
| 67 | 822437..822742 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p02; LLNZ_04395; phage(gi13095864) | 6e-07 | Click |
Region 4, total : 13 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 862536..863828 | PHAGE_Clostr_st: putative uracil permease; LLNZ_04585; phage(gi80159777) | 4e-33 | Click |
| 2 | 864077..865009 | PHAGE_Parame_AR158: hypothetical protein AR158_C204R; LLNZ_04590; phage(gi157953395) | 7e-26 | Click |
| 3 | 865097..866170 | carbamoyl phosphate synthase small subunit; LLNZ_04595 | N/A | Click |
| 4 | complement(866331..866603) | PHAGE_Lactoc_T: hypothetical protein BK5-Tp33; LLNZ_04600; phage(gi14251157) | 1e-26 | Click |
| 5 | complement(866701..867102) | PHAGE_Lactoc_T: hypothetical protein BK5-Tp33; LLNZ_04605; phage(gi14251157) | 3e-51 | Click |
| 6 | complement(867171..867860) | PHAGE_Lactob_Lj965: putative superinfection immunity protein; LLNZ_04610; phage(gi41179219) | 1e-17 | Click |
| 7 | 868243..868404 | hypothetical protein; LLNZ_04615 | N/A | Click |
| 8 | 868486..868788 | hypothetical protein; LLNZ_04620 | N/A | Click |
| 9 | 868906..869166 | PHAGE_Lactob_phiAT3: putative transposase A; LLNZ_04625; phage(gi48697273) | 6e-12 | Click |
| 10 | 869163..870017 | PHAGE_Lactob_phiAT3: putative transposase B; LLNZ_04630; phage(gi48697274) | 6e-48 | Click |
| 11 | 870476..870565 | tRNA | N/A | Click |
| 12 | 870760..871164 | arsenate reductase; LLNZ_04635 | N/A | Click |
| 13 | 871294..872112 | putative serine/threonine phosphatase; LLNZ_04640 | N/A | Click |
| 14 | 872205..873116 | PHAGE_Staphy_JD007: tail lysin; LLNZ_04645; phage(gi428783012) | 1e-10 | Click |
Region 5, total : 22 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1310854..1310868 | attL ATCTTGATAAATTTC | N/A | Click |
| 2 | complement(1316286..1317521) | PROPHAGE_Escher_Sakai: ATP-dependent protease ATP-binding subunit HslU; LLNZ_06930; phage(gi15834112) | 3e-19 | Click |
| 3 | complement(1317603..1317773) | hypothetical protein; LLNZ_06935 | N/A | Click |
| 4 | complement(1317770..1318276) | PHAGE_Bacill_W.Ph.: gp244; LLNZ_06940; phage(gi371671304) | 2e-16 | Click |
| 5 | 1318622..1319131 | putative rRNA methyltransferase; LLNZ_06945 | N/A | Click |
| 6 | 1319349..1319696 | hypothetical protein; LLNZ_06950 | N/A | Click |
| 7 | complement(1319733..1321037) | PHAGE_Clostr_st: putative uracil permease; LLNZ_06955; phage(gi80159777) | 4e-18 | Click |
| 8 | complement(1321095..1321688) | xanthine phosphoribosyltransferase; LLNZ_06960 | N/A | Click |
| 9 | complement(1322365..1322649) | PHAGE_Entero_N15: gp48; LLNZ_06965; phage(gi9630515) | 3e-05 | Click |
| 10 | complement(1322636..1323001) | PHAGE_Entero_N15: gp49; LLNZ_06970; phage(gi9630516) | 9e-05 | Click |
| 11 | complement(1323429..1324499) | PHAGE_Caulob_CcrColossus: DUF475 protein; LLNZ_06975; phage(gi414088276) | 7e-66 | Click |
| 12 | complement(1324586..1325161) | PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; LLNZ_06980; phage(gi414088275) | 1e-23 | Click |
| 13 | complement(1325177..1325752) | PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; LLNZ_06985; phage(gi414088275) | 3e-26 | Click |
| 14 | complement(1325762..1326385) | PHAGE_Caulob_CcrColossus: putative TerD-like bacterial stress protein; LLNZ_06990; phage(gi414088275) | 2e-21 | Click |
| 15 | complement(1326465..1327562) | PHAGE_Cronob_vB_CsaM_GAP32: toxic ion resistance protein; LLNZ_06995; phage(gi414087253) | 1e-18 | Click |
| 16 | complement(1327580..1329169) | hypothetical protein; LLNZ_07000 | N/A | Click |
| 17 | complement(1329210..1330031) | hypothetical protein; LLNZ_07005 | N/A | Click |
| 18 | complement(1330033..1331139) | hypothetical protein; LLNZ_07010 | N/A | Click |
| 19 | complement(1331136..1332332) | hypothetical protein; LLNZ_07015 | N/A | Click |
| 20 | complement(1332325..1333551) | hypothetical protein; LLNZ_07020 | N/A | Click |
| 21 | complement(1334863..1335147) | PHAGE_Entero_N15: gp48; LLNZ_07025; phage(gi9630515) | 3e-05 | Click |
| 22 | complement(1335134..1335499) | PHAGE_Entero_N15: gp49; LLNZ_07030; phage(gi9630516) | 9e-05 | Click |
| 23 | 1335464..1335478 | attR ATCTTGATAAATTTC | N/A | Click |
| 24 | complement(1335570..1336625) | PHAGE_Thermu_26: phage XerD-like integrase; LLNZ_07035; phage(gi157265417) | 4e-09 | Click |
Region 6, total : 65 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2061853..2062629) | PHAGE_Cronob_phiES15: putative serine/threonine phosphatase; LLNZ_10700; phage(gi401817585) | 4e-11 | Click |
| 2 | complement(2062752..2064026) | ribosomal RNA small subunit methyltransferase B; LLNZ_10705 | N/A | Click |
| 3 | 2064138..2064160 | attL AACGTAACTAAAAACGTAACTAA | N/A | Click |
| 4 | complement(2064273..2064333) | tRNA | N/A | Click |
| 5 | complement(2065234..2066091) | PHAGE_Lactoc_lato: putative lysin; LLNZ_10710; phage(gi30089910) | 1e-107 | Click |
| 6 | complement(2066093..2066554) | PHAGE_Lactoc_lato: putative holin; LLNZ_10715; phage(gi30089909) | 1e-55 | Click |
| 7 | complement(2066570..2066917) | PHAGE_Lactoc_lato: hypothetical protein P335p47; LLNZ_10720; phage(gi30089908) | 2e-54 | Click |
| 8 | complement(2066930..2067166) | PHAGE_Lactoc_T: hypothetical protein BK5-Tp24; LLNZ_10725; phage(gi14251148) | 1e-35 | Click |
| 9 | complement(2067182..2072035) | PHAGE_Lactoc_lato: putative tail-host specificity protein; LLNZ_10730; phage(gi30089906) | 0.0 | Click |
| 10 | complement(2073682..2078829) | PHAGE_Lactoc_lato: putative tail lysin; LLNZ_10745; phage(gi30089904) | 0.0 | Click |
| 11 | complement(2079052..2079468) | PHAGE_Lactoc_lato: putative tail component; LLNZ_10750; phage(gi30089902) | 2e-70 | Click |
| 12 | complement(2079613..2080206) | PHAGE_Lactoc_lato: major structural protein; LLNZ_10755; phage(gi30089901) | 8e-108 | Click |
| 13 | complement(2080237..2080632) | PHAGE_Lactoc_lato: hypothetical protein P335p39; LLNZ_10760; phage(gi30089900) | 1e-67 | Click |
| 14 | complement(2080629..2081135) | PHAGE_Lactoc_lato: hypothetical protein P335p38; LLNZ_10765; phage(gi30089899) | 2e-90 | Click |
| 15 | complement(2081137..2081487) | PHAGE_Lactoc_lato: hypothetical protein P335p37; LLNZ_10770; phage(gi30089898) | 3e-57 | Click |
| 16 | complement(2081462..2081785) | PHAGE_Lactoc_lato: hypothetical protein P335p36; LLNZ_10775; phage(gi30089897) | 2e-53 | Click |
| 17 | complement(2081986..2083200) | PHAGE_Lactoc_lato: major structural protein; LLNZ_10780; phage(gi30089896) | 0.0 | Click |
| 18 | complement(2083212..2083916) | PHAGE_Lactoc_lato: putative ClpP protease; LLNZ_10785; phage(gi30089895) | 4e-130 | Click |
| 19 | complement(2083962..2085140) | PHAGE_Lactoc_lato: putative portal protein; LLNZ_10790; phage(gi30089894) | 0.0 | Click |
| 20 | complement(2085137..2085328) | PHAGE_Lactoc_lato: hypothetical protein P335p32; LLNZ_10795; phage(gi30089893) | 5e-12 | Click |
| 21 | complement(2085315..2086913) | PHAGE_Lactoc_lato: putative terminase large subunit; LLNZ_10800; phage(gi30089892) | 0.0 | Click |
| 22 | complement(2088262..2088546) | PHAGE_Lactoc_lato: putative terminase large subunit; LLNZ_10815; phage(gi30089892) | 2e-50 | Click |
| 23 | complement(2088536..2088934) | PHAGE_Lactoc_lato: putative terminase small subunit; LLNZ_10820; phage(gi30089891) | 5e-20 | Click |
| 24 | complement(2089116..2089634) | PHAGE_Lactoc_lato: hypothetical protein P335p29; LLNZ_10825; phage(gi30089890) | 9e-102 | Click |
| 25 | complement(2089638..2089928) | hypothetical protein; LLNZ_10830 | N/A | Click |
| 26 | complement(2089987..2090057) | tRNA | N/A | Click |
| 27 | complement(2090305..2090706) | PHAGE_Lactoc_lato: hypothetical protein P335p28; LLNZ_10835; phage(gi30089889) | 8e-68 | Click |
| 28 | complement(2090789..2090974) | PHAGE_Lactoc_lato: hypothetical protein P335p27; LLNZ_10840; phage(gi30089888) | 9e-29 | Click |
| 29 | complement(2090971..2091279) | hypothetical protein; LLNZ_10845 | N/A | Click |
| 30 | complement(2091281..2091460) | hypothetical protein; LLNZ_10850 | N/A | Click |
| 31 | complement(2091462..2091635) | PHAGE_Lactoc_lato: hypothetical protein P335p26; LLNZ_10855; phage(gi30089887) | 3e-25 | Click |
| 32 | complement(2091711..2092469) | PROPHAGE_Escher_CFT073: transposase/IS protein; LLNZ_10860; phage(gi26248359) | 9e-37 | Click |
| 33 | complement(2092481..2093704) | PROPHAGE_Escher_CFT073: transposase; LLNZ_10865; phage(gi26248360) | 2e-28 | Click |
| 34 | complement(2093760..2093903) | PHAGE_Lactoc_lato: hypothetical protein P335p26; LLNZ_10870; phage(gi30089887) | 1e-15 | Click |
| 35 | 2094264..2094473 | hypothetical protein; LLNZ_10875 | N/A | Click |
| 36 | complement(2094522..2094722) | PHAGE_Lactoc_lato: hypothetical protein P335p22; LLNZ_10880; phage(gi30089883) | 1e-06 | Click |
| 37 | complement(2094719..2094949) | PHAGE_Lactoc_1: ORF25; LLNZ_10885; phage(gi13786556) | 2e-10 | Click |
| 38 | complement(2094968..2095306) | PHAGE_Lactoc_bIL286: Orf31; LLNZ_10890; phage(gi13095774) | 4e-54 | Click |
| 39 | complement(2095307..2095726) | PHAGE_Lactoc_bIL309: dUTPase; LLNZ_10895; phage(gi13095829) | 4e-72 | Click |
| 40 | complement(2095723..2096280) | PHAGE_Lactoc_bIL286: Orf27; LLNZ_10900; phage(gi13095770) | 3e-24 | Click |
| 41 | complement(2096296..2096532) | PHAGE_Lactoc_sk1: hypothetical protein sk1p39; LLNZ_10905; phage(gi9629691) | 1e-14 | Click |
| 42 | complement(2096513..2096707) | hypothetical protein; LLNZ_10910 | N/A | Click |
| 43 | complement(2096704..2096901) | PHAGE_Lactoc_ul36: hypothetical protein ul36_21; LLNZ_10915; phage(gi21716092) | 2e-09 | Click |
| 44 | complement(2096902..2097168) | hypothetical protein; LLNZ_10920 | N/A | Click |
| 45 | complement(2097149..2097481) | hypothetical protein; LLNZ_10925 | N/A | Click |
| 46 | complement(2098128..2098367) | PHAGE_Lactoc_1: ORF16; LLNZ_10940; phage(gi13786547) | 1e-39 | Click |
| 47 | complement(2098364..2098738) | PHAGE_Lactoc_bIL286: Orf19; LLNZ_10945; phage(gi13095762) | 2e-64 | Click |
| 48 | complement(2098735..2099460) | PHAGE_Lactoc_bIL285: Orf17; LLNZ_10950; phage(gi13095697) | 1e-131 | Click |
| 49 | complement(2099460..2100242) | PHAGE_Lactoc_Tuc2009: replication initiation protein; LLNZ_10955; phage(gi13487815) | 2e-144 | Click |
| 50 | complement(2100371..2100796) | PHAGE_Lactoc_ul36: putative single stranded binding protein; LLNZ_10960; phage(gi21716085) | 4e-77 | Click |
| 51 | complement(2100789..2100923) | PHAGE_Lactoc_ul36: putative translation initiation factor; LLNZ_10965; phage(gi21716084) | 3e-18 | Click |
| 52 | complement(2100932..2101183) | hypothetical protein; LLNZ_10970 | N/A | Click |
| 53 | complement(2101176..2101547) | PHAGE_Lactoc_ul36: putative translation initiation factor; LLNZ_10975; phage(gi21716084) | 4e-70 | Click |
| 54 | complement(2101556..2101951) | PHAGE_Lactoc_bIL286: Orf13; LLNZ_10980; phage(gi13095756) | 6e-71 | Click |
| 55 | complement(2102050..2102292) | PHAGE_Lactoc_T: hypothetical protein BK5-Tp44; LLNZ_10985; phage(gi14251168) | 1e-37 | Click |
| 56 | 2102400..2102777 | PHAGE_Staphy_3A: ORF031; LLNZ_10990; phage(gi66395619) | 7e-21 | Click |
| 57 | complement(2102770..2102973) | PHAGE_Staphy_SpaA1: XRE family transcriptional regulator; LLNZ_10995; phage(gi399498907) | 4e-05 | Click |
| 58 | complement(2103069..2103338) | hypothetical protein; LLNZ_11000 | N/A | Click |
| 59 | complement(2103352..2104110) | PHAGE_Lactob_1: antirepressor; LLNZ_11005; phage(gi219563224) | 8e-75 | Click |
| 60 | complement(2104123..2104371) | PHAGE_Staphy_37: ORF071; LLNZ_11010; phage(gi66395787) | 5e-06 | Click |
| 61 | 2104476..2104712 | hypothetical protein; LLNZ_11015 | N/A | Click |
| 62 | complement(2104684..2104905) | hypothetical protein; LLNZ_11020 | N/A | Click |
| 63 | 2105003..2105116 | hypothetical protein; LLNZ_11025 | N/A | Click |
| 64 | complement(2105280..2105477) | hypothetical protein; LLNZ_11030 | N/A | Click |
| 65 | 2105761..2106258 | PHAGE_Lactoc_r1t: Repressor; LLNZ_11035; phage(gi23455722) | 3e-16 | Click |
| 66 | 2106264..2106698 | PHAGE_Lactoc_bIL285: Orf3; LLNZ_11040; phage(gi13095683) | 6e-15 | Click |
| 67 | 2106712..2107047 | hypothetical protein; LLNZ_11045 | N/A | Click |
| 68 | 2107115..2108296 | PHAGE_Lactoc_bIL310: integrase; LLNZ_11050; phage(gi13095863) | 2e-96 | Click |
| 69 | 2108316..2108338 | attR AACGTAACTAAAAACGTAACTAA | N/A | Click |
Region 7, total : 28 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2204031..2204046 | attL TAAAGCTGTCAGTAAA | N/A | Click |
| 2 | complement(2211673..2212995) | putative abortive phage resistance; LLNZ_11595 | N/A | Click |
| 3 | complement(2213134..2213259) | hypothetical protein; LLNZ_11600 | N/A | Click |
| 4 | complement(2213442..2213774) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p29; LLNZ_11605; phage(gi13095890) | 1e-05 | Click |
| 5 | complement(2213774..2214214) | PHAGE_Lactoc_bIL310: terminase; LLNZ_11610; phage(gi13095888) | 7e-74 | Click |
| 6 | complement(2214347..2214889) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p26; LLNZ_11615; phage(gi13095887) | 3e-54 | Click |
| 7 | complement(2215106..2216734) | PHAGE_Lactoc_bIL310: helicase; LLNZ_11620; phage(gi13095886) | 0.0 | Click |
| 8 | complement(2216745..2217539) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p24; LLNZ_11625; phage(gi13095885) | 5e-152 | Click |
| 9 | complement(2217536..2217871) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p23; LLNZ_11630; phage(gi13095884) | 3e-55 | Click |
| 10 | complement(2217941..2218180) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p20; LLNZ_11635; phage(gi13095881) | 1e-36 | Click |
| 11 | complement(2218218..2218499) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p19; LLNZ_11640; phage(gi13095880) | 2e-46 | Click |
| 12 | complement(2218492..2218617) | hypothetical protein; LLNZ_11645 | N/A | Click |
| 13 | complement(2218633..2218728) | hypothetical protein; LLNZ_11650 | N/A | Click |
| 14 | complement(2218721..2218924) | hypothetical protein; LLNZ_11655 | N/A | Click |
| 15 | complement(2218921..2219442) | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p17; LLNZ_11660; phage(gi13095878) | 2e-74 | Click |
| 16 | complement(2219701..2220366) | PHAGE_Lactoc_bIL310: anti-repressor; LLNZ_11665; phage(gi13095876) | 2e-09 | Click |
| 17 | complement(2220529..2220750) | PHAGE_Brocho_BL3: gp41; LLNZ_11670; phage(gi327409433) | 1e-07 | Click |
| 18 | 2220921..2221463 | PHAGE_Lactoc_lato: hypothetical protein P335p08; LLNZ_11675; phage(gi30089869) | 5e-13 | Click |
| 19 | 2221685..2221915 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p10; LLNZ_11680; phage(gi13095871) | 3e-34 | Click |
| 20 | 2221988..2222182 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p09; LLNZ_11685; phage(gi13095870) | 3e-29 | Click |
| 21 | 2222364..2223098 | hypothetical protein; LLNZ_11690 | N/A | Click |
| 22 | 2223304..2223489 | hypothetical protein; LLNZ_11695 | N/A | Click |
| 23 | 2223489..2223674 | hypothetical protein; LLNZ_11700 | N/A | Click |
| 24 | 2223676..2224740 | hypothetical protein; LLNZ_11705 | N/A | Click |
| 25 | complement(2224760..2224930) | hypothetical protein; LLNZ_11710 | N/A | Click |
| 26 | 2225392..2225706 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p06; LLNZ_11715; phage(gi19343482) | 2e-16 | Click |
| 27 | 2226238..2226387 | hypothetical protein; LLNZ_11720 | N/A | Click |
| 28 | 2226510..2226704 | PHAGE_Lactoc_bIL310: hypothetical protein bIL310p03; LLNZ_11725; phage(gi13095865) | 5e-12 | Click |
| 29 | 2227201..2228382 | PHAGE_Lactoc_bIL310: integrase; LLNZ_11730; phage(gi13095863) | 2e-94 | Click |
| 30 | 2238469..2238484 | attR TAAAGCTGTCAGTAAA | N/A | Click |