| Definition | Staphylococcus aureus subsp. aureus ED133, complete genome. |
|---|---|
| Accession | CP001996 |
| Length | 2,832,478 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 70 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 319127..321085 | PHAGE_Megavi_lba: hypothetical protein; SAOV_0273; phage(gi448825249) | 6e-06 | Click |
| 2 | 321137..321149 | attL AAAAAGGGCAGAT | N/A | Click |
| 3 | complement(321155..322360) | PHAGE_Staphy_SMSAP5: site-specific recombinase; SAOV_0274; phage(gi422935807) | 0.0 | Click |
| 4 | complement(322463..323113) | CAAX amino terminal protease family; SAOV_0275 | N/A | Click |
| 5 | complement(323256..323381) | PHAGE_Staphy_SMSAP5: hypothetical protein; SAOV_0276; phage(gi422935827) | 5e-12 | Click |
| 6 | complement(323586..324020) | PHAGE_Staphy_SMSAP5: putative liporotein; SAOV_0277; phage(gi422935819) | 3e-73 | Click |
| 7 | complement(324038..324409) | PHAGE_Staphy_SMSAP5: hypothetical protein; SAOV_0278; phage(gi422935827) | 1e-67 | Click |
| 8 | complement(324512..324841) | PHAGE_Staphy_SMSAP5: putative phage regulatory protein; SAOV_0279; phage(gi422935832) | 4e-58 | Click |
| 9 | 325002..325193 | PHAGE_Staphy_IPLA35: cro; SAOV_0280; phage(gi215401115) | 2e-30 | Click |
| 10 | 325281..325457 | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp08; SAOV_0281; phage(gi215401116) | 5e-29 | Click |
| 11 | complement(325454..325684) | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp09; SAOV_0282; phage(gi215401117) | 3e-38 | Click |
| 12 | 325741..326493 | PHAGE_Staphy_187: ORF017; SAOV_0283; phage(gi66395232) | 8e-141 | Click |
| 13 | 326509..326706 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp10; SAOV_0284; phage(gi156603959) | 7e-32 | Click |
| 14 | 326852..327115 | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp11; SAOV_0285; phage(gi215401119) | 8e-47 | Click |
| 15 | 327392..327694 | PHAGE_Staphy_phiSLT: hypothetical protein phiSLTp14; SAOV_0286; phage(gi12719406) | 3e-34 | Click |
| 16 | 327699..327959 | PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp14; SAOV_0287; phage(gi122891728) | 8e-43 | Click |
| 17 | 327969..328190 | PHAGE_Staphy_phiETA2: hypothetical protein phiETA2_gp15; SAOV_0288; phage(gi122891729) | 5e-37 | Click |
| 18 | 328183..328806 | PHAGE_Staphy_phiMR25: hypothetical protein; SAOV_0289; phage(gi189427137) | 1e-117 | Click |
| 19 | 328806..329225 | PHAGE_Staphy_X2: ORF033; SAOV_0290; phage(gi66394702) | 2e-76 | Click |
| 20 | 329239..329934 | PHAGE_Staphy_X2: ORF017; SAOV_0291; phage(gi66394687) | 1e-124 | Click |
| 21 | 329906..330706 | PHAGE_Staphy_71: ORF015; SAOV_0292; phage(gi66396055) | 2e-146 | Click |
| 22 | 330706..331062 | PHAGE_Staphy_96: ORF042; SAOV_0293; phage(gi66395927) | 2e-66 | Click |
| 23 | 331059..332300 | PHAGE_Staphy_42E: ORF007; SAOV_0294; phage(gi66395515) | 0.0 | Click |
| 24 | 332297..332512 | PHAGE_Staphy_phiMR11: hypothetical protein; SAOV_0295; phage(gi162290127) | 1e-35 | Click |
| 25 | 332515..332736 | PHAGE_Staphy_phiETA: hypothetical protein phiETA_24; SAOV_0296; phage(gi17426252) | 2e-37 | Click |
| 26 | 332746..333153 | PHAGE_Staphy_phiMR11: putative resolvase; SAOV_0297; phage(gi162290129) | 2e-74 | Click |
| 27 | 333153..333338 | PHAGE_Staphy_96: ORF100; SAOV_0298; phage(gi66395957) | 8e-28 | Click |
| 28 | 333339..333596 | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p25; SAOV_0299; phage(gi9635701) | 4e-43 | Click |
| 29 | 333608..333979 | PHAGE_Staphy_phiPV83: phi PVL ORF 50; SAOV_0300; phage(gi9635702) | 9e-67 | Click |
| 30 | 333980..334228 | PHAGE_Staphy_42E: ORF064; SAOV_0301; phage(gi66395564) | 4e-43 | Click |
| 31 | 334239..334448 | PHAGE_Staphy_phiMR25: hypothetical protein; SAOV_0302; phage(gi189427151) | 1e-30 | Click |
| 32 | 334451..334861 | PHAGE_Staphy_SA11: hypothetical protein; SAOV_0303; phage(gi422935588) | 7e-48 | Click |
| 33 | 334861..335136 | PHAGE_Staphy_X2: ORF058; SAOV_0304; phage(gi66394720) | 2e-49 | Click |
| 34 | 335129..335377 | PHAGE_Staphy_phiETA3: hypothetical protein phiETA3_gp32; SAOV_0305; phage(gi122891816) | 2e-40 | Click |
| 35 | 335370..335906 | PHAGE_Staphy_55: ORF023; SAOV_0306; phage(gi66396136) | 5e-98 | Click |
| 36 | 335943..336227 | hypothetical protein; SAOV_0307 | N/A | Click |
| 37 | 336244..336450 | hypothetical protein; SAOV_0308 | N/A | Click |
| 38 | 336447..336653 | PHAGE_Staphy_42E: ORF081; SAOV_0309; phage(gi66395571) | 3e-31 | Click |
| 39 | 336650..336802 | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp30; SAOV_0310; phage(gi215401138) | 2e-22 | Click |
| 40 | 336870..337070 | PHAGE_Staphy_3A: ORF059; SAOV_0311; phage(gi66395640) | 1e-29 | Click |
| 41 | 337119..339566 | PHAGE_Staphy_SMSAP5: virulence-associated protein E; SAOV_0312; phage(gi422935798) | 0.0 | Click |
| 42 | 339907..340197 | PHAGE_Staphy_phi7401PVL: hypothetical protein; SAOV_0313; phage(gi448244659) | 5e-53 | Click |
| 43 | 340178..341545 | PHAGE_Staphy_3A: ORF009; SAOV_0314; phage(gi66395597) | 0.0 | Click |
| 44 | 341558..341995 | PHAGE_Staphy_SMSAP5: phage regulatory protein; SAOV_0315; phage(gi422935818) | 5e-80 | Click |
| 45 | 342152..342466 | PHAGE_Staphy_42E: ORF046; SAOV_0316; phage(gi66395552) | 1e-59 | Click |
| 46 | 342576..342899 | PHAGE_Staphy_SMSAP5: terminase-small subunit; SAOV_0317; phage(gi422935834) | 2e-56 | Click |
| 47 | 342889..344580 | PHAGE_Staphy_42E: ORF003; SAOV_0318; phage(gi66395511) | 0.0 | Click |
| 48 | 344585..345613 | PHAGE_Staphy_phi7401PVL: portal protein; SAOV_0319; phage(gi448244665) | 0.0 | Click |
| 49 | 345806..346579 | PHAGE_Staphy_SMSAP5: protease; SAOV_0320; phage(gi422935811) | 2e-141 | Click |
| 50 | 346591..347754 | PHAGE_Staphy_SMSAP5: putative capsid protein; SAOV_0321; phage(gi422935806) | 0.0 | Click |
| 51 | 347823..348101 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp49; SAOV_0322; phage(gi156603998) | 7e-48 | Click |
| 52 | 348113..348445 | PHAGE_Staphy_SMSAP5: hypothetical protein; SAOV_0323; phage(gi422935831) | 6e-57 | Click |
| 53 | 348442..348843 | PHAGE_Staphy_SMSAP5: putative DNA-binding protein; SAOV_0324; phage(gi422935822) | 5e-70 | Click |
| 54 | 348844..349239 | PHAGE_Staphy_SMSAP5: hypothetical protein; SAOV_0325; phage(gi422935824) | 3e-69 | Click |
| 55 | 349274..349915 | PHAGE_Staphy_SMSAP5: major tail protein; SAOV_0326; phage(gi422935812) | 1e-119 | Click |
| 56 | 350007..350462 | PHAGE_Staphy_SMSAP5: major tail protein; SAOV_0327; phage(gi422935817) | 4e-79 | Click |
| 57 | 350489..350839 | PHAGE_Staphy_12: SLT orf 116b-like protein; SAOV_0328; phage(gi29028656) | 6e-62 | Click |
| 58 | 350881..351039 | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp49; SAOV_0329; phage(gi215401157) | 5e-24 | Click |
| 59 | 351053..354100 | PHAGE_Staphy_SMSAP5: phage tail tape measure protein; SAOV_0330; phage(gi422935797) | 0.0 | Click |
| 60 | 354052..357252 | PHAGE_Staphy_SMSAP5: phage tail tape measure protein; SAOV_0331; phage(gi422935797) | 0.0 | Click |
| 61 | 357252..358076 | PHAGE_Staphy_2: phage tail tape measure protein like; SAOV_0332; phage(gi156604006) | 4e-160 | Click |
| 62 | 358085..359668 | PHAGE_Staphy_SMSAP5: prophage endopeptidase tail family protein; SAOV_0333; phage(gi422935801) | 0.0 | Click |
| 63 | 359668..359958 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp59; SAOV_0334; phage(gi156604008) | 5e-51 | Click |
| 64 | 359974..361884 | PHAGE_Staphy_SMSAP5: minor structural protein; SAOV_0335; phage(gi422935800) | 0.0 | Click |
| 65 | 361884..363350 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp61; SAOV_0336; phage(gi156604010) | 0.0 | Click |
