| Definition | Mycobacterium tuberculosis KZN 4207, complete genome. |
|---|---|
| Accession | CP001662 |
| Length | 4,394,985 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 19 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1431243..1432109) | PROPHAGE_Escher_CFT073: transposase; TBSG_01318; phage(gi26246249) | 8e-19 | Click |
| 2 | complement(1432137..1432418) | hypothetical arginine rich protein; TBSG_01319 | N/A | Click |
| 3 | complement(1432766..1433020) | hypothetical protein; TBSG_01320 | N/A | Click |
| 4 | complement(1433031..1433264) | hypothetical protein; TBSG_01321 | N/A | Click |
| 5 | complement(1433363..1433635) | hypothetical protein; TBSG_01322 | N/A | Click |
| 6 | 1433541..1433930 | hypothetical protein; TBSG_01323 | N/A | Click |
| 7 | 1433927..1434154 | hypothetical protein; TBSG_01324 | N/A | Click |
| 8 | 1434264..1434284 | attL TATTGCGCGTTTATTGCGCGG | N/A | Click |
| 9 | 1434299..1435426 | PHAGE_Mycoba_SWU1: integrase; TBSG_01325; phage(gi388570553) | 2e-57 | Click |
| 10 | 1435429..1435791 | phiRv2 phage protein; TBSG_01326 | N/A | Click |
| 11 | 1435808..1436068 | PHAGE_Mycoba_Ramsey: gp43; TBSG_01327; phage(gi206600224) | 2e-09 | Click |
| 12 | 1436065..1436457 | phiRv2 phage protein; TBSG_01328 | N/A | Click |
| 13 | 1436459..1437886 | phiRv2 phage protein; TBSG_01329 | N/A | Click |
| 14 | 1437883..1438128 | phiRv2 phage protein; TBSG_01330 | N/A | Click |
| 15 | 1438208..1438531 | phiRv2 phage protein; TBSG_01331 | N/A | Click |
| 16 | 1438563..1439189 | PHAGE_Nocard_NBR1: terminase small subunit; TBSG_01332; phage(gi372217587) | 4e-15 | Click |
| 17 | 1439342..1439875 | PHAGE_Rhodoc_RRH1: caudovirus prohead protease family protein; TBSG_01333; phage(gi372449807) | 2e-07 | Click |
| 18 | 1439883..1441322 | PHAGE_Rhodoc_REQ1: putative capsid protein; TBSG_01334; phage(gi372450101) | 5e-51 | Click |
| 19 | complement(1441732..1442100) | hypothetical protein; TBSG_01335 | N/A | Click |
| 20 | complement(1442210..1443208) | PHAGE_Mycoba_BPs: integrase; TBSG_01336; phage(gi189043119) | 1e-63 | Click |
| 21 | 1443676..1443696 | attR TATTGCGCGTTTATTGCGCGG | N/A | Click |
Region 2, total : 13 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(2366311..2366667) | PHAGE_Mycoba_Ramsey: gp56; TBSG_02195; phage(gi206600237) | 3e-10 | Click |
| 2 | complement(2366912..2368318) | PHAGE_Pseudo_MP38: putative tail component protein; TBSG_02196; phage(gi215479964) | 1e-06 | Click |
| 3 | complement(2368450..2369682) | PHAGE_Celeri_P12053L: putative phage tail fiber protein; TBSG_02197; phage(gi399528893) | 1e-05 | Click |
| 4 | complement(2370003..2371214) | PHAGE_Roseob_SIO1: gp7; TBSG_02198; phage(gi9964615) | 1e-06 | Click |
| 5 | complement(2371229..2371528) | PE family protein; TBSG_02199 | N/A | Click |
| 6 | 2371566..2371913 | hypothetical protein; TBSG_02200 | N/A | Click |
| 7 | 2372284..2372610 | PHAGE_Entero_4795: putative transposase OrfA protein of IS629; TBSG_02201; phage(gi157166066) | 8e-20 | Click |
| 8 | 2372661..2373545 | PHAGE_Burkho_phiE125: ISBt3 transposase subunit protein; TBSG_02202; phage(gi17975200) | 8e-85 | Click |
| 9 | 2373609..2373935 | PHAGE_Mycoba_Ramsey: gp56; TBSG_02203; phage(gi206600237) | 3e-05 | Click |
| 10 | 2374083..2376035 | PHAGE_Human__4: EBNA-1; TBSG_02204; phage(gi82503233) | 1e-65 | Click |
| 11 | complement(2376183..2377574) | PHAGE_Cyprin_1: membrane protein ORF65; TBSG_02205; phage(gi422933603) | 4e-07 | Click |
| 12 | complement(2377686..2378957) | PHAGE_Roseob_SIO1: gp7; TBSG_02206; phage(gi9964615) | 6e-06 | Click |
| 13 | complement(2379538..2381505) | PHAGE_Cercop_2: transcriptional regulator ICP4; TBSG_02207; phage(gi56694796) | 2e-05 | Click |
Region 3, total : 10 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 3243202..3243609 | PROPHAGE_Shewan_MR-1: ISSod6, transposase; TBSG_02964; phage(gi24374783) | 1e-16 | Click |
| 2 | 3243692..3244129 | PROPHAGE_Brucel_1330: ISBm1, transposase orfB; TBSG_02965; phage(gi23501425) | 1e-10 | Click |
| 3 | 3245325..3246152 | PHAGE_Cronob_vB_CsaP_GAP52: hypothetical protein; TBSG_02966; phage(gi414087485) | 5e-07 | Click |
| 4 | 3246229..3247404 | PHAGE_Pectob_My1: YadA domain-containing protein; TBSG_02967; phage(gi410491156) | 7e-09 | Click |
| 5 | 3247550..3247846 | esat-6 like protein esxJ; TBSG_02968 | N/A | Click |
| 6 | 3247873..3248157 | esat-6 like protein esxI; TBSG_02969 | N/A | Click |
| 7 | 3248268..3248606 | transposase; TBSG_02970 | N/A | Click |
| 8 | 3248640..3249326 | PHAGE_Burkho_KS9: tail length tape measure protein gp13; TBSG_02971; phage(gi255033744) | 5e-05 | Click |
| 9 | 3249289..3249783 | transposase; TBSG_02972 | N/A | Click |
| 10 | 3249965..3250738 | PHAGE_Ectoca_1: EsV-1-65; TBSG_02973; phage(gi13242537) | 1e-06 | Click |