| Definition | Escherichia coli DH1 (ME8569) DNA, complete genome. |
|---|---|
| Accession | AP012030 |
| Length | 4,621,430 |
Legend
| Hits against Virus and prophage DB | |
| Hits against Bacterial DB or GenBank file |
Region 1, total : 39 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 262123..262182 | attL CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA | N/A | Click |
| 2 | complement(262553..262894) | CP4-6 prophage; toxin of the YkfI-YafW toxin-antitoxin system; ECDH1ME8569_0232 | N/A | Click |
| 3 | complement(262915..263232) | CP4-6 prophage; antitoxin of the YkfI-YafW toxin-antitoxin system; ECDH1ME8569_0233 | N/A | Click |
| 4 | complement(263251..263472) | hypothetical protein; ECDH1ME8569_0234 | N/A | Click |
| 5 | complement(263481..263957) | CP4-6 prophage; putative DNA repair protein; ECDH1ME8569_0235 | N/A | Click |
| 6 | complement(263973..264431) | PHAGE_Pseudo_YuA: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_0236(gi162135127) | 9e-17 | Click |
| 7 | complement(264529..264768) | CP4-6 prophage; hypothetical protein; ECDH1ME8569_0237 | N/A | Click |
| 8 | complement(264845..265312) | CP4-6 prophage; hypothetical protein; ECDH1ME8569_0238 | N/A | Click |
| 9 | complement(265335..266192) | CP4-6 prophage; predicted DNA-binding transcriptional regulator; ECDH1ME8569_0239 | N/A | Click |
| 10 | complement(266409..267230) | PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_0240(gi414086954) | 2e-45 | Click |
| 11 | complement(267322..268185) | CP4-6 prophage; putative GTP-binding protein; ECDH1ME8569_0241 | N/A | Click |
| 12 | complement(268514..269407) | PHAGE_Burkho_phi1026b: gp58; putative; phage DNA-binding transcriptional regulator; ECDH1ME8569_0242(gi38707948) | 1e-23 | Click |
| 13 | 269467..269871 | PROPHAGE_Shewan_MR-1: ISSod1, transposase OrfA; partial; phage regulator of insertion element IS911A; ECDH1ME8569_0243(gi24373865) | 1e-08 | Click |
| 14 | 269828..270979 | PROPHAGE_Escher_MG1655: IS30 transposase; IS30; phage transposase; ECDH1ME8569_0244(gi16132105) | 0.0 | Click |
| 15 | 271055..271480 | PHAGE_Entero_Sf6: putative transposase OrfB; partial; phage transposase of insertion element IS911A; ECDH1ME8569_0245(gi41057343) | 1e-66 | Click |
| 16 | 272072..273217 | PHAGE_Vibrio_VHML: ORF37; ECDH1ME8569_0246; phage(gi27311204) | 1e-10 | Click |
| 17 | complement(273326..274306) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; ECDH1ME8569_0247; phage(gi16131377) | 0.0 | Click |
| 18 | 274550..275953 | CP4-6 prophage; predicted S-methylmethionine transporter; ECDH1ME8569_0248 | N/A | Click |
| 19 | 275940..276872 | homocysteine S-methyltransferase; ECDH1ME8569_0249 | N/A | Click |
| 20 | complement(276981..278027) | PHAGE_Plankt_PaV_LD: ABC transporter; predicted; phage ferric transporter subunit; ECDH1ME8569_0250(gi371496158) | 1e-23 | Click |
| 21 | complement(278039..278401) | predicted ferric transporter subunit; ECDH1ME8569_0251 | N/A | Click |
| 22 | complement(278403..278906) | PROPHAGE_Escher_MG1655: IS1 transposase B; IS1; phage transposase InsAB'; ECDH1ME8569_0252(gi16131317) | 4e-93 | Click |
| 23 | complement(279249..279587) | PROPHAGE_Xantho_33913: ISxac3 transposase; ECDH1ME8569_0253; phage(gi21231087) | 9e-24 | Click |
| 24 | complement(279610..279960) | hypothetical protein; ECDH1ME8569_0254 | N/A | Click |
| 25 | complement(280054..281208) | PROPHAGE_Ralsto_GMI1000: ISRSO12-transposase ORFB protein; predicted; phage DNA-binding transcriptional regulator; ECDH1ME8569_0255(gi17546158) | 2e-17 | Click |
| 26 | 281503..282411 | CP4-6 prophage; predicted lyase/synthase; ECDH1ME8569_0256 | N/A | Click |
| 27 | 282426..284393 | CP4-6 prophage; predicted dehydratase; ECDH1ME8569_0257 | N/A | Click |
| 28 | 284635..286002 | CP4-6 prophage; predicted sugar transporter; ECDH1ME8569_0258 | N/A | Click |
| 29 | 286014..287624 | CP4-6 prophage; predicted xylosidase/arabinosidase; ECDH1ME8569_0259 | N/A | Click |
| 30 | complement(287629..288387) | CP4-6 prophage; predicted DNA-binding transcriptional regulator; ECDH1ME8569_0260 | N/A | Click |
| 31 | complement(288526..289530) | PHAGE_Parame_1: Aspartate transcarbamylase; ornithine; phage carbamoyltransferase 2, chain F; ECDH1ME8569_0261(gi9631738) | 1e-12 | Click |
| 32 | complement(289874..290377) | PROPHAGE_Escher_MG1655: IS1 transposase B; IS1; phage transposase InsAB'; ECDH1ME8569_0262(gi16131317) | 4e-93 | Click |
| 33 | complement(290296..290571) | PHAGE_Entero_P1: InsA; ECDH1ME8569_0263; phage(gi46401643) | 1e-49 | Click |
| 34 | 290725..291456 | hypothetical protein; ECDH1ME8569_0264 | N/A | Click |
| 35 | complement(291547..292173) | CP4-6 prophage; conserved protein; ECDH1ME8569_0265 | N/A | Click |
| 36 | complement(292445..293143) | CP4-6 prophage; DNA-binding protein; ECDH1ME8569_0266 | N/A | Click |
| 37 | complement(293170..294024) | CP4-6 prophage; predicted protein; ECDH1ME8569_0267 | N/A | Click |
| 38 | complement(294457..295437) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; ECDH1ME8569_0268; phage(gi16131377) | 0.0 | Click |
| 39 | complement(295563..296003) | CP4-6 prophage; predicted protein; ECDH1ME8569_0269 | N/A | Click |
| 40 | complement(296120..297520) | PHAGE_Lactoc_bIL311: integrase; predicted; phage phage integrase; ECDH1ME8569_0270(gi13095659) | 7e-08 | Click |
| 41 | 297630..297689 | attR CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA | N/A | Click |
Region 2, total : 12 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(566399..567379) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; ECDH1ME8569_0521; phage(gi16131377) | 0.0 | Click |
| 2 | 567658..567873 | PHAGE_Stx2_c_II: holin; ECDH1ME8569_0522; phage(gi302393164) | 1e-28 | Click |
| 3 | 567873..568370 | PHAGE_Entero_cdtI: lysin; putative; phage lysozyme; ECDH1ME8569_0523(gi148609440) | 3e-92 | Click |
| 4 | 568367..568828 | PHAGE_Entero_HK629: cell lysis protein Rz; putative; phage murein endopeptidase; ECDH1ME8569_0524(gi428782076) | 2e-79 | Click |
| 5 | complement(568860..569153) | PHAGE_Escher_TL_2011c: Bor protein precursor; putative; phage lipoprotein; ECDH1ME8569_0525(gi418487071) | 2e-49 | Click |
| 6 | complement(569444..569896) | PHAGE_Entero_HK629: putative envelope protein; ECDH1ME8569_0526; phage(gi428782079) | 1e-83 | Click |
| 7 | 570140..570346 | PHAGE_Entero_HK629: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_0527(gi428782080) | 1e-32 | Click |
| 8 | 571094..571639 | PHAGE_Entero_HK629: terminase small subunit nu1; DNA; phage packaging protein; ECDH1ME8569_0528(gi428782012) | 1e-96 | Click |
| 9 | 571794..572357 | PHAGE_Entero_HK629: tail fiber assembly protein; ECDH1ME8569_0529; phage(gi428782036) | 5e-75 | Click |
| 10 | complement(572412..572996) | DLP12 prophage; predicted SAM-dependent methyltransferase; ECDH1ME8569_0530 | N/A | Click |
| 11 | 573135..573320 | PHAGE_Entero_HK629: tail fiber assembly protein; ECDH1ME8569_0531; phage(gi428782036) | 4e-06 | Click |
| 12 | 573941..574690 | DLP12 prophage; DNA-binding transcriptional activator; ECDH1ME8569_0532 | N/A | Click |
Region 3, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1174259..1174924) | e14 prophage; predicted SAM-dependent methyltransferase; ECDH1ME8569_1072 | N/A | Click |
| 2 | complement(1174925..1175620) | e14 prophage; predicted inner membrane protein; ECDH1ME8569_1073 | N/A | Click |
| 3 | 1176032..1176045 | attL ATTCATCTTATTTT | N/A | Click |
| 4 | 1176087..1176980 | e14 prophage; cell death peptidase, inhibitor ofT4 late gene expression; ECDH1ME8569_1074 | N/A | Click |
| 5 | 1177320..1177628 | PROPHAGE_Escher_MG1655: IS3 transposase A; IS3; phage element protein InsE; ECDH1ME8569_1075(gi226524700) | 4e-49 | Click |
| 6 | complement(1178488..1179459) | PHAGE_Entero_mEp235: integrase; predicted; phage integrase; ECDH1ME8569_1076(gi428781836) | 5e-43 | Click |
| 7 | complement(1179440..1179685) | e14 prophage; predicted excisionase; ECDH1ME8569_1077 | N/A | Click |
| 8 | complement(1179722..1180033) | e14 prophage; predicted protein; ECDH1ME8569_1078 | N/A | Click |
| 9 | 1180150..1180491 | e14 prophage; predicted protein; ECDH1ME8569_1079 | N/A | Click |
| 10 | complement(1180429..1180737) | PHAGE_Cronob_phiES15: hypothetical protein; predicted; phage protein; ECDH1ME8569_1080(gi401817573) | 2e-11 | Click |
| 11 | complement(1180912..1181586) | PHAGE_Entero_SfV: repressor; repressor; phage protein phage e14; ECDH1ME8569_1081(gi19549021) | 5e-132 | Click |
| 12 | 1181677..1181877 | PHAGE_Entero_SfV: repressor; predicted; phage DNA-binding transcriptional regulator; ECDH1ME8569_1082(gi19549022) | 7e-32 | Click |
| 13 | 1181921..1182478 | PHAGE_Entero_SfV: hypothetical protein SfVp36; ECDH1ME8569_1083; phage(gi19549023) | 3e-92 | Click |
| 14 | 1182475..1182813 | e14 prophage; predicted protein; ECDH1ME8569_1084 | N/A | Click |
| 15 | 1182823..1184190 | PHAGE_Entero_SfV: large terminase subunit; ECDH1ME8569_1085; phage(gi19548992) | 0.0 | Click |
| 16 | 1184202..1184384 | PHAGE_Salmon_ST64B: putative integral membrane protein; e14; phage prophage; ECDH1ME8569_1086(gi23505448) | 9e-29 | Click |
| 17 | 1184384..1184857 | PHAGE_Salmon_ST64B: Portal Protein; ECDH1ME8569_1087; phage(gi23505449) | 2e-75 | Click |
| 18 | 1184793..1185575 | PHAGE_Entero_SfV: tail protein; ECDH1ME8569_1088; phage(gi19549009) | 3e-143 | Click |
| 19 | 1185566..1186150 | PHAGE_Entero_SfV: tail protein; ECDH1ME8569_1089; phage(gi19548988) | 1e-113 | Click |
| 20 | 1186154..1186783 | PHAGE_Entero_SfV: hypothetical protein SfVp21; predicted; phage protein; ECDH1ME8569_1090(gi19548989) | 5e-54 | Click |
| 21 | 1186785..1187198 | PHAGE_Entero_mEp213: tail fiber assembly protein; predicted; phage protein; ECDH1ME8569_1091(gi428782612) | 6e-24 | Click |
| 22 | complement(1187170..1187772) | PHAGE_Entero_HK106: tail fiber assembly protein; predicted; phage tail fiber assembly protein; ECDH1ME8569_1092(gi428783304) | 3e-100 | Click |
| 23 | complement(1187772..1188308) | PHAGE_Entero_HK106: side tail fiber protein; ECDH1ME8569_1093; phage(gi428783303) | 7e-49 | Click |
| 24 | 1188338..1188892 | PHAGE_Entero_2: DNA-invertase; site-specific; phage DNA recombinase; ECDH1ME8569_1094(gi169936026) | 8e-89 | Click |
| 25 | 1188999..1189832 | PHAGE_Lactob_H: hypothetical protein; ECDH1ME8569_1095; phage(gi148750872) | 4e-05 | Click |
| 26 | 1190066..1190230 | isocitrate dehydrogenase; ECDH1ME8569_1096 | N/A | Click |
| 27 | complement(1190333..1190656) | PHAGE_Stx2_c_1717: hypothetical protein Stx2-1717_gp43; ECDH1ME8569_1097; phage(gi209447168) | 3e-42 | Click |
| 28 | complement(1191356..1191760) | PHAGE_Entero_HK629: putative envelope protein; ECDH1ME8569_1098; phage(gi428782079) | 2e-29 | Click |
| 29 | 1195324..1195337 | attR ATTCATCTTATTTT | N/A | Click |
Region 4, total : 32 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | complement(1393195..1394130) | PHAGE_Parame_FR483: hypothetical protein FR483_N404R; ECDH1ME8569_1288; phage(gi155370502) | 3e-08 | Click |
| 2 | 1394151..1394162 | attL AAATGGGGCAAA | N/A | Click |
| 3 | complement(1394182..1395417) | PHAGE_Gifsy_2: bacteriophage integrase; integrase;; phage ECDH1ME8569_1289(gi169257268) | 2e-90 | Click |
| 4 | complement(1395419..1395634) | hypothetical protein; ECDH1ME8569_1290 | N/A | Click |
| 5 | complement(1395713..1395922) | hypothetical protein; ECDH1ME8569_1291 | N/A | Click |
| 6 | complement(1395915..1396148) | restriction alleviation and modification protein; ECDH1ME8569_1292 | N/A | Click |
| 7 | complement(1396166..1396975) | PHAGE_Entero_epsilon15: RecT; ECDH1ME8569_1293; phage(gi30387413) | 1e-81 | Click |
| 8 | complement(1396968..1399568) | PHAGE_Erwini_phiEt88: exodeoxyribonuclease; ECDH1ME8569_1294; phage(gi327198600) | 1e-83 | Click |
| 9 | complement(1399670..1399945) | hypothetical protein; ECDH1ME8569_1295 | N/A | Click |
| 10 | complement(1400020..1400196) | PHAGE_Gifsy_2: hypothetical protein STM1010.1n.Gifsy2; ECDH1ME8569_1296; phage(gi169257274) | 5e-06 | Click |
| 11 | complement(1400190..1400411) | PHAGE_Escher_P13374: host killing protein; ECDH1ME8569_1297; phage(gi410491620) | 9e-06 | Click |
| 12 | 1400730..1401341 | PHAGE_Entero_lambda: Superinfection exclusion protein B; ECDH1ME8569_1298; phage(gi19263394) | 2e-07 | Click |
| 13 | complement(1401338..1401493) | PHAGE_Salico_CGphi29: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_1299(gi472340166) | 7e-10 | Click |
| 14 | complement(1401504..1401638) | hypothetical protein; ECDH1ME8569_1300 | N/A | Click |
| 15 | complement(1401947..1402423) | Rac prophage; putative DNA-binding transcriptional regulator; ECDH1ME8569_1301 | N/A | Click |
| 16 | 1402547..1402843 | PHAGE_Aggreg_S1249: phage protein; putative; phage DNA-binding transcriptional regulator; ECDH1ME8569_1302(gi273809591) | 2e-14 | Click |
| 17 | 1402866..1403288 | PHAGE_Entero_mEp237: CII protein; hypothetical; phage protein; ECDH1ME8569_1303(gi435439306) | 3e-08 | Click |
| 18 | 1403301..1404158 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; Lambda gpo homolog; hypothetical; phage protein; ECDH1ME8569_1304(gi169257279) | 9e-23 | Click |
| 19 | 1404165..1404911 | PHAGE_Gifsy_2: bacteriophage DNA replication protein; ECDH1ME8569_1305; phage(gi169257280) | 3e-76 | Click |
| 20 | 1404934..1405494 | predicted DNA-binding protein; ECDH1ME8569_1306 | N/A | Click |
| 21 | 1405527..1405826 | PHAGE_Entero_HK630: cell lysis protein Rz; ECDH1ME8569_1307; phage(gi428782852) | 4e-46 | Click |
| 22 | 1405946..1407421 | Rac prophage; potassium transporter subunit; ECDH1ME8569_1308 | N/A | Click |
| 23 | 1407559..1407822 | PHAGE_Psychr_pOW20_A: DNA methylase; hypothetical; phage protein; ECDH1ME8569_1309(gi472339820) | 6e-21 | Click |
| 24 | 1407803..1408162 | hypothetical protein; ECDH1ME8569_1310 | N/A | Click |
| 25 | 1408285..1408470 | hypothetical protein; ECDH1ME8569_1311 | N/A | Click |
| 26 | 1408636..1409664 | PHAGE_Escher_HK639: tail length tape measure protein; ECDH1ME8569_1312; phage(gi356870615) | 6e-27 | Click |
| 27 | 1409640..1409795 | PHAGE_Stx2_c_1717: outer membrane protein Lom precursor; ECDH1ME8569_1313; phage(gi209447197) | 1e-21 | Click |
| 28 | complement(1409928..1410908) | PROPHAGE_Escher_MG1655: IS5 transposase and trans-activator; ECDH1ME8569_1314; phage(gi16131377) | 0.0 | Click |
| 29 | 1410996..1411166 | PHAGE_Entero_cdtI: putative Lom-like outer membrane protein; ECDH1ME8569_1315; phage(gi148609401) | 4e-27 | Click |
| 30 | 1411231..1414593 | PHAGE_Entero_mEp460: side tail fiber protein; predicted; phage tail fiber protein; ECDH1ME8569_1316(gi428782336) | 2e-149 | Click |
| 31 | 1414593..1415168 | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; putative; phage tail fiber assembly protein; ECDH1ME8569_1317(gi16129505) | 9e-109 | Click |
| 32 | complement(1415266..1415856) | PHAGE_Escher_D108: G region invertase; ECDH1ME8569_1318; phage(gi281199698) | 7e-25 | Click |
| 33 | complement(1416173..1416439) | Rac prophage; predicted DNA-binding transcriptional regulator; ECDH1ME8569_1319 | N/A | Click |
| 34 | 1416994..1417005 | attR AAATGGGGCAAA | N/A | Click |
Region 5, total : 40 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 1601739..1601750 | attL AAAAAAGAGGTA | N/A | Click |
| 2 | 1606874..1606886 | attL ATATGTTTGAAAA | N/A | Click |
| 3 | 1611397..1611600 | PHAGE_Salmon_SSU5: putative selenium-binding protein YdfZ; ECDH1ME8569_1484; phage(gi410491512) | 1e-13 | Click |
| 4 | complement(1611635..1613095) | PHAGE_Microm_MpV1: hypothetical protein; ECDH1ME8569_1485; phage(gi313768442) | 1e-40 | Click |
| 5 | complement(1613184..1614467) | PHAGE_Burkho_phi1026b: gp59; ECDH1ME8569_1486; phage(gi38707949) | 1e-33 | Click |
| 6 | 1615221..1615487 | Qin prophage; predicted DNA-binding transcriptional regulator; ECDH1ME8569_1487 | N/A | Click |
| 7 | 1615804..1616394 | PHAGE_Escher_D108: G region invertase; putative; phage site-specific recombinase; ECDH1ME8569_1488(gi281199698) | 5e-25 | Click |
| 8 | complement(1616492..1617067) | PROPHAGE_Escher_MG1655: Qin prophage; predicted tail fibre assembly protein; putative; phage tail fibre assembly protein; ECDH1ME8569_1489(gi16129505) | 2e-109 | Click |
| 9 | complement(1617067..1618029) | PROPHAGE_Escher_MG1655: Qin prophage; predicted side tail fibre assembly protein; putative; phage site-specific recombinase; ECDH1ME8569_1490(gi16129506) | 0.0 | Click |
| 10 | complement(1617980..1618549) | PHAGE_Entero_HK630: terminase small subunit nu1; ECDH1ME8569_1491; phage(gi428782788) | 3e-94 | Click |
| 11 | 1618938..1619171 | PHAGE_Entero_2008: hypothetical protein YYZ_gp48; ECDH1ME8569_1492; phage(gi209427772) | 7e-21 | Click |
| 12 | 1619214..1619639 | PHAGE_Entero_HK629: putative envelope protein; ECDH1ME8569_1493; phage(gi428782079) | 1e-60 | Click |
| 13 | complement(1619791..1619964) | Qin prophage; hypothetical protein; ECDH1ME8569_1494 | N/A | Click |
| 14 | complement(1620136..1620312) | hypothetical protein; ECDH1ME8569_1495 | N/A | Click |
| 15 | complement(1620637..1620849) | PHAGE_Lactoc_bIL312: Csp; ECDH1ME8569_1496; phage(gi13095918) | 1e-15 | Click |
| 16 | complement(1621212..1621694) | PROPHAGE_Salmon_LT2: phage-tail assembly-like protein; ECDH1ME8569_1497; phage(gi16765210) | 2e-53 | Click |
| 17 | complement(1621706..1622239) | PHAGE_Entero_mEp460: endolysin; ECDH1ME8569_1498; phage(gi428782372) | 2e-97 | Click |
| 18 | complement(1622236..1622547) | PHAGE_Entero_mEp460: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_1499(gi428782371) | 1e-29 | Click |
| 19 | complement(1622552..1622758) | PHAGE_Entero_mEp460: porin; ECDH1ME8569_1500; phage(gi428782370) | 1e-31 | Click |
| 20 | 1622798..1622810 | attR ATATGTTTGAAAA | N/A | Click |
| 21 | complement(1623521..1623736) | PHAGE_Lactoc_bIL312: Csp; ECDH1ME8569_1501; phage(gi13095918) | 5e-16 | Click |
| 22 | 1624037..1624249 | Qin prophage; cold shock protein; ECDH1ME8569_1502 | N/A | Click |
| 23 | complement(1624671..1625423) | PHAGE_Entero_mEp460: late gene regulator; putative; phage antitermination protein Q; ECDH1ME8569_1503(gi428782366) | 4e-137 | Click |
| 24 | complement(1625437..1626486) | PHAGE_Entero_mEp460: hypothetical protein; Qin; phage prophage; ECDH1ME8569_1504(gi428782365) | 1e-113 | Click |
| 25 | complement(1626833..1627081) | Qin prophage; hypothetical protein; ECDH1ME8569_1505 | N/A | Click |
| 26 | complement(1627301..1627456) | PHAGE_Stx2_c_II: putative host killer protein; ECDH1ME8569_1506; phage(gi302393105) | 3e-19 | Click |
| 27 | complement(1627528..1627815) | Qin prophage; toxin of the RelE-RelB toxin-antitoxin system; ECDH1ME8569_1507 | N/A | Click |
| 28 | complement(1627815..1628054) | bifunctional antitoxin/transcriptional repressorRelB; ECDH1ME8569_1508 | N/A | Click |
| 29 | 1628079..1628384 | Qin prophage; predicted protein; ECDH1ME8569_1509 | N/A | Click |
| 30 | 1628587..1628919 | Qin prophage; hypothetical protein; ECDH1ME8569_1510 | N/A | Click |
| 31 | complement(1629304..1629513) | Qin prophage; hypothetical protein; ECDH1ME8569_1511 | N/A | Click |
| 32 | complement(1629528..1629818) | Qin prophage; hypothetical protein; ECDH1ME8569_1512 | N/A | Click |
| 33 | complement(1629802..1630032) | PHAGE_Pectob_ZF40: putative cro anti-repressor; ECDH1ME8569_1513; phage(gi422936651) | 1e-08 | Click |
| 34 | 1630116..1630523 | PHAGE_Cronob_phiES15: putative transcriptional repressor DicA; ECDH1ME8569_1514; phage(gi401817574) | 5e-33 | Click |
| 35 | 1630690..1630845 | PHAGE_Salico_CGphi29: hypothetical protein; ECDH1ME8569_1515; phage(gi472340166) | 2e-09 | Click |
| 36 | 1630847..1630975 | predicted protein; ECDH1ME8569_1516 | N/A | Click |
| 37 | 1631005..1631223 | conserved hypothetical protein; Qin prophage; ECDH1ME8569_1517 | N/A | Click |
| 38 | 1631791..1631979 | putative regulator of cell division; ECDH1ME8569_1518 | N/A | Click |
| 39 | 1631976..1632167 | Qin prophage; hypothetical protein; ECDH1ME8569_1519 | N/A | Click |
| 40 | 1632260..1633180 | hypothetical protein; ECDH1ME8569_1520 | N/A | Click |
| 41 | 1633694..1634890 | PHAGE_Entero_2008: putative integrase; ECDH1ME8569_1521; phage(gi209427727) | 1e-135 | Click |
| 42 | complement(1634910..1635020) | predicted protein, truncated; ECDH1ME8569_1522 | N/A | Click |
| 43 | 1635034..1635045 | attR AAAAAAGAGGTA | N/A | Click |
| 44 | complement(1635078..1636097) | PHAGE_Synech_S_SM2: zinc-containing alcohol dehydrogenase superfamily protein; ECDH1ME8569_1523; phage(gi326781942) | 2e-18 | Click |
Region 6, total : 18 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2451235..2451250 | attL TTGCAGGTTCGATTCC | N/A | Click |
| 2 | 2451426..2452583 | PROPHAGE_Escher_MG1655: CPS-53 (KpLE1) prophage; predicted prophage CPS-53 integrase; ECDH1ME8569_2286; phage(gi16130281) | 0.0 | Click |
| 3 | 2452736..2453098 | PHAGE_Entero_SfV: putative flippase; bactoprenol-linked; phage glucose translocase; ECDH1ME8569_2287(gi19549013) | 1e-58 | Click |
| 4 | 2453095..2454015 | PHAGE_Entero_SfV: bactoprenol glucosyltransferase; bactoprenol; phage glucosyltransferase; ECDH1ME8569_2288(gi19549012) | 6e-163 | Click |
| 5 | 2454012..2455343 | CPS-53 (KpLE1) prophage; predicted inner membrane protein; ECDH1ME8569_2289 | N/A | Click |
| 6 | 2455684..2455986 | PHAGE_Entero_HK106: tail fiber assembly protein; ECDH1ME8569_2290; phage(gi428783304) | 2e-46 | Click |
| 7 | complement(2455958..2456398) | PHAGE_Entero_mEp213: tail fiber assembly protein; hypothetical; phage protein; ECDH1ME8569_2291(gi428782612) | 2e-26 | Click |
| 8 | complement(2456425..2457018) | PHAGE_Entero_SfV: hypothetical protein SfVp21; ECDH1ME8569_2292; phage(gi19548989) | 2e-51 | Click |
| 9 | complement(2456993..2457268) | PHAGE_Entero_SfV: DNA adenine methylase; ECDH1ME8569_2293; phage(gi19549028) | 2e-50 | Click |
| 10 | complement(2457268..2457756) | PHAGE_Entero_SfV: hypothetical protein SfVp40; hypothetical; phage protein; ECDH1ME8569_2294(gi19549027) | 2e-87 | Click |
| 11 | complement(2457759..2458127) | PHAGE_Entero_HK140: DNA replication protein O; ECDH1ME8569_2295; phage(gi428781991) | 3e-14 | Click |
| 12 | 2458401..2458847 | PHAGE_Entero_SfV: hypothetical protein SfVp32; predicted; phage protein; ECDH1ME8569_2296(gi19549019) | 8e-63 | Click |
| 13 | 2458913..2459737 | PHAGE_Entero_SfV: hypothetical protein SfVp31; hypothetical; phage protein; ECDH1ME8569_2297(gi19549018) | 3e-151 | Click |
| 14 | 2459865..2460401 | PHAGE_Entero_SfV: hypothetical protein SfVp30; hypothetical; phage protein; ECDH1ME8569_2298(gi19549017) | 3e-99 | Click |
| 15 | 2460392..2460754 | PHAGE_Entero_SfV: hypothetical protein SfVp29; hypothetical; phage protein; ECDH1ME8569_2299(gi19549016) | 5e-67 | Click |
| 16 | 2460754..2461059 | PHAGE_Entero_SfV: hypothetical protein SfVp28; hypothetical; phage protein; ECDH1ME8569_2300(gi19549015) | 3e-52 | Click |
| 17 | 2460975..2461115 | PHAGE_Entero_SfV: excisionase; ECDH1ME8569_2301; phage(gi19548990) | 2e-19 | Click |
| 18 | 2461156..2461171 | attR TTGCAGGTTCGATTCC | N/A | Click |
| 19 | 2461191..2461391 | PHAGE_Entero_HK633: hypothetical protein; ECDH1ME8569_2302; phage(gi428782548) | 3e-34 | Click |
| 20 | complement(2461575..2462510) | PHAGE_Burkho_phi1026b: gp58; ECDH1ME8569_2303; phage(gi38707948) | 1e-15 | Click |
Region 7, total : 27 CDS
| # | CDS_POSITION | BLAST_HIT | E-VALUE | SEQUENCE |
|---|---|---|---|---|
| 1 | 2733706..2733718 | attL GAAGCCCTGCCTG | N/A | Click |
| 2 | 2734068..2735309 | PHAGE_Entero_P4: integrase; ECDH1ME8569_2541; phage(gi9627511) | 1e-65 | Click |
| 3 | complement(2735553..2736509) | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2542 | N/A | Click |
| 4 | 2736553..2736765 | PHAGE_Entero_P4: transcriptional regulator; DNA-binding; phage transcription alactivator; ECDH1ME8569_2543(gi9627517) | 9e-05 | Click |
| 5 | 2736894..2738303 | PHAGE_Entero_TLS: YfiJ; hypothetical; phage protein; ECDH1ME8569_2544(gi148734544) | 1e-06 | Click |
| 6 | 2738456..2739082 | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2545 | N/A | Click |
| 7 | complement(2739260..2741449) | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2546 | N/A | Click |
| 8 | complement(2741446..2743062) | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2547 | N/A | Click |
| 9 | complement(2743422..2743685) | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2548 | N/A | Click |
| 10 | 2743827..2744900 | CP4-57 prophage; RNase LS; ECDH1ME8569_2549 | N/A | Click |
| 11 | 2744893..2745264 | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2550 | N/A | Click |
| 12 | 2745619..2746482 | CP4-57 prophage; putative GTP-binding protein; ECDH1ME8569_2551 | N/A | Click |
| 13 | 2746574..2747395 | PHAGE_Cronob_vB_CsaM_GAP32: hypothetical protein; hypothetical; phage protein; ECDH1ME8569_2552(gi414086954) | 6e-45 | Click |
| 14 | 2747612..2748313 | CP4-57 prophage; putative DNA-binding transcriptional regulator; ECDH1ME8569_2553 | N/A | Click |
| 15 | 2748354..2748590 | CP4-57 prophage; putative inner membrane protein; ECDH1ME8569_2554 | N/A | Click |
| 16 | 2748590..2749033 | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2555 | N/A | Click |
| 17 | 2749057..2749524 | CP4-57 prophage; hypothetical protein; ECDH1ME8569_2556 | N/A | Click |
| 18 | complement(2749749..2750063) | hypothetical protein; ECDH1ME8569_2557 | N/A | Click |
| 19 | complement(2750076..2750669) | arsenite transporter; ECDH1ME8569_2558 | N/A | Click |
| 20 | complement(2750745..2750945) | hypothetical protein; ECDH1ME8569_2559 | N/A | Click |
| 21 | complement(2750885..2751067) | CP4-57 prophage; predicted protein, truncated; ECDH1ME8569_2560 | N/A | Click |
| 22 | 2751227..2752930 | CP4-57 prophage; predicted inner membrane protein; ECDH1ME8569_2561 | N/A | Click |
| 23 | 2753828..2754286 | PHAGE_Pseudo_YuA: hypothetical protein; putative; phage antirestriction protein; ECDH1ME8569_2562(gi162135127) | 4e-15 | Click |
| 24 | 2754295..2754777 | CP4-57 prophage; putative DNA repair protein; ECDH1ME8569_2563 | N/A | Click |
| 25 | 2754786..2754986 | hypothetical protein; ECDH1ME8569_2564 | N/A | Click |
| 26 | 2755024..2755341 | CP4-57 prophage; antitoxin of the YpjF-YfjZ toxin-antitoxin system; ECDH1ME8569_2565 | N/A | Click |
| 27 | 2755362..2755691 | CP4-57 prophage; toxin of the YpjF-YfjZ toxin-antitoxin system; ECDH1ME8569_2566 | N/A | Click |
| 28 | 2755397..2755409 | attR GAAGCCCTGCCTG | N/A | Click |
| 29 | complement(2756055..2760554) | PHAGE_Cronob_vB_CsaM_GAP32: long tail fiber proximal subunit; ECDH1ME8569_2567; phage(gi414087138) | 2e-19 | Click |