| 66 | 363350..363739 | PHAGE_Staphy_SMSAP5: hypothetical protein; SAOV_0337; phage(gi422935825) | 2e-62 | Click |
| 67 | 363732..363896 | PHAGE_Staphy_2: hypothetical protein SPTP3102_gp63; SAOV_0338; phage(gi156604012) | 3e-26 | Click |
| 68 | 363942..364241 | PHAGE_Staphy_42E: ORF047; SAOV_0339; phage(gi66395553) | 3e-52 | Click |
| 69 | 364384..364491 | hypothetical protein; SAOV_0340 | N/A | Click |
| 70 | 364780..365082 | PHAGE_Staphy_12: holin; SAOV_0341; phage(gi29028665) | 7e-50 | Click |
| 71 | 365094..366548 | PHAGE_Staphy_SMSAP5: putative amidase; SAOV_0342; phage(gi422935803) | 0.0 | Click |
| 72 | 368593..368605 | attR AAAAAGGGCAGAT | N/A | Click |
Region 2, total : 18 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 434650..434673 | attL ATTGAGTGGGAATAATTATATATA | N/A | Click |
| 2 | complement(434758..435894) | PROPHAGE_Oceano_HTE831: integrase; SAOV_0414c; phage(gi23097608) | 3e-85 | Click |
| 3 | complement(435978..436763) | pathogenicity island protein; SAOV_0415c | N/A | Click |
| 4 | 436880..437107 | hypothetical protein; SAOV_0416 | N/A | Click |
| 5 | 437153..437413 | pathogenicity island protein; SAOV_0417 | N/A | Click |
| 6 | 437460..437606 | pathogenicity island protein; SAOV_0419 | N/A | Click |
| 7 | 437671..437823 | pathogenicity island protein; SAOV_0418 | N/A | Click |
| 8 | 437824..438117 | PHAGE_Staphy_PT1028: ORF016; SAOV_0420; phage(gi66395180) | 3e-14 | Click |
| 9 | 438208..440571 | PHAGE_Strept_858: orf40; SAOV_0421; phage(gi168229313) | 1e-95 | Click |
| 10 | 440993..441337 | PHAGE_Staphy_PT1028: ORF013; SAOV_0422; phage(gi66395177) | 1e-08 | Click |
| 11 | 441562..441768 | pathogenicity island protein; SAOV_0423 | N/A | Click |
| 12 | 441755..442813 | PHAGE_Staphy_2: phage capsid; SAOV_0424; phage(gi156603997) | 6e-16 | Click |
| 13 | 442995..443486 | PHAGE_Staphy_PT1028: ORF010; SAOV_0425; phage(gi66395174) | 3e-26 | Click |
| 14 | 443510..443638 | PHAGE_Staphy_PT1028: ORF009; SAOV_0426; phage(gi66395173) | 4e-16 | Click |
| 15 | complement(443793..444497) | toxic shock syndrome toxin-1; SAOV_0427c | N/A | Click |
| 16 | 444958..445308 | PHAGE_Staphy_PT1028: ORF026; SAOV_0428; phage(gi66395186) | 8e-23 | Click |
| 17 | 445427..445939 | PHAGE_Staphy_PT1028: ORF011; SAOV_0429; phage(gi66395175) | 2e-91 | Click |
| 18 | 446711..447511 | PHAGE_Strept_2: streptococcal superantigen SSA; SAOV_0430; phage(gi28876204) | 2e-83 | Click |
| 19 | complement(447678..448400) | PHAGE_Staphy_phiNM3: enterotoxin type A precursor; SAOV_0431c; phage(gi118725111) | 1e-29 | Click |
| 20 | 448668..448691 | attR ATTGAGTGGGAATAATTATATATA | N/A | Click |
Region 3, total : 59 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1107537..1107548 | attL CAATTATATGAT | N/A | Click |
| 2 | complement(1107930..1109315) | PHAGE_Staphy_TEM123: integrase; SAOV_1070c; phage(gi388570325) | 0.0 | Click |
| 3 | complement(1109368..1109595) | PHAGE_Staphy_phiETA: hypothetical protein phiETA_02; SAOV_1071c; phage(gi17426230) | 4e-35 | Click |
| 4 | complement(1109705..1110208) | hypothetical protein; SAOV_1072c | N/A | Click |
| 5 | complement(1110244..1110429) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p04; SAOV_1073c; phage(gi9635681) | 2e-28 | Click |
| 6 | complement(1110584..1111294) | PHAGE_Staphy_phi5967PVL: repressor; SAOV_1074c; phage(gi431810247) | 1e-130 | Click |
| 7 | 1111466..1111705 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1075; phage(gi431810248) | 1e-38 | Click |
| 8 | 1111718..1112161 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1076; phage(gi431810249) | 1e-77 | Click |
| 9 | 1112575..1113288 | PHAGE_Staphy_92: ORF018; SAOV_1077; phage(gi66396424) | 7e-115 | Click |
| 10 | 1113968..1114135 | PHAGE_Staphy_phiPV83: phi PVL ORF 38 homologue; SAOV_1078; phage(gi9635690) | 3e-26 | Click |
| 11 | 1114548..1114808 | PHAGE_Staphy_80alpha: hypothetical protein SPV-80A_gp14; SAOV_1079; phage(gi148717856) | 7e-43 | Click |
| 12 | 1114818..1115039 | PHAGE_Staphy_phiETA: hypothetical protein phiETA_16; SAOV_1080; phage(gi17426244) | 1e-37 | Click |
| 13 | 1115655..1116080 | PHAGE_Staphy_IPLA88: putative ssDNA binding protein; SAOV_1081; phage(gi215401185) | 1e-74 | Click |
| 14 | 1116761..1117513 | PHAGE_Staphy_42E: ORF016; SAOV_1082; phage(gi66395524) | 4e-125 | Click |
| 15 | 1117866..1119107 | PHAGE_Staphy_P954: helicase DnaB; SAOV_1083; phage(gi257136378) | 0.0 | Click |
| 16 | 1119104..1119319 | PHAGE_Staphy_IPLA88: hypothetical protein SauSIPLA88_gp20; SAOV_1084; phage(gi215401190) | 5e-36 | Click |
| 17 | 1119554..1119958 | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp23; SAOV_1085; phage(gi156604040) | 5e-75 | Click |
| 18 | 1120212..1120520 | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp24; SAOV_1086; phage(gi156604041) | 2e-54 | Click |
| 19 | 1120521..1120769 | PHAGE_Staphy_42E: ORF064; SAOV_1087; phage(gi66395564) | 4e-43 | Click |
| 20 | 1120780..1121031 | PHAGE_Staphy_phiMR25: hypothetical protein; SAOV_1088; phage(gi189427151) | 1e-30 | Click |
| 21 | 1120994..1121404 | PHAGE_Staphy_SA11: hypothetical protein; SAOV_1089; phage(gi422935588) | 7e-48 | Click |
| 22 | 1121404..1121679 | PHAGE_Staphy_X2: ORF058; SAOV_1090; phage(gi66394720) | 8e-49 | Click |
| 23 | 1121672..1121920 | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp27; SAOV_1091; phage(gi215401135) | 5e-40 | Click |
| 24 | 1121913..1122425 | PHAGE_Staphy_80alpha: dUTPase; SAOV_1092; phage(gi148717874) | 8e-90 | Click |
| 25 | 1122462..1122704 | PHAGE_Staphy_phiMR11: hypothetical protein; SAOV_1093; phage(gi162290140) | 5e-06 | Click |
| 26 | 1122716..1122898 | hypothetical protein; SAOV_1094 | N/A | Click |
| 27 | 1122898..1123104 | PHAGE_Staphy_42E: ORF081; SAOV_1095; phage(gi66395571) | 3e-31 | Click |
| 28 | 1123101..1123250 | PHAGE_Staphy_phiNM3: hypothetical protein; SAOV_1096; phage(gi118725087) | 7e-21 | Click |
| 29 | 1123250..1123450 | PHAGE_Staphy_phiPV83: phi PVL ORF 60 homologue; SAOV_1097; phage(gi9635710) | 5e-32 | Click |
| 30 | 1123478..1123894 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1098; phage(gi431810266) | 2e-78 | Click |
| 31 | 1124126..1124425 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1099; phage(gi431810267) | 1e-55 | Click |
| 32 | 1124511..1124900 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1100; phage(gi431810268) | 1e-70 | Click |
| 33 | 1124897..1126558 | PHAGE_Staphy_phiNM3: phage terminase; SAOV_1101; phage(gi118725092) | 0.0 | Click |
| 34 | 1126574..1127761 | PHAGE_Staphy_phi5967PVL: phage portal protein; SAOV_1102; phage(gi431810270) | 0.0 | Click |
| 35 | 1127745..1128482 | PHAGE_Staphy_phi5967PVL: S14 family endopeptidase ClpP; SAOV_1103; phage(gi431810271) | 8e-133 | Click |
| 36 | 1128506..1129651 | PHAGE_Staphy_phi5967PVL: phage major capsid protein; SAOV_1104; phage(gi431810272) | 0.0 | Click |
| 37 | 1129672..1129956 | PHAGE_Staphy_P954: hypothetical protein; SAOV_1105; phage(gi257136407) | 3e-39 | Click |
| 38 | 1129946..1130230 | PHAGE_Staphy_phiNM3: hypothetical protein; SAOV_1106; phage(gi118725097) | 2e-39 | Click |
| 39 | 1130214..1130576 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1107; phage(gi431810273) | 1e-59 | Click |
| 40 | 1130573..1130977 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1108; phage(gi431810274) | 3e-66 | Click |
| 41 | 1130974..1131381 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1109; phage(gi431810275) | 9e-72 | Click |
| 42 | 1131382..1132023 | PHAGE_Staphy_phi5967PVL: phi13 family phage major tail protein; SAOV_1110; phage(gi431810276) | 1e-112 | Click |
| 43 | 1132149..1132289 | PHAGE_Staphy_phiNM3: hypothetical protein; SAOV_1111; phage(gi118725102) | 3e-12 | Click |
| 44 | 1132338..1132688 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1112; phage(gi431810277) | 9e-61 | Click |
| 45 | 1132715..1132876 | PHAGE_Staphy_77: 77ORF100; SAOV_1113; phage(gi41189576) | 2e-24 | Click |
| 46 | 1132933..1136046 | PHAGE_Staphy_phi5967PVL: phage tail tape measure protein; SAOV_1114; phage(gi431810278) | 0.0 | Click |
| 47 | 1136088..1137443 | PHAGE_Staphy_3: tail length tape measure protein; SAOV_1115; phage(gi156604065) | 0.0 | Click |
| 48 | 1137440..1138924 | PHAGE_Staphy_77: 77ORF004; SAOV_1116; phage(gi41189519) | 0.0 | Click |
| 49 | 1138940..1142725 | PHAGE_Staphy_77: 77ORF002; SAOV_1117; phage(gi41189517) | 0.0 | Click |
| 50 | 1142914..1143201 | PHAGE_Staphy_phiPV83: phi PVL ORF 22 homologue; SAOV_1118; phage(gi9635732) | 2e-47 | Click |
| 51 | 1143257..1143664 | PHAGE_Staphy_phi5967PVL: hypothetical protein; SAOV_1119; phage(gi431810282) | 7e-56 | Click |
| 52 | 1144119..1144898 | PHAGE_Staphy_phiNM3: enterotoxin type A precursor; SAOV_1120; phage(gi118725111) | 1e-129 | Click |
| 53 | 1145478..1145915 | PHAGE_Staphy_IPLA88: putative holin; SAOV_1121; phage(gi215401230) | 1e-76 | Click |
| 54 | 1145896..1146537 | PHAGE_Staphy_X2: ORF018; SAOV_1122; phage(gi66394688) | 6e-128 | Click |
| 55 | 1146567..1147112 | PHAGE_Staphy_X2: ORF027; SAOV_1123; phage(gi66394696) | 6e-104 | Click |
| 56 | 1147655..1148275 | PHAGE_Staphy_X2: ORF019; SAOV_1124; phage(gi66394689) | 2e-123 | Click |
| 57 | complement(1148912..1150837) | PHAGE_Thermu_TMA: hypothetical protein; SAOV_1125c; phage(gi343960457) | 7e-11 | Click |
| 58 | complement(1151040..1152104) | PHAGE_Orf_virus: ORF116 hypothetical protein; SAOV_1126c; phage(gi41057179) | 3e-06 | Click |
| 59 | 1152554..1152997 | NPQTN cell wall anchored protein IsdC; SAOV_1127 | N/A | Click |
| 60 | 1152997..1154073 | PHAGE_Acanth_mimivirus: hypothetical protein; SAOV_1128; phage(gi311977577) | 1e-08 | Click |
| 61 | 1154913..1154924 | attR CAATTATATGAT | N/A | Click |
Region 4, total : 16 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1350030..1351370 | PHAGE_Megavi_lba: putative glutamine synthetase; SAOV_1310; phage(gi448825676) | 1e-12 | Click |
| 2 | 1351863..1352060 | PHAGE_Staphy_55: ORF073; SAOV_1311; phage(gi66396175) | 6e-07 | Click |
| 3 | 1352761..1352973 | PHAGE_Staphy_55: ORF073; SAOV_1312; phage(gi66396175) | 3e-07 | Click |
| 4 | 1353269..1353475 | PHAGE_Staphy_phiMR11: hypothetical protein; SAOV_1313; phage(gi162290174) | 3e-16 | Click |
| 5 | 1354171..1354281 | hypothetical protein; SAOV_1314 | N/A | Click |
| 6 | 1354697..1354897 | PHAGE_Staphy_55: ORF073; SAOV_1315; phage(gi66396175) | 6e-22 | Click |
| 7 | 1355409..1355825 | PHAGE_Staphy_52A: ORF019; SAOV_1316; phage(gi66396286) | 4e-25 | Click |
| 8 | complement(1356256..1356462) | PROPHAGE_Escher_CFT073: transposase/IS protein; SAOV_1317c; phage(gi26248359) | 6e-09 | Click |
| 9 | complement(1357345..1357476) | hypothetical protein; SAOV_1320c | N/A | Click |
| 10 | 1357644..1357760 | hypothetical protein; SAOV_1321 | N/A | Click |
| 11 | 1357890..1358141 | hypothetical protein; SAOV_1322 | N/A | Click |
| 12 | 1358302..1358580 | PHAGE_Staphy_StB27: scaffold protein; SAOV_1323; phage(gi431809709) | 1e-11 | Click |
| 13 | 1358630..1358860 | hypothetical protein; SAOV_1324 | N/A | Click |
| 14 | 1358912..1359034 | hypothetical protein; SAOV_1325 | N/A | Click |
| 15 | 1359264..1359416 | PHAGE_Staphy_StB27: minor head protein; SAOV_1326; phage(gi431809708) | 1e-05 | Click |
| 16 | 1359437..1359754 | PHAGE_Clostr_phiC2: putative head morphogenesis protein; SAOV_1327; phage(gi134287339) | 3e-07 | Click |
Region 5, total : 73 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1970718..1971473 | PROPHAGE_Ralsto_GMI1000: ISRSO11-transposase ORFA protein; SAOV_1901; phage(gi17546156) | 4e-06 | Click |
| 2 | 1971497..1972285 | PROPHAGE_Escher_MG1655: IS150 transposase B; SAOV_1902; phage(gi16131429) | 6e-39 | Click |
| 3 | complement(1972454..1972969) | conserved hypothetical protein; SAOV_1903 | N/A | Click |
| 4 | complement(1973099..1973260) | conserved hypothetical protein; SAOV_1904 | N/A | Click |
| 5 | complement(1973770..1974168) | PHAGE_Lister_B025: gp28; SAOV_1905; phage(gi157325245) | 5e-20 | Click |
| 6 | complement(1974158..1974685) | PHAGE_Lister_B025: gp27; SAOV_1906; phage(gi157325244) | 4e-36 | Click |
| 7 | complement(1974707..1974886) | PHAGE_Staphy_P954: hypothetical protein; SAOV_1907; phage(gi257136424) | 1e-25 | Click |
| 8 | complement(1975486..1976454) | PHAGE_Staphy_phiPV83: LukF-PV(P83) precursor; SAOV_1908; phage(gi9635737) | 0.0 | Click |
| 9 | complement(1976456..1977382) | PHAGE_Staphy_phiPV83: LukM precursor; SAOV_1909; phage(gi9635736) | 2e-179 | Click |
| 10 | complement(1977730..1978485) | PHAGE_Staphy_phiPV83: lytic enzyme (N-acetylmuramyl-Lalanine amidase); SAOV_1910; phage(gi9635735) | 5e-154 | Click |
| 11 | complement(1978497..1978730) | PHAGE_Staphy_phiPV83: holin; SAOV_1911; phage(gi9635734) | 2e-38 | Click |
| 12 | complement(1979040..1979147) | hypothetical protein; SAOV_1912c | N/A | Click |
| 13 | complement(1979290..1979520) | PHAGE_Staphy_phiPV83: phi PVL ORF 17 homologue; SAOV_1913c; phage(gi9635733) | 1e-36 | Click |
| 14 | 1979380..1979395 | attL AATATTCTTATCATTT | N/A | Click |
| 15 | complement(1979644..1979931) | PHAGE_Staphy_phiPV83: phi PVL ORF 22 homologue; SAOV_1914c; phage(gi9635732) | 8e-47 | Click |
| 16 | complement(1979978..1980130) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p56; SAOV_1915c; phage(gi9635731) | 8e-23 | Click |
| 17 | complement(1980120..1983905) | PHAGE_Staphy_phiPV83: phi PVL ORF 20 and 21 homologue; SAOV_1916c; phage(gi9635730) | 0.0 | Click |
| 18 | complement(1983921..1985411) | PHAGE_Staphy_phiPV83: phi PVL ORF 18 and 19 homologue; SAOV_1917c; phage(gi9635729) | 0.0 | Click |
| 19 | complement(1990116..1990238) | PHAGE_Staphy_1: hypothetical protein SPTP3101_gp46; SAOV_1919c; phage(gi156603935) | 1e-13 | Click |
| 20 | complement(1990298..1990744) | PHAGE_Staphy_phiPV83: phi PVL ORF 14 homologue; SAOV_1920c; phage(gi9635726) | 4e-80 | Click |
| 21 | complement(1990809..1991762) | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp46; SAOV_1921c; phage(gi156604063) | 3e-180 | Click |
| 22 | complement(1991763..1992143) | PHAGE_Staphy_phiPV83: phi PVL ORF 12 homologue; SAOV_1922c; phage(gi9635724) | 3e-71 | Click |
| 23 | complement(1992140..1992517) | PHAGE_Staphy_phiPV83: phi PVL ORF 11 homologue; SAOV_1923c; phage(gi9635723) | 4e-66 | Click |
| 24 | complement(1992517..1992849) | PHAGE_Staphy_1: putative phage head tail adapter; SAOV_1924c; phage(gi156603930) | 2e-60 | Click |
| 25 | complement(1992839..1993171) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p46; SAOV_1925c; phage(gi9635721) | 1e-58 | Click |
| 26 | complement(1993180..1993338) | PHAGE_Staphy_phiPV83: phi PVL ORF 8 homologue; SAOV_1926c; phage(gi9635720) | 2e-23 | Click |
| 27 | complement(1993374..1994621) | PHAGE_Staphy_3: head protein; SAOV_1927c; phage(gi156604057) | 0.0 | Click |
| 28 | complement(1994709..1995293) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p43; SAOV_1928c; phage(gi9635718) | 4e-109 | Click |
| 29 | complement(1995286..1996536) | PHAGE_Staphy_1: portal protein; SAOV_1929c; phage(gi156603925) | 0.0 | Click |
| 30 | complement(1996542..1996742) | PHAGE_Staphy_phiPV83: phi PVL ORF 3 homologue; SAOV_1930c; phage(gi9635716) | 8e-28 | Click |
| 31 | complement(1996756..1998450) | PHAGE_Staphy_phiPV83: phi PVL ORF 2 homologue; SAOV_1931c; phage(gi9635715) | 0.0 | Click |
| 32 | complement(1998450..1998920) | PHAGE_Staphy_phiPV83: phi PVL ORF 1 homologue; SAOV_1932c; phage(gi9635714) | 9e-81 | Click |
| 33 | complement(1999049..1999402) | PHAGE_Staphy_phiPV83: phi PVL ORF 63 homologue; SAOV_1933c; phage(gi9635713) | 3e-68 | Click |
| 34 | complement(1999409..1999861) | PHAGE_Staphy_3: hypothetical protein SPTP3103_gp33; SAOV_1934c; phage(gi156604050) | 8e-82 | Click |
| 35 | complement(1999976..2000437) | PHAGE_Staphy_phiPV83: phi PVL ORF 61 homologue; SAOV_1935c; phage(gi9635711) | 4e-80 | Click |
| 36 | complement(2000460..2000660) | PHAGE_Staphy_phiPV83: phi PVL ORF 60 homologue; SAOV_1936c; phage(gi9635710) | 5e-32 | Click |
| 37 | complement(2000660..2000809) | PHAGE_Staphy_phiNM3: hypothetical protein; SAOV_1937c; phage(gi118725087) | 7e-21 | Click |
| 38 | complement(2000806..2001012) | PHAGE_Staphy_42E: ORF081; SAOV_1938c; phage(gi66395571) | 3e-31 | Click |
| 39 | complement(2001012..2001194) | hypothetical protein; SAOV_1939c | N/A | Click |
| 40 | complement(2001206..2001448) | PHAGE_Staphy_phiMR11: hypothetical protein; SAOV_1940c; phage(gi162290140) | 5e-06 | Click |
| 41 | complement(2001485..2001997) | PHAGE_Staphy_80alpha: dUTPase; SAOV_1941c; phage(gi148717874) | 8e-90 | Click |
| 42 | complement(2001990..2002238) | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp27; SAOV_1942c; phage(gi215401135) | 5e-40 | Click |
| 43 | complement(2002231..2002506) | PHAGE_Staphy_X2: ORF058; SAOV_1943c; phage(gi66394720) | 8e-49 | Click |
| 44 | complement(2002506..2002916) | PHAGE_Staphy_SA11: hypothetical protein; SAOV_1944c; phage(gi422935588) | 7e-48 | Click |
| 45 | complement(2003168..2003410) | PHAGE_Staphy_3A: ORF049; SAOV_1945c; phage(gi66395634) | 1e-42 | Click |
| 46 | complement(2003414..2003782) | PHAGE_Staphy_55: ORF040; SAOV_1946c; phage(gi66396152) | 3e-65 | Click |
| 47 | complement(2003973..2004377) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p23; SAOV_1947c; phage(gi9635699) | 3e-71 | Click |
| 48 | complement(2004388..2004609) | PHAGE_Staphy_phiETA: hypothetical protein phiETA_24; SAOV_1948c; phage(gi17426252) | 2e-37 | Click |
| 49 | complement(2004612..2004827) | PHAGE_Staphy_phiMR11: hypothetical protein; SAOV_1949c; phage(gi162290127) | 7e-37 | Click |
| 50 | complement(2004824..2004985) | PHAGE_Staphy_phiMR11: putative helicase; SAOV_1950c; phage(gi162290126) | 5e-25 | Click |
| 51 | complement(2005000..2006064) | PHAGE_Staphy_X2: ORF010; SAOV_1951c; phage(gi66394680) | 0.0 | Click |
| 52 | complement(2006061..2006417) | PHAGE_Staphy_96: ORF042; SAOV_1952c; phage(gi66395927) | 2e-66 | Click |
| 53 | complement(2006380..2007168) | PHAGE_Staphy_29: ORF015; SAOV_1953c; phage(gi66396206) | 2e-136 | Click |
| 54 | complement(2007140..2007919) | PHAGE_Cronob_vB_CsaP_GAP52: putative homing endonuclease; SAOV_1954c; phage(gi414087523) | 1e-10 | Click |
| 55 | complement(2007919..2008587) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p19; SAOV_1955c; phage(gi9635696) | 5e-125 | Click |
| 56 | complement(2008601..2009026) | PHAGE_Staphy_phiPV83: single strand DNA binding protein; SAOV_1956c; phage(gi9635695) | 2e-68 | Click |
| 57 | complement(2009026..2009664) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p17; SAOV_1957c; phage(gi9635694) | 9e-119 | Click |
| 58 | complement(2009664..2010143) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p16; SAOV_1958c; phage(gi9635693) | 8e-85 | Click |
| 59 | complement(2010136..2010372) | PHAGE_Staphy_StB27: hypothetical protein; SAOV_1959c; phage(gi431809688) | 7e-19 | Click |
| 60 | complement(2010380..2010640) | PHAGE_Staphy_26: hypothetical protein SAP26_gp39; SAOV_1960c; phage(gi304443277) | 8e-46 | Click |
| 61 | complement(2010734..2011054) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p14; SAOV_1961c; phage(gi9635691) | 5e-51 | Click |
| 62 | complement(2011206..2011343) | PHAGE_Staphy_X2: ORF138; SAOV_1962c; phage(gi66394742) | 9e-19 | Click |
| 63 | 2011402..2011614 | hypothetical protein; SAOV_1963 | N/A | Click |
| 64 | complement(2011719..2011982) | PHAGE_Staphy_IPLA35: hypothetical protein SauSIPLA35_gp11; SAOV_1964c; phage(gi215401119) | 9e-45 | Click |
| 65 | complement(2012243..2012956) | PHAGE_Staphy_92: ORF018; SAOV_1965c; phage(gi66396424) | 7e-115 | Click |
| 66 | 2013013..2013222 | PHAGE_Staphy_CN125: hypothetical protein CURR002; SAOV_1966; phage(gi239507424) | 5e-33 | Click |
| 67 | complement(2013215..2013355) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p08; SAOV_1967c; phage(gi9635685) | 2e-19 | Click |
| 68 | complement(2013339..2013815) | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p07; SAOV_1968c; phage(gi9635684) | 2e-44 | Click |
| 69 | complement(2013828..2014070) | PHAGE_Staphy_P954: cro repressor-like protein; SAOV_1969c; phage(gi257136363) | 1e-41 | Click |
| 70 | 2014267..2014950 | PHAGE_Staphy_phiPV83: repressor; SAOV_1970; phage(gi9635682) | 5e-90 | Click |
| 71 | 2014962..2015816 | PHAGE_Staphy_P954: hypothetical protein; SAOV_1971; phage(gi257136360) | 4e-142 | Click |
| 72 | 2016034..2016219 | PHAGE_Staphy_phiPV83: hypothetical protein phiPV83p04; SAOV_1972; phage(gi9635681) | 2e-28 | Click |
| 73 | 2016255..2017238 | hypothetical protein; SAOV_1973 | N/A | Click |
| 74 | 2017114..2017129 | attR AATATTCTTATCATTT | N/A | Click |
| 75 | 2017417..2018463 | PHAGE_Staphy_phiNM: integrase; SAOV_1974; phage(gi118430725) | 0.0 | Click |
Region 6, total : 19 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2092393..2092416 | attL CCCACCCCAACTTGCATTGTCTGT | N/A | Click |
| 2 | complement(2098145..2099644) | PHAGE_Melano_entomopoxvirus: ORF MSV156 hypothetical protein; SAOV_2051c; phage(gi9631364) | 3e-07 | Click |
| 3 | complement(2099903..2100253) | PHAGE_Staphy_3: SCIN; SAOV_2052c; phage(gi156604075) | 2e-23 | Click |
| 4 | complement(2100512..2101003) | PHAGE_Staphy_PT1028: ORF010; SAOV_2053c; phage(gi66395174) | 8e-28 | Click |
| 5 | complement(2101169..2102227) | PHAGE_Staphy_2: phage capsid; SAOV_2054c; phage(gi156603997) | 3e-16 | Click |
| 6 | complement(2102214..2102420) | hypothetical protein; SAOV_2055c | N/A | Click |
| 7 | complement(2102401..2102607) | hypothetical protein; SAOV_2056c | N/A | Click |
| 8 | complement(2102645..2102989) | PHAGE_Staphy_PT1028: ORF013; SAOV_2057c; phage(gi66395177) | 1e-08 | Click |
| 9 | complement(2103660..2106032) | PHAGE_Lactoc_bIL310: helicase; SAOV_2058c; phage(gi13095886) | 6e-100 | Click |
| 10 | complement(2106124..2106423) | PHAGE_Staphy_PT1028: ORF016; SAOV_2059c; phage(gi66395180) | 2e-33 | Click |
| 11 | complement(2106424..2106648) | PHAGE_Staphy_phiMR25: hypothetical protein; SAOV_2060c; phage(gi189427130) | 3e-08 | Click |
| 12 | complement(2106784..2107101) | hypothetical protein; SAOV_2061c | N/A | Click |
| 13 | complement(2107115..2107756) | PHAGE_Xylell_Xfas53: Bro-N family protein; SAOV_2062c; phage(gi273810441) | 2e-14 | Click |
| 14 | complement(2107760..2107972) | putative transcriptional regulator; SAOV_2063c | N/A | Click |
| 15 | 2108126..2108788 | PHAGE_Clostr_PhiS63: gp36; SAOV_2064; phage(gi388570662) | 3e-06 | Click |
| 16 | 2108801..2109973 | PROPHAGE_Oceano_HTE831: integrase; SAOV_2065; phage(gi23097608) | 6e-42 | Click |
| 17 | complement(2110042..2111658) | PHAGE_Halocy_JM_2012: chaperonin GroEL; SAOV_2066c; phage(gi389060206) | 2e-67 | Click |
| 18 | complement(2111734..2112018) | PHAGE_Bacill_36: GroES; SAOV_2067c; phage(gi156564025) | 5e-16 | Click |
| 19 | 2112193..2112936 | probable membrane protein; SAOV_2068 | N/A | Click |
| 20 | complement(2112961..2114187) | PHAGE_Cafete_BV_PW1: hypothetical protein; SAOV_2069c; phage(gi310831380) | 6e-24 | Click |
| 21 | 2115154..2115177 | attR CCCACCCCAACTTGCATTGTCTGT | N/A | Click